A neuronal composition, method for culturing and use thereof

Abstract

The application discloses a neuron composition and a culture method and application thereof. The culture method comprises the following steps: constructing a vector containing a cell transdifferentiation gene combination; the cell transdifferentiation gene combination comprises NGN2 and SOX11; infecting and transfecting starting cells by using the vector; the starting cells comprise human peripheral blood mononuclear cells; culturing the infected starting cells by using a neuron induction transformation culture medium, inducing differentiation, and obtaining early-stage neurons; culturing the early-stage neurons by using a neuron differentiation maturation culture medium, and obtaining mature-stage neurons. The method can realize direct transformation of blood-derived cells into a multi-modal sensory neuron, an intermediate neuron and a motor neuron composition. The neurons provided by the application can be applied to the construction of a neurological disease model, the construction of an in-vitro neuromuscular junction (NMJ) functional model, drug screening, transplantation research, a multi-modal biosensor and multi-modal sensory signal decoding.

Description

[0001] This application claims priority to Chinese Patent Application No. 202610156528.0, filed on February 4, 2026, entitled "A Neuron and Its Reprogramming Culture Method and Application", the entire contents of which are incorporated herein by reference. Technical Field

[0002] This application belongs to the fields of genetic engineering and biotechnology, and relates to the fields of direct reprogramming of somatic cells and neurobiology. Specifically, it relates to a method for inducing the direct reprogramming of human blood mononuclear cell line THP-1 into functional neurons with electrophysiological activity by inducing transcription factors in combination with small molecule compounds. Background Technology

[0003] The central nervous system of adult mammals lacks the ability to regenerate itself. Once neurons are damaged or lost, they usually cannot be repaired, resulting in a lack of effective cures for many neurological diseases (such as spinal cord injury, traumatic brain injury, Alzheimer's disease, and amyotrophic lateral sclerosis).

[0004] Neuronal reprogramming technology, through transcription factors or small molecule compounds, directly transforms non-neuronal cells into functional neurons, providing a new direction for neural regeneration research. Current reprogramming research primarily focuses on fibroblasts or glial cells, while studies targeting peripheral blood-derived cells are relatively limited.

[0005] Neurogenin 2 (Ngn2) is a neuron-specific basic helical-loop-helical (bHLH) transcription factor that controls the expression of many homologous domain proteins. It can determine the neuronal fate of ectodermal cells and plays a crucial role in the formation of neurons from cortical progenitor cells, ventral spinal cord progenitor cells and neurons, motor neurons, and neuronal subtype coordination. Sox11 is essential for the survival of neural progenitor cells, the survival and maturation of neurons, and both have been shown to effectively mediate the reprogramming of ectofibroblasts into neurons.

[0006] THP-1 cells, as a typical human peripheral blood mononuclear cell line, possess advantages such as stable origin, ease of culture, and high reproducibility, making them ideal initiating cells for reprogramming. However, an efficient induction system for their transformation into neuronal lineages has not yet been established. Therefore, there is an urgent need for an efficient induction strategy combining transcription factors and small molecule compounds to achieve the direct reprogramming of THP-1 cells into functional neurons, providing a feasible source of humanized neuronal cells for the construction of neurological disease models and drug screening. Summary of the Invention

[0007] To address the aforementioned technical problems, this application provides compositions of multimodal sensory neurons, interneurons, and motor neurons, along with their reprogramming culture methods and applications. The method provided in this application enables the direct conversion of blood-derived monocytes into neuronal lineages, offering an efficient and feasible technical approach for constructing neurological disease models, drug screening, and neural regeneration research.

[0008] In a first aspect, this application provides a method for reprogramming and culturing a neuronal composition, comprising: A vector containing a combination of cell transdifferentiation genes was constructed; the combination of cell transdifferentiation genes includes NGN2 and SOX11. The vector is used to infect or transfect initiating cells; the initiating cells include human peripheral blood mononuclear cells. Infected or transfected initiating cells are cultured in a neuron-inducing conversion medium and induced to differentiate, resulting in early neurons. The neuron-inducing conversion medium comprises a basal medium and a combination of a first small molecule compound. Early neurons were cultured using a neuronal differentiation and maturation culture medium to obtain mature neurons; the neuronal differentiation and maturation culture medium included a basal culture medium and a combination of second small molecule compounds.

[0009] In one possible implementation, the genes in the cell transdifferentiation gene combination are homologous genes derived from humans, mice, or any other species.

[0010] In one possible implementation, the method of infecting the initiating cells includes infecting the initiating cells using vectors including lentiviruses, adenoviruses, and retroviruses.

[0011] In one possible implementation, the method of transfecting the cells includes transfecting using chemical or physical methods.

[0012] Furthermore, the chemical transfection methods include: liposome transfection, calcium phosphate co-precipitation, and cationic polymers (such as PEI). These bind to negatively charged nucleic acids to form complexes, which are then stored in the cell.

[0013] Furthermore, the physical transfection methods include: electroporation (creating temporary pores in the cell membrane using electrical pulses), microinjection (direct injection with a needle), gene gun (bombarding with microparticles), and other methods.

[0014] In one possible implementation, the culture vessel is pre-coated with a coating matrix during the culturing of infected or transfected initiating cells. The coating matrix is ​​selected from at least one of laminin, gelatin, fibronectin, and Matrigel.

[0015] In one possible implementation, the first combination of small molecule compounds includes one or more of XMU-MP-1, FSK, and LDN.

[0016] Furthermore, the first small molecule compound combination also includes FGF family proteins.

[0017] In one possible implementation, the first combination of small molecule compounds comprises: XMU-MP-1; and, Choose one or both of FSK and LDN.

[0018] Furthermore, the first small molecule compound combination also includes FGF family proteins.

[0019] In one possible implementation, the second small molecule compound combination includes one or more of the following: FSK, Kenpaullone, CHIR-99021, LDN, SB, RA, and Hit3.

[0020] Furthermore, the second small molecule compound combination also includes one or more of BDNF, GDNF, and NT3.

[0021] In a second aspect, this application provides a neuronal composition obtained by culturing using the method described in the first aspect, the neuronal composition comprising multimodal sensory neurons, interneurons, and motor neurons.

[0022] In one possible implementation, the multimodal sensory neuron is capable of expressing specific marker proteins, including specific marker proteins expressed by one or more of peripheral sensory-like neurons, retinal-like neurons, and LEPR-positive neurons.

[0023] In one possible implementation, the interneurons include LEPR-positive interneurons and PIEZO1 / 2-positive interneurons.

[0024] In one possible implementation, the motor neuron is capable of expressing specific marker proteins, including one or more of ISL1 and HB9.

[0025] Thirdly, this application provides the use of the neuronal composition described in the second aspect in screening neuroprotective agents, regeneration promoters, and drugs that regulate TRP channels, PIEZO channels, LEPR receptors, and retinal-like neuron-related receptors.

[0026] Fourthly, this application provides a kit containing the neuronal composition described in the second aspect for screening neuroprotective agents, regeneration promoters, and drugs regulating TRP channels, PIEZO channels, LEPR receptors, and retinal-like neuron-related receptors.

[0027] Fifthly, this application provides a method for conducting transplantation studies using the neuronal composition described in the second aspect for non-therapeutic purposes, the transplantation studies being used in animal models of nerve injury or neurodegenerative diseases, the method comprising: transplanting the neuronal composition described in the second aspect into the central nervous system of a non-human mammal, and detecting the survival of the neurons.

[0028] Sixthly, this application provides the use of the neuronal composition described in the second aspect in constructing an in vitro neuromuscular junction functional model.

[0029] In a seventh aspect, this application provides a neuron-inducing transformation culture medium, comprising: a basal culture medium and a first small molecule compound combination and a second small molecule compound combination.

[0030] In one possible implementation, the first molecular compound combination includes one or more of XMU-MP-1, FSK, and LDN.

[0031] Furthermore, the first small molecule compound combination also includes FGF family proteins.

[0032] In one possible implementation, the second small molecule compound combination includes one or more of the following: FSK, Kenpaullone, CHIR-99021, LDN, SB, RA, and Hit3.

[0033] Furthermore, the second small molecule compound combination also includes one or more of BDNF, GDNF, and NT3.

[0034] Eighthly, this application provides the use of the culture medium described in the seventh aspect in a composition for inducing differentiation of human peripheral blood mononuclear cells based on NGN2-SOX11 to obtain multimodal sensory neurons, interneurons and motor neurons.

[0035] The beneficial effects of this application are as follows: 1. Establishment of an innovative culture method: For the first time, a culture method was established that allows for the direct, rapid, and efficient reprogramming of the human blood mononuclear cell line THP-1 into a series of functional neurons without requiring a pluripotent stem cell stage. This method involves staged culture in a specific induction culture system, inducing cells to acquire typical neuron-like morphology within one week, gradually maturing within 3-4 weeks, and expressing neuron-specific markers such as Tuj1, Map2, and NeuN at the transcriptional level.

[0036] 2. Well-developed technical process: A stable induction process from suspended immune cells to adherent neurons has been established, with good reproducibility and ease of operation.

[0037] 3. This application has explored the key regulatory mechanisms in the process of reprogramming neurons using innovative culture methods.

[0038] 4. Unique model system: It establishes an ideal model for studying the cross-border switching mechanism between the immune system and the nervous system.

[0039] 5. Rigorous functional verification: Sensory channel function was verified by detecting TRPV1, TRPM8, TRPA1, and PIEZO agonist responses through calcium imaging; spontaneous discharge, induced discharge by stimulants targeting different receptor channels, and photoinduced photoresponse electrical signals of retinal-like neurons were detected by MEA (microelectrode array) to prove the presence of a neuronal electrical activity network; this dual verification makes the definition of "functional neuron" more rigorous.

[0040] 6. Broad Application Potential: Derived from human peripheral blood cells, this technology theoretically allows for further reprogramming into autologous immune cells, providing a feasible cell source for future personalized neural repair. This application offers a feasible, humanized, and scalable cell source for constructing models of neurodegenerative diseases, screening neuropharmaceuticals, building in vitro neuromuscular junction (NMJ) functional models, transplantation research, developing multimodal biosensors, decoding multimodal sensory signals, and constructing central-peripheral interaction organoid models, thus advancing the application of neural regeneration research and disease mechanism analysis.

[0041] 7. Drug screening value: TRP channel positive cells can be used for pain drug screening and TRP channel modulator testing; PIEZO channel positive cells can be used for screening novel mechanosensitive channel activators, RBC volume regulation drugs, and blood flow sensing-related drugs; LEPR positive neurons can be used for screening drugs that enhance leptin sensitivity and anti-leptin resistance drugs; motor neurons, interneurons, and retinal-related neurons can be used for transplantation research, demonstrating significant translational application value. Attached Figure Description

[0042] Figure 1 This diagram illustrates the transformation analysis of THP-1 cells directly reprogrammed into neurons, as provided in this embodiment of the application, showcasing the basic method and flow of induced reprogramming, as well as the morphology and characteristics of the reprogrammed neurons. Figure 1 In the diagram, (A) shows the basic method and timeline for inducing THP-1 cells to reprogram into neurons; (B) shows the morphological changes and expression of the neuronal marker protein TUJ1 at different time points under neuronal induction culture conditions after THP-1 cells were infected with LV-GFP or LV-NGN2-SOX11 (LV-NSG). GFP was used to label successfully infected cells (n=20 randomly selected 20x fields from three samples); (C) shows a comparison of the reprogramming efficiency of transducing NGN2, SOX11, or NGN2-SOX11, respectively, with the statistical time being day 7 after induction (mean ± sem, n=20 randomly selected 20x fields from three samples); (DE) compares the effects of no addition, single use of small molecules, or combined use on reprogramming efficiency based on LV-NGN2-SOX11 infection. Reprogramming efficiency is defined as TUJ1. + / GFP + Cell proportions (±sem, n=10 randomly selected 20x fields from three samples); (FG) shows that transformed cells express MAP2, a marker of mature neurons, at different time points, and reprogramming efficiency (TUJ1) is calculated separately. + / GFP + ) and the proportion of mature neurons (MAP2) + / GFP + (H) shows the expression of mature neuronal and synapse-related markers inducing neurons, including neuronal nuclear antigen (NeuN), synaptotagmin 1 (SYT1), synapsin 1 (SYN1), and postsynaptic density protein 95 (PSD95).

[0043] Figure 2 The data map provided for embodiments of this application shows early morphological changes in THP-1 reprogrammed into neurons, not polarized macrophages. Figure 2In the middle section, (A, B) immunofluorescence analysis was performed on the phenotypic characteristics of THP-1 cells induced to polarize to M0, M1, and M2, respectively. The expression of macrophage-related markers CD68 (M0), CD86 (M1), CD206 (M2), and neuron-specific marker TUJ1 was detected and compared with TiN cells in the early stage of induction (6 dpi). GFP was used to label successfully infected cells (n=10 randomly selected 20x fields from three samples); (C) The expression ratio of CD molecules in early TiN cells was statistically analyzed; (D, E, F) Polarization treatment significantly reduced the lentiviral infection efficiency of THP-1 cells (GFP). + ) and neuron reprogramming efficiency (TUJ1) + / GFP + (G) Schematic diagram of live cell dynamic imaging experimental design, changes in bright field morphology and GFP fluorescence expression of cells at different time points during live cell dynamic imaging (one image is displayed every 6-10 h); (H) After dynamic imaging, cells in the same field of view are stained with immunofluorescence to detect the expression of neuron-specific marker TUJ1 to verify the neuronal identity of the reprogrammed cells.

[0044] Figure 3 This is a comparative diagram showing the induced TiN maturation by the second combination of small molecule compounds. GFP shows infected cells, TUJ1 shows neurons, and MAP2 shows mature neurons to compare the morphology and maturation status of neurons.

[0045] Figure 4 The reprogrammed TiN neurons provided in this application embodiment possess detectable spontaneous electrical activity, functional voltage-gated calcium channels, and depolarization-dependent excitatory membrane properties. Among these, Figure 4 In the diagram, (A) shows the preparation process for the MEA-based detection of firing capacity. On day 7 after transformation, all cells were reselected and flow cytometry was performed to sort out GFP-positive cells and seed them into 24-well plates loaded with MEA chips. (B) shows the spontaneous firing of reprogrammed neurons on day 21. No firing was detected in well C2, while one electrode in each of wells C3 and C4 collected obvious firing signals. Several different waveforms were collected at each electrode, representing the firing phenomena of multiple neurons. (C) shows the changes in calcium signal of TiN stimulated by KCL detected by calcium imaging.

[0046] Figure 5 This is a category attribute analysis diagram of the THP-1 reprogrammed neurons provided in an embodiment of this application. Figure 5In the diagram, (A) shows the experimental design; (B, C) show the detection of motor neuron-specific markers ISL1 and HB9 by RT-qPCR and immunofluorescence, with ChAT representing a marker of cholinergic neurons; (D, E, F) show the detection of sensory neuron-specific markers by RT-qPCR and immunofluorescence, with green fluorescent GFP indicating target cells infected with lentivirus, red fluorescent TUJ1 indicating neurons, white fluorescent indicating specific signals, and blue fluorescent HST indicating the cell nucleus. TRKA is one of the markers of sensory neurons, and TRPV1, TRPA1, and TRPM8 are all members of the transient receptor potential channel family, mainly expressed in sensory neurons (especially peripheral small-diameter neurons), mediating pain, chemical stimulation perception, and temperature perception, respectively; (G) shows the curves of ΔF / F0 changing over time in response to different stimuli: different ion channel agonists stimulating TiN; Cap, Menthol, and AITC induce subtype-specific Ca 2+ The control DMSO showed no calcium signal response; the ΔF / F0 distribution of all reprogrammed neurons that responded to different stimuli was shown, suggesting the presence of some TRPV1, TRPA1, TRPM8 or LEPR positive functional neurons; (H) Schematic diagram of MEA detection process and bright field diagram of cultured TiN; (I) The electrical signal response state of TiN to different TRP receptor stimulants is shown, with Cap, Menthol and AITC corresponding to the thermal pain receptor TRPV1, the cold receptor TRPM8 and the chemostimulation receptor TRPA1, respectively.

[0047] Figure 6 This is a diagram illustrating the results of newly formed neurons expressing mechanosensitive receptors and possessing mechanosensitive transduction capabilities, as provided in an embodiment of this application. Figure 6 In the study, (A) immunofluorescence staining was used to detect the expression of PIEZO1 and PIEZO2; (B) RT-qPCR analysis was used to detect the upregulation of PIEZO1 and PIEZO2 expression; (C) calcium imaging was used to detect that TiN neurons produced significant calcium signal fluctuations after stimulation with the PIEZO1-specific stimulant YODA1; and (D) under the same stimulation conditions, MEA was used to detect the electrical signal response induced by the stimulant.

[0048] Figure 7 The diagram illustrates the results of newly formed neurons expressing LEPR and responding to LEP calcium signals, as provided in this embodiment of the application. Figure 7In the study, (A) immunofluorescence staining was used to detect the expression of LEPR; (B) RT-qPCR analysis was used to detect the upregulation of LEPR expression; (C) calcium imaging was used to detect significant calcium signal fluctuations in TiN neurons after stimulation with leptin (LEP); (D) MEA was used to detect the electrical signal response induced by the stimulant under the same stimulation conditions; and (E) bioinformatics analysis was used to show multiple subpopulations of the generated neuronal composition.

[0049] Figure 8 The image shows the results of newly formed neurons expressing retinal-like neuron-specific markers and specifically responding to 475nm blue light, as provided in the embodiments of this application. Figure 8 In the diagram, (A) is the experimental design diagram; (B) shows a group of cells that highly express retinal-like neuron-related genes, mainly ipRGCs and bipolar cells, after grouping neurons according to specific markers and Top genes; (C) shows the classification of specific neurons identified according to specific markers; (D) shows the expression of TUJ1, PIEZO, and LEPR; (E) shows the immunofluorescence of some markers of ipRGCs, including BRN3A and OPN4; (F) RT-qPCR analysis detected the upregulation of the expression of the blue light-specific photosensitive protein OPN4; (G) shows the electrical signal response of this type of neuron to 475nm blue light as detected by MEA; (H) shows the immunofluorescence of photoreceptors in cone and rod cells, including RHO, OPN1SW, and OPN1MW / LW; (I) is a schematic diagram of the response of light-stimulated neurons to MEA; and (J) shows the electrical signal response of TIN under blue light stimulation.

[0050] Figure 9 This is a statistical graph showing the expression of subtype-specific receptors in newly formed neurons, as provided in the embodiments of this application. Darker colors represent strong positive signals.

[0051] Figure 10 The early regulatory mechanism of newly formed neurons provided in the embodiments of this application involves multiple signaling pathways. Among them, Figure 10In the study, (A) experimental design for sequencing analysis of reprogrammed cells in the early stage (0-7 days); (B, C) cell groups were formed based on specific markers, mainly into THP-1, cT, TtN, TiN, and Macro; (D) preliminary analysis showed the expression of neuronal development-related genes EBF1 and DCX; (E) pathway enrichment analysis showed that multiple signaling pathways, including but not limited to the Apelin signaling pathway, Hippo signaling pathway, and Wnt signaling pathway, were significantly upregulated in the early formation stage of TiN; (F) based on the pseudo-temporal expression pattern analysis of genes, several key molecules in the Apelin signaling pathway were identified.

[0052] Figure 11 The diagram shows the test results of XMU-MP-1 activation of YAP promoting early reprogramming of THP-1 in embodiments of this application. It demonstrates that the YAP activator XMU-MP-1 significantly promotes the structural complexity of mature TiN, while inhibition using the YAP inhibitor Verteporfin delays this process. Figure 11 In the figures, (A, B) show that immunofluorescence detection shows that adding YAP inhibitors in the early stage of reprogramming significantly delayed the elongation of newly generated neurons, while counting showed no effect on reprogramming efficiency; (C) In the early stage of reprogramming (using the basic conditions of FSK, LDN and FGF2, i.e., FLF2), adding the YAP activator XMU-MP-1 can significantly promote the early elongation of neurites of induced neurons (TiN); (D) shows the morphology of reprogrammed neurons cultured for 15 days with or without the addition of XMU-MP-1, as well as the expression of TUJ1 and MAP2, showing that XMU-MP-1 significantly promotes higher morphological maturity and more complex neurite structures in mature TiN.

[0053] Figure 12 One of the final products obtained in the embodiments of this application is a motor neuron graph. Figure 12 In the diagram, (A) is a schematic diagram of the co-culture experiment. (B) Immunofluorescence staining shows that after 21 days of co-culture, the nerve endings of TiN (green, GFP) expressed the presynaptic marker SV2 (red) and co-localized with the positive signal of the postsynaptic acetylcholine receptor marker α-BTX on the skeletal muscle cell membrane, indicating that a functional neuromuscular junction was formed between TiN and muscle cells. No specific co-localization was observed in the control group.

[0054] Figure 13 This is a diagram showing the calcium signal response of neurons to different channel receptor stimulants, such as TRP channel, PIEZO channel, and LEP receptor stimulants, obtained in the embodiments of this application. Figure 13In the diagram, (A) is a schematic diagram of the experimental design; (B) shows some neurons that respond to calcium signals during the time period of monitoring calcium ion signals. Figure 13 This confirms that the multimodal neuron composition obtained in the embodiments of this application can simultaneously express multiple functional receptors.

[0055] Figure 14 This is a diagram showing the electrical signal response of neurons to light stimulation of different wavelengths, obtained in an embodiment of this application.

[0056] Figure 15 This is an immunofluorescence image of neurons surviving and developing in the mouse spinal cord, obtained in an embodiment of this application. Figure 15 In the diagram, (A) shows the overall picture of transplanted neurons to the spinal cord after injury; (B) shows the expression of TUJ1 in control cells and TiN neurons in vivo by immunofluorescence detection; and (C) shows the survival status of TiN neurons in vivo and the expression of the maturation marker MAP2 at different time points after transplantation. Detailed Implementation

[0057] The technical solutions of the embodiments of this application will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this application, and not all embodiments. Based on the embodiments of this application, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this application.

[0058] In the description of this application, the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of indicated technical features. Thus, a feature defined as "first" or "second" may explicitly or implicitly include one or more of the stated features. In the description of this application, "multiple" means two or more, unless otherwise explicitly specified.

[0059] In the description of this application, the term "for example" is used to mean "used as an example, illustration, or description." Any embodiment described as "for example" in this application is not necessarily to be construed as being more preferred or advantageous than other embodiments. The following description is provided to enable any person skilled in the art to make and use this application. Details are set forth in the following description for purposes of explanation. It should be understood that those skilled in the art will recognize that this application can be made without using these specific details. In other instances, well-known structures and processes will not be described in detail to avoid unnecessarily obscuring the description of this application. Therefore, this application is not intended to be limited to the embodiments shown, but is consistent with the broadest scope of the principles and features disclosed in this application.

[0060] This application provides a method for reprogramming and cultivating neurons, including: S101. Construct a vector containing a combination of cell transdifferentiation genes; the combination of cell transdifferentiation genes includes NGN2 and SOX11; S102. Infect or transfect starting cells using the vector; the starting cells include human peripheral blood mononuclear cells. S103. Infected or transfected starting cells are cultured in neuron-inducing and transforming medium and induced to differentiate to obtain early neurons; the neuron-inducing and transforming medium includes a combination of basal medium and a first small molecule compound. S104. Early neurons are cultured using a neuronal differentiation and maturation culture medium to obtain mature neurons; the neuronal differentiation and maturation culture medium includes a basal culture medium and a combination of second small molecule compounds.

[0061] In one possible implementation, the genes in the cell transdifferentiation gene combination are homologous genes derived from humans, mice, or any other species.

[0062] In one possible implementation, the method of infecting the initiating cells includes infecting the initiating cells using vectors including lentiviruses, adenoviruses, and retroviruses.

[0063] In one possible implementation, the method of transfecting the cells includes transfecting using chemical or physical methods.

[0064] Furthermore, the chemical transfection methods include: liposome transfection, calcium phosphate co-precipitation, and cationic polymers (such as PEI). These bind to negatively charged nucleic acids to form complexes, which are then stored in the cell.

[0065] Furthermore, the physical transfection methods include: electroporation (using electrical pulses to create temporary pores in the cell membrane), microinjection (direct injection with a needle), gene gun (bombardment with microparticles), and other methods.

[0066] Furthermore, the vector is used to infect the initiating cells. The vector is a lentiviral vector, and the promoter in the lentiviral vector that regulates the expression level is selected from CMV.

[0067] Furthermore, during the construction of lentiviral vectors, cell transdifferentiation gene combinations can be linked using 2A sequences from different sources (e.g., T2A, E2A, P2A, F2A, etc.) or IRES sequences, and fluorescent reporter genes can be introduced.

[0068] In one possible implementation, the culture vessel is pre-coated with a coating matrix during the culturing of infected or transfected initiating cells. The coating matrix is ​​selected from at least one of laminin, gelatin, fibronectin, and Matrigel.

[0069] In one possible implementation, the main components of the complete culture medium include: a mixture of DMEM (Dulbecco's Modified Eagle Medium, 1×), F-12 (Ham's F-12 Nutrient Mixture, 1×), and Neurobasal (1×) in a volume ratio of 2:2:1; wherein 2% B-27 (50×) neuronal nutrient additive, 1% penicillin-streptomycin (100×) in a volume ratio, and 1% N-2 (100×) additive may or may not be added.

[0070] In one possible implementation, the first combination of small molecule compounds includes one or more of XMU-MP-1, FSK, and LDN.

[0071] Furthermore, the first small molecule compound combination also includes one or two of the FGF family proteins.

[0072] In one possible implementation, the first combination of small molecule compounds comprises: XMU-MP-1; and Choose one or both of FSK and LDN.

[0073] Furthermore, the first small molecule compound combination also includes FGF family proteins.

[0074] Specifically, the FGF family protein is selected from at least one of the group consisting of FGF2-FGF8. Preferably, the FGF family protein is selected from FGF2 or FGF8.

[0075] Furthermore, in the first small molecule compound combination, based on complete culture medium, the amount of FSK added is 2.5-20 μM, the amount of XMU-MP-1 added is 0.25-1 μM, the amount of LDN added is 0.5-2.5 μM, and the amount of FGF2 / FGF8 added is 0-50 ng / mL.

[0076] Preferably, the amount of FSK added is 10 μM, the amount of XMU-MP-1 added is 0.5 μM, the amount of LDN added is 1 μM, and the amount of FGF family proteins such as FGF2 / FGF8 added is 10 ng / mL.

[0077] In one possible implementation, the second small molecule compound combination includes one or more of the following: FSK, Kenpaullone, CHIR-99021, LDN, SB, RA, Hit3, etc.

[0078] Furthermore, the second small molecule compound combination also includes one or more of BDNF, GDNF, and NT3.

[0079] Furthermore, in the second small molecule compound combination, based on complete culture medium, the added amounts of FSK are 0-10 μM, Kenpaullone is 0.25-2.5 μM, CHIR-99021 is 0.25-2 μM, LDN is 0-1 μM, SB is 0.5-10 μM, RA is 0.25-2 μM, Hit3 is 0.5-5 μM, BDNF is 10-50 ng / mL, GDNF is 10-50 ng / mL, and NT3 is 10-50 ng / mL.

[0080] Preferably, in the second small molecule compound combination, based on complete culture medium, the added amounts of FSK are 5 μM, Kenpaullone is 1 μM, CHIR-99021 is 1 μM, LDN is 0.25 μM, SB is 2.5 μM, RA is 1 μM, Hit3 is 2.5 μM, BDNF is 10 ng / mL, GDNF is 10 ng / mL, and NT3 is 10 ng / mL.

[0081] It should be noted that the starting cells used in this application are human peripheral blood mononuclear cells, specifically THP-1 cells, which are distinct from other cells such as skin cells. Studies have reported that skin cells and other cells may contain contamination with neuronal precursor cells, meaning that not all successfully transformed neurons may originate entirely from fibroblasts. THP-1 cells, however, are peripheral blood immune cells originating from the mesodermal hematopoietic lineage, and are more distantly related to the nervous system in terms of developmental lineage. Furthermore, they have undergone over forty years of in vitro suspension culture, resulting in virtually no neuronal precursor cell contamination. In addition, compared to skin cells, blood cells are easier and more readily available, involve minimal trauma, and are produced in considerable quantities.

[0082] The following is an explanation of some of the terms.

[0083] XMU-MP-1 is a reversible and selective MST1 / 2 inhibitor and a YAP activator, capable of activating YAP nuclear translocation. Its CAS number is 2061980-01-4, and its structural formula is as follows: .

[0084] LDN (LDN193189) is a potent and selective BMP type I receptor inhibitor, CAS number 1062368-24-4, with the following structural formula: .

[0085] FSK stands for Forskolin, a classic cAMP activator, with CAS number 66575-29-9.

[0086] DM is also an effective BMP receptor inhibitor.

[0087] FGF2, also known as basic FGF (bFGF), is one of the earliest recognized members of the FGF family.

[0088] FGF8 is also a member of the fibroblast growth factor (FGF) family. Members of the FGF family have broad mitotic and cell survival-promoting activities and participate in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion.

[0089] Kenpaullone is a potent CDK1 / cyclin B and GSK-3β inhibitor, CAS number 142273-20-9.

[0090] CHIR-99021 is a GSK-3α and GSK-3β inhibitor.

[0091] SB (SB431542) is a potent selective BMP type I receptor inhibitor and a selective ALK5 inhibitor.

[0092] RA (Retinoic acid) is an active metabolite of vitamin A. It can act as a high-affinity ligand for the retinoic acid X receptor (RXR) and can also activate the retinoic acid receptor (RAR).

[0093] Hit3 (K02288) is a highly selective BMP receptor inhibitor.

[0094] BDNF stands for brain-derived neurotrophic factor.

[0095] GDNF stands for glial cell-derived neurotrophic factor (GDNF).

[0096] NT3 neurotrophic factor 3 is a member of the neurotrophic factor family, and together with nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), etc., it constitutes the structure-related protein family.

[0097] Verteporfin (CL 318952) is a YAP inhibitor that disrupts the YAP-TEAD interaction. Its structural formula is as follows:

[0098] Matri-gel (354234, Corning) is a soluble basement membrane matrix extracted from Engelbreth-Holm-Swarm (EHS) mouse sarcoma rich in extracellular matrix proteins.

[0099] The sequence of the NGN2 gene is shown in SEQ ID NO.1, and the sequence is as follows: ATGttcgtcaaatccgagaccttggagttgaaggaggaagaggacgtgttagtgctgctcggatcggcctcccccgccttggcggccctgaccccgctgtcatccagcgccgacgaagaagaggaggaggagccgggcgcgtcaggcggggcgcgtcggcagcgcggggctgaggccgggcagggggcgcggggcggcgtggctgcgggtgcggagggctgccggcccgcacggctgctgggtctggtacacgattgcaaacggcgcccttcccgggcgcgggccgtctcccgaggcgccaagacggccgagacggtgcagcgcatcaagaagacccgtagactgaaggccaacaaccgcgagcgaaaccgcatgcacaacctcaacgcggcactggacgcgctgcgcgaggtgctccccacgttccccgaggacgccaagctcaccaagatcgagaccctgcgcttcgcccacaactacatctgggcactcaccgagaccctgcgcctggcggatcactgcgggggcggcggcgggggcctgccgggggcgctcttctccgaggcagtgttgctgagcccgggaggagccagcgccgccctgagcagcagcggagacagcccctcgcccgcctccacgtggagttgcaccaacagccccgcgccgtcctcctccgtgtcctccaattccacctccccctacagctgcactttatcgcccgccagcccggccgggtcagacatggactattggcagcccccacctcccgacaagcaccgctatgcacctcacctccccatagccagggattgtatcTAG The sequence of the SOX11 gene is shown in SEQ ID NO. 2, and the sequence is as follows: In the method described in this application, the NGN2 gene, in synergy with SOX11, plays a decisive role in the differentiation of different types of nerve cells during nervous system development. NGN2 is not only a fate determinant for motor neurons but also plays a crucial role in the development of peripheral DRG sensory neurons and the differentiation of TrkA / B / C subtypes. The effective combination of the above genes can induce the generation of functional neurons with functional expression of sensory neuron-related receptors, as described in this application. Under the action of the gene combination, and in conjunction with relevant culture media, especially neuronal induction and transformation media, the method described in this application can induce the generation of a large number of new neurons within one week, and the obtained neurons have high survival rate and purity. It should be emphasized that XMU-MP-1 activates YAP to promote early reprogramming of THP-1, significantly promotes neuronal morphogenesis and structural program initiation, and significantly promotes the structural complexity of mature TiN.

[0100] The above preparation method can specifically include the following steps in practical applications: a. The above-mentioned genes are constructed individually or in combination into commercially available or proprietary lentiviral vectors. The promoters regulating expression levels in each vector are CMV, GFAP, IBA1, etc. Simultaneously, these genes can be linked using 2A sequences from different sources (e.g., T2A, E2A, P2A, F2A, etc.) or IRES sequences. Optionally, green or red fluorescent reporter genes can be further introduced to determine viral packaging quality and titer, observe changes in cell morphology, determine cell purity, and for various subsequent specific application analyses. The control vector pCSC-SP-PW-GFP (aka: pBOB-GFP) (Plasmid #12337) is commercially available.

[0101] b. The above gene vectors are packaged into corresponding lentiviruses through cell transfection, the titers of various viruses are measured, the amount of virus used to infect donor cells is determined, and the infection rate of various viruses reaches 70%~100%.

[0102] c. Place the starting cells in complete culture medium and adjust to a certain cell density (approximately 5 × 10⁶). 5 (units / mL).

[0103] d. Seed cells in wells containing complete culture medium, add an appropriate amount of lentiviral particles for infection, and incubate overnight. During infection, polybrene can be added to enhance infection efficiency.

[0104] e. Inoculate infected THP-1 cells into culture dishes pre-coated with at least one of laminin, gelatin, fibronectin, and Matrigel. Simultaneously replace the complete culture medium with neuronal induction medium. The neuronal induction medium is a C2 culture medium supplemented with a first small molecule composition. The C2 culture comprises a neuronal basal medium of DMEM (1×), F-12 (1×), and Neurobasal (1×) in a 2:2:1 ratio, supplemented with 0.5%-2% (v / v) of B-27 (50×) neuronal nutrient additive, 1% (v / v) of penicillin-streptomycin (double antibiotic), and optional 0.5%-1% (v / v) of N-2 (100×) additive. The first small molecule compound combination may include one or more of XMU-MP-1, FSK, and LDN. The first small molecule compound combination may also include one or two of the FGF family proteins.

[0105] f. Starting from the day the neuron induction medium is added (Day 1), replace half of the medium every other day to maintain the compound concentration and ensure that the transformation efficiency exceeds 90%. Untransformed cells will continue to proliferate and form grape-like clusters that are easy to float, which can be removed during the medium change process.

[0106] g. After culturing in the neuron induction medium for 7 days, replace the medium with neuron differentiation and maturation medium using a half-replacement method. The neuron differentiation and maturation medium mainly consists of FSK (5 μM), Kenpaullone (1 μM) (Kenpaullone can be replaced with any of the above-listed substances with similar signaling pathway inhibitory or activating effects), BDNF (10-20 ng / mL), GDNF (10-20 ng / mL), and NT3 (10-20 ng / mL). The basal medium remains C2. Before changing the medium, gently shake the cell culture plate to remove any non-adherent THP-1 cells. The neuron differentiation and maturation medium is changed twice a week, maintaining stable culture for at least 28 days.

[0107] h. Real-time dynamic imaging of cells was used to track the transformation process. After viral infection, the culture plate was placed in the live cell module of the BC43 confocal microscope. From the time the medium was changed to neural induction medium (day 1) to day 5, the morphological changes and movement trajectories of the cells were recorded. At the end of the tracking, the neurons in the tracking field were immunofluorescence stained to further confirm the identity of the reprogrammed neurons.

[0108] i. Characterize the neurons prepared above. This characterization may include, for example, the following aspects: (1) Neuron category attribute analysis: including preliminary identification of neuron subtypes and detection of neuron functional activity (calcium imaging), etc.; (2) The spontaneous firing ability of neurons.

[0109] The following detailed embodiments further illustrate this point.

[0110] Example 1: Neuron Reprogramming Culture See Figure 1 (A) This figure illustrates the basic method and time points for inducing THP-1 cells to reprogram into neurons: THP-1 cells were infected with lentivirus (LV-Ngn2-Sox11-EGFP, titer approximately 1e9 vg / mL, MOI = 10–30). After overnight infection, the medium was replaced with neuron induction medium containing a combination of small molecule compounds (day 1). Half of the neuron induction medium was replaced every other day. After days 6–8, half of the medium was replaced with neuron induction maturation medium, and the cells were cultured until different time points for immunofluorescence staining. A basic method for rapidly and efficiently inducing THP-1 cells to reprogram into neurons was established.

[0111] Specifically, the method for constructing the lentivirus (LV-Ngn2-Sox11-EGFP) described in this application embodiment is as follows: 1. The construction method of recombinant plasmid pLV3-NGN2-Sox11-EGFP includes: The NGN2 and SOX11 genes were cloned into a lentiviral expression vector (pLV3-CMV-IRES-EGFP) carrying the EGFP reporter gene to construct the recombinant plasmid pLV3-NGN2-Sox11-EGFP. The lentiviral expression vector (pLV3-CMV-IRES-EGFP) was modified from a self-purchased pLV3-ISRE-EGFP (P105203, MIAOLING).

[0112] 1.1 Design primers using Snapgene software (all from 5' to 3', F for forward primer and R for reverse primer): The sequence of NGN2-F is shown in SEQ ID NO.3: ATCCACCGGTGCCACCATGTTCGTCAAATCCGAGACCTTG The sequence of NGN2-R is shown in SEQ ID NO.4: GCTTCGGCCAGTAACGTTAGGGGGGGGGGCGGAATTCATGATACAATCCCTGGCTATGGG The sequence of Sox11-F is shown in SEQ ID NO.5: GCGCTACCGGACTCAGATCCGCCACCATGGTGCAGCAGGCCG The sequence of Sox11-R is shown in SEQ ID NO.6: CTTGATCCCTCGAGCGTACTTCAATACGTGAACACCAGGTCGG The sequence of the linearized vector backbone Bone-F is shown in SEQ ID NO.7: GGTGGCACCGGTGGAT The sequence of the linearized vector backbone Bone-R is shown in SEQ ID NO.8: AGTACGCTCGAGGGATCAAG The sequence of IRES EGFP-T2A-F is shown in SEQ ID NO.9: CCTAACGTTACTGGCCGAAGC The sequence of IRES EGFP-T2A-R is shown in SEQ ID NO.10: GGATCTGAGTCCGGTAGCGC 1.2 Using human cell cDNA and mouse cell cDNA as templates, respectively, the sequences of NGN2 and Sox11 were obtained by PCR using the above primers. Using pLV3-CMV-IRES-EGFP as a template, PCR was performed using primers targeting bone and IRES GFP T2A, and the products were recovered. The gel recovery kit from Tiangen Biotech was used, and the high-fidelity PCR mix was purchased from Nanjing Novizan Biotech Co., Ltd.

[0113] 1.3 After recovering the above four products, homologous recombination was performed using the Vazyme Ultra One StepCloning Kit V2ClonExpres (C116-01, Vazyme) from Novizan.

[0114] 1.4. The recombinant product was transformed into Stbl3 competent cells (commercially available). Single clones were picked and cultured, followed by plasmid extraction and sequencing verification. The plasmid extraction kit was commercially available (DP103, TIANGEN). After successful sequencing verification, plasmid extraction and lentivirus packaging were performed.

[0115] 2. Packaging methods for lentivirus (LV-Ngn2-Sox11-EGFP), including: 2.1 Using a lentiviral packaging system, the recombinant plasmid pLV3-NGN2-Sox11-EGFP and the helper plasmids pMDLg / pRRE, pRSV-Rev, and pMD2.G were co-transfected into HEK293T cells in logarithmic growth phase (with a confluence of 80%–90%) at a ratio of 4:2:2:1. PEI was used as the transfection reagent, with a plasmid to PEI ratio of 1:3. Fresh culture medium was replaced 6–8 hours after transfection.

[0116] 2.2 Collect the supernatant containing virus particles at 24 h and 48 h after changing the medium.

[0117] 2.3 Combine the virus fluids collected in the two collections and centrifuge at 3000 rpm for 10 min at 4 ℃ to remove cell debris. After centrifugation, take the supernatant and filter it through a 0.45 μm filter membrane to obtain the recombinant lentivirus LV-Ngn2-Sox11-EGFP.

[0118] 2.4 The obtained viral solution can be used directly for target cell infection, or aliquoted and stored at -80℃ for later use. The packaging plasmid, transfection reagent PEI, and HEK293T cells can all be commercially available.

[0119] It is understood that the construction and packaging of the lentivirus are mature technologies, and its main function is as a delivery tool for genes NGN2 and SOX11. Other technologies that can play a similar role can also be used as alternatives. Therefore, the construction of the lentivirus is merely an illustrative example and not a limiting statement.

[0120] Specifically, the method for culturing neurons includes the following steps: 1.1 Stable culture and passage of THP-1 cells THP-1 cells are a typical human peripheral blood mononuclear cell line, maintained using suspension culture. Cells were placed in culture flasks containing RPMI-1640 complete medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin mixture, and cultured stably in a 37°C, 5% CO2 incubator. To maintain optimal cell growth, when the cell density reached approximately 5 × 10⁻⁶ cells / year... 5 ~1×10 6 When the cell density reaches 10 cells / mL, passage is performed. During passage, first thoroughly mix the cell suspension, then transfer about 1 / 3 to 1 / 2 of the cell volume into a culture flask containing fresh complete culture medium to make up the volume, and continue culturing.

[0121] During long-term culture, cell morphology and growth density should be observed regularly to avoid overgrowth or cell aggregation. The culture medium should be replaced with fresh medium every 2-3 days. Since THP-1 is a suspension cell line, trypsin digestion is not required during passage.

[0122] 1.2 Pre-treatment of THP-1 cells for reprogramming: Introduction of transcription factors mediated by lentivirus To achieve direct reprogramming of THP-1 cells into neuronal lineages, transcription factors (NGN2 and SOX11) related to neural fate determination were introduced into THP-1 cells via a lentiviral vector system. The lentiviral vector contained the target transcription factor genes and GFP fluorescent markers to assess infection efficiency and track infected target cells. In this embodiment, NGN2 and SOX11 were derived from humans and mice, respectively. The cDNA sequence of human NGN2 is shown in SEQ ID NO.1, and the cDNA sequence of mouse SOX11 is shown in SEQ ID NO.2.

[0123] Before infection, THP-1 cells in the logarithmic growth phase were collected and counted, and the cell density was adjusted to approximately 5 × 10⁻⁶. 5 Cells were then seeded into 12-well plates containing complete culture medium, and an appropriate amount of lentiviral particles (LV-Ngn2-Sox11-GFP, titer approximately 1e9 vg / mL, MOI = 10~30) were added. 8 μg / mL of polybrene was also added to enhance infection efficiency. After mixing, the cells were centrifuged horizontally at 900 g for 1 h. After centrifugation, the cells were incubated overnight at 37°C and 5% CO2.

[0124] After infection, the medium was replaced with neuron-inducing and transforming medium for continued culturing. The vector contained a fluorescent label (EGFP), and the infection efficiency could be observed using a fluorescence microscope.

[0125] 1.3 Establishing a specific method for Ngn-Sox11 combined with small molecule compounds to mediate THP-1 reprogramming. Pretreatment for neuronal differentiation induction: After infection, infected THP-1 cells were seeded onto Matrigel-coated cell culture plates and replaced with neuronal induction media (containing a combination of small molecule compounds). The formulation consisted of C2 medium supplemented with: FSK (10 μM), LDN (1 μM), and neurotrophic factor FGF2 (10-20 ng / mL). The C2 medium composition was DMEM:F12:Neurobasal in a ratio of 2:2:1, supplemented with 2% B-27 neuronal culture additive. By comparing different compound combinations, the NGN2-SOX11 combined with FSK, LDN, and FGF2 group was found to have the highest transformation efficiency.

[0126] Building upon this, the embodiments of this application further screened out that NGN2-SOX11 combined with YAP activators XMU-MP-1, LDN, and FGF2 can also reprogram THP-1 cells into neurons. Compared to neurons reprogrammed using the combination of FSK, LDN, and FGF2, this combination exhibits higher axonal and dendritic complexity. Furthermore, NGN2-SOX11 combined with YAP activators XMU-MP-1, FSK, LDN, and FGF2 can reprogram more complex neurons faster and more efficiently. It was found that XMU-MP-1 significantly promoted neurite elongation and complexity in reprogrammed neurons, with a final concentration of 0.5 μM for XMU-MP-1.

[0127] Neuronal differentiation induction: Starting from the day the induction medium is added (Day 1), half of the medium is replaced every other day to maintain the compound concentration and ensure that the conversion efficiency exceeds 90%. Unconverted cells will continue to proliferate and form grape-like clusters that are easy to float, which can be removed during medium replacement.

[0128] Neuronal differentiation and maturation: After 7 days of culture, the medium was replaced with neuronal differentiation and maturation medium using a half-change method. The main components added to this medium were FSK (5 μM), Kenpaullone (1 μM), BDNF (10-20 ng / mL), GDNF (10-20 ng / mL), and NT3 (10-20 ng / mL). The basal medium remained C2. Before changing the medium, the cell culture plate was gently shaken to remove any non-adherent THP-1 cells. The neuronal differentiation and maturation medium was changed twice a week to maintain stable culture for more than 28 days.

[0129] Example 2: Verification of Neuron Identity Induced cells were collected at different time points for immunofluorescence staining to detect neuron-specific markers and confirm the identity of reprogrammed neurons. This established a method for direct reprogramming of THP-1 into functional neurons mediated by Ngn2-Sox11 combined with small molecule compounds.

[0130] The method includes: 2.1 Confirm the identity of the neurons reprogrammed by THP-1 Early morphological observation and neuronal labeling detection: Morphological changes of GFP-positive cells were continuously observed from 0 to 28 days after induction. Immunofluorescence staining was performed at multiple time points from 0 to 28 days using neuron-specific markers TUJ1 and MAP2. Combining cell morphology and marker expression, the success of neuronal fate conversion was determined. Successfully converted neurons were named TiN.

[0131] Validation of mature neurons: In the late maturation stage of reprogrammed neurons (approximately 28 days), immunofluorescence staining was used to detect the mature neuron marker NeuN to assess the neuronal identity and maturity level of the cells. Simultaneously, synaptic-associated protein Synaptotagmin-1 (SYT1), postsynaptic density marker protein PSD95, and presynaptic vesicle-associated protein Synaptophysin (SYN) were detected to comprehensively evaluate the synapse formation and functional maturation status of neurons. Through combined analysis of the above maturation and synaptic-associated markers, the acquisition of mature neuronal characteristics by reprogrammed cells can be further verified from both cell type specificity and synaptic structure and function perspectives, thereby more comprehensively confirming their neuronal identity and functional maturity.

[0132] 2.2 The morphological evolution of THP-1 neurons into TiN neurons is different from the polarization phenomenon.

[0133] In terms of morphology: THP-1 cells are naturally suspension-growing cells with a regular, round shape. When induced to differentiate into macrophages, they exhibit polarization, characterized by adherence, the formation of "sharp corners," and cell body extension. In the early stages of reprogramming, THP-1 cells also exhibit similar adherent and cell body extension morphologies, thus requiring differentiation between polarization and neuronal reprogramming.

[0134] To differentiate the cells, this application's embodiments stained polarized macrophages in the early stages of reprogramming with marker proteins CD68, CD86, and CD206, as well as neuron-specific marker protein TUJ1. M0 macrophages induced by the polarization activator PMA, M1 macrophages induced by LPS and IFNγ, and M2 macrophages induced by IL4 and IL13 were used as positive controls. The infection and reprogramming efficiency of polarized cells were further investigated using immunofluorescence to detect the expression of GFP and TUJ1.

[0135] To more strongly demonstrate the occurrence of THP-1 being reprogrammed into neurons, this application embodiment uses real-time dynamic imaging of cells to track the transformation process. After viral infection, the culture plate is placed in the live cell module of a BC43 confocal microscope. From the time the medium is changed to the neuroinduction medium (day 1) to day 5, the morphological changes and movement trajectories of the cells are recorded. At the end of the tracking, the neurons in the tracking field are stained with immunofluorescence to further confirm the identity of the reprogrammed neurons.

[0136] 2.3 Class attribute analysis of THP-1 converted neurons TiN.

[0137] Preliminary identification of neuronal subtypes: On day 28 post-reprogramming, mature TiN neurons were subjected to immunofluorescence staining and RT-qPCR analysis to preliminarily identify neuronal subtype characteristics. Based on the known functions of transcription factors NGN2 and SOX11, the following neuronal subtype markers were detected: cholinergic neurons: choline acetyltransferase (ChAT); motor neurons: developmental marker HB9 and maturation marker ISL1; sensory neurons: TRK receptor family (TRKA, TRKB, TRKC) and TRP ion channel family members (TRPV1, TRPM8, TRPA1); leptin receptor LEPR. Expression profile analysis of these markers allowed for a preliminary determination of the class and differentiation tendency of TiN neurons.

[0138] Further confirmation of neuronal subtypes: Reprogrammed neurons at 9 days and 21 days were sent for 10× single-cell sequencing analysis. Based on the different types of neuronal marker analysis, the reprogrammed neuron types were confirmed, and further verification was performed using RT-qPCR, immunofluorescence staining, and calcium imaging.

[0139] Neuronal functional activity detection (calcium imaging): To verify whether mature TiN neurons possess functional responses, calcium imaging technology was used to detect their calcium signal responses to various TRP channel agonists and leptin. This is because calcium imaging can be used in sensory neuron research to determine whether these neurons have functional responses to specific stimuli (such as capsaicin, menthol, AITC, etc.). The specific procedure is as follows: In this embodiment, neurons reprogrammed on days 7-8 were digested and resuspended. Cells strongly positive for GFP were sorted using flow cytometry and seeded into confocal culture dishes. After approximately 21 days of culture, the cells were stained with the red calcium indicator dye Rhod-2 AM to monitor changes in calcium signals under different stimuli in real time. To verify the reliability of the results, parallel replicate experiments were also performed using the green calcium indicator dye Fluo4. Analysis of the dynamic changes in calcium signals confirmed the functional activity and sensory neuron-like response characteristics of the reprogrammed neurons.

[0140] 2.4. Detect the spontaneous firing ability of THP-1 converted neurons.

[0141] To verify whether neurons reprogrammed from THP-1 cells possess electrophysiological functions, this application employs microelectrode array (MEA) technology to detect firing activity. MEA is a non-invasive recording platform based on a multi-channel electrode array. It does not damage cell membrane structures and can simultaneously capture firing events from multiple cells or cell clusters, thus providing a more comprehensive reflection of the overall activity state of the neuronal network.

[0142] In the experiment, neurons induced on days 7-8 were flow-sorted. After sorting, GFP-positive cells were seeded in 24-well plates loaded with MEA chips and cultured at different time points for electrical activity detection. Cells cultured for more than two weeks were used for electrical activity analysis.

[0143] During detection, a culture plate containing the MEA chip was placed in the MEA detection system, and the culture conditions were set to a constant temperature of 37°C and 5% CO2. After the cells stabilized for approximately 10 minutes, the spontaneous firing activity of neurons was recorded. To avoid background noise interference, the signal detection threshold was set to 6 times the baseline noise RMS of the electrodes. Generally, a threshold of 4-5 times is sufficient for detection, but to further reduce the risk of false positives and false negatives, this experiment used a more stringent threshold setting of 6 times. By analyzing the spontaneous firing signals recorded by the MEA, the electrophysiological maturity of the reprogrammed neurons and their neural network formation ability can be evaluated.

[0144] Example 4: Results Analysis 4.1 THP-1 can be rapidly and stably induced into human neurons TiN in vitro.

[0145] To achieve direct reprogramming of THP-1 cells into neuronal lineages, this embodiment of the application introduces transcription factors (NGN2, SOX11) related to neural fate determination into THP-1 cells via a lentiviral vector system. After infection, the infected THP-1 cells are seeded onto Matrigel-coated cell culture plates and replaced with neuronal induction medium. This medium is based on C2 medium supplemented with small molecule compounds FSK (10 μM), LDN (1 μM), and neurotrophic factor FGF2 (10 ng / mL). The component ratio of C2 medium is DMEM:F12:Neurobasal (2:2:1), and 2% neuronal culture additive B27 is added. See the detailed operational diagram below. Figure 1 A. Through continuous trials and optimizations, the embodiments of this application have established relatively complete induction and subsequent culture methods in the early experiments. Systematic optimization revealed that the combination of transcription factor NGN2-SOX11 with FSK, LDN, and FGF2 can significantly improve induction efficiency and is the optimal reprogramming scheme. Figure 1 C~1E).

[0146] Starting from the day the induction medium was changed (Day 1), half of the induction medium was replaced every other day. After 7 days of culture, the medium was replaced with neuronal differentiation and maturation medium, which consisted mainly of C2 medium supplemented with FSK (5 μM), Ken (1 μM), BDNF (10 ng / mL), GDNF (10 ng / mL), and NT3 (10 ng / mL). Before changing the medium, the cell culture plate was gently shaken to remove non-adherent THP-1 cells. The neuronal differentiation and maturation medium was changed twice a week to maintain stable culture for more than 28 days.

[0147] Immunofluorescence staining of induced cells at different time points revealed that on day 4 after induction, cells began to exhibit bipolar and multipolar morphology and expressed the neuron-specific cytoskeletal protein TUJ1; by day 8, cells had clearly formed the basic early neuronal morphology; by day 10, cell synapses were more prominent and had begun to intertwine into a network; and by day 28, reprogrammed neurons had developed into the typical morphology of mature neurons, possessing complex and extended branches. Figure 1 B). Furthermore, MAP2 expression was detectable in reprogrammed neurons at different time points, indicating that newly generated neurons do indeed undergo an active maturation process. Figure 1 F~G), and further expressed neuronal maturation marker NeuN, synapse-associated protein SYT1, postsynaptic density marker protein PSD95, and presynaptic vesicle-associated protein Synaptophysin (SYN) (F~G), and further expressed neuronal maturation marker NeuN, synapse-associated protein SYT1, postsynaptic density marker protein PSD95, and presynaptic vesicle-associated protein Synaptophysin Figure 1 (H), proving that THP-1 cells have been successfully transformed into functional neurons with typical morphology and differentiation characteristics.

[0148] 4.2 The morphological changes in reprogrammed THP-1 cells are not those of polarized macrophages. THP-1 cells are a cell line derived from human monocytes, widely used in immunological research. Under specific stimuli, they can polarize and differentiate into macrophages with different functional phenotypes. To clarify whether the morphological changes in early-stage reprogrammed THP-1 cells originate from the reprogramming process itself rather than macrophage polarization, we differentiated and compared the two. In this application, phorbol 12-myristate 13-acetate (PMA) combined with cytokines was used to induce THP-1 cells to polarize into macrophages as a positive control. Subsequently, immunofluorescence staining was used to stain the surface markers CD68, CD86, CD206, and the neuron-specific marker TUJ1 of monocytes and macrophages. By observing the expression of staining signals and counting positive cells, the reprogrammed THP-1 cells were effectively distinguished from the polarized THP-1 cells. Early THP-1 morphological changes during reprogramming do resemble those in the polarized state, but they do not express CD68 and other CD molecules, and the expression of CD86 and CD206 is also significantly reduced. Meanwhile, polarized macrophages that are strongly positive for CD68, CD86, and CD206 in truly polarized THP-1 cells completely lack the expression of the neuronal marker TUJ1. Figure 2 (Figures A-C). Further culturing revealed that successfully reprogrammed cells gradually developed complex axonal and dendritic networks, forming typical neuronal morphology, while polarized macrophages did not possess these morphological characteristics. Furthermore, viral infection of polarized cells to induce reprogramming showed a significant decrease in infection efficiency and reprogramming efficiency (Figures D-F). These results indicate that the morphological changes in THP-1 during reprogramming originate from neuronal fate switching, rather than polarization.

[0149] 4.3. Real-time cell imaging technology verifies the morphological evolution process from monocytes to neurons. To directly observe the dynamic changes of THP-1 cells during the reprogramming process and verify their transformation from monocytes to neurons, this application employs live-cell real-time imaging technology to continuously track the induction process. After viral infection, the culture plate was placed in the live-cell module of a BC43 confocal microscope. From the time the medium was changed to the neuronal induction medium (day 2) to day 6, morphological changes and cell movement trajectories (e.g., ...) were recorded. Figure 2 G). The imaging device takes a picture of a fixed field of view every 30 minutes, from Figure 2As shown in Figure 2H, with prolonged induction time, the GFP fluorescence signal gradually increased, indicating an increase in viral expression levels. Simultaneously, some cells underwent significant morphological changes, exhibiting elongated protrusions and neuron-like structures. After imaging, the cells were fixed with 4% paraformaldehyde and stained with TUJ1 immunofluorescence. Comparison of the imaging video and the immunostained field of view under a confocal microscope revealed that cells exhibiting neuronal morphology in dynamic imaging all showed positive TUJ1 signals in the staining (Figure 2H). These results demonstrate that THP-1 cells indeed underwent a dynamic transformation from monocytes to neurons during reprogramming induction, providing direct evidence for the authenticity of THP-1's direct reprogramming into neurons.

[0150] 4.4. Kenpaullone, SB, RA, Hit3, and other auxiliary agents have similar effects in inducing TiN maturation. To test the effects of adding different compounds to the second-stage culture on promoting the maturation of reprogrammed neurons, TiN was replaced with a maturation-inducing medium and cultured for another 7 days. Immunofluorescence analysis was performed on the morphology of neurons and the maturation marker MAP2. The results showed that different compounds, including Kenpaullone, SB, RA, and Hit3, could all assist in inducing the maturation of TiN. Figure 3 The only difference is in the morphology of neurons and the proportion of neurons maturing at the same time. Morphologically, Kenpaullon-induced synapses are longer.

[0151] 4.5. Reprogrammed TiN neurons possess some electrophysiological functions. To verify whether neurons reprogrammed from THP-1 cells possess electrophysiological functions, this application employs microelectrode array (MEA) technology to detect firing activity, such as... Figure 5 As shown. After infecting THP-1 cells with lentivirus, they were treated with induction medium for 8 days. Then, GFP-positive induced cells were sorted by flow cytometry and seeded into 24-well plates loaded with MEA chips. The cells were continuously cultured at different time points for electroactivity detection. Figure 4 A). MEA recordings showed that newly generated neurons exhibited significant spontaneous firing signals at 21 days ( Figure 4B). Thermographs and waveforms showed that spontaneous firing activity of neurons was detected through porous electrode channels, and the waveform amplitude and amplitude tended to increase with the extension of induction time, indicating that the newborn neurons have partially acquired the electrophysiological characteristics of mature neurons. Both detected waveforms exhibited typical extracellular action potential morphology: at 21 days, the average spike amplitudes were 23.7 μV and 45.4 μV, with a high signal-to-noise ratio, suggesting that the neuronal membrane electrophysiological characteristics are relatively mature and possess stable excitability; in addition, the newborn neurons could generate significant calcium signal responses under KCl stimulation, suggesting that they have acquired functional voltage-gated calcium channels and depolarization-dependent excitatory membrane properties. Figure 4 C).

[0152] The results in summary indicate that the reprogrammed TiN neurons possess detectable spontaneous electrical activity and stable action potential characteristics, suggesting that they have achieved partial electrophysiological functional maturation in the later stages of culture.

[0153] 4.6 The TiN neurons obtained through reprogramming exhibit characteristics of a hybrid neuronal subtype. To further determine the subtype attributes of the reprogrammed neurons, in this embodiment of the application, TiN neurons were cultured to day 28 and subjected to immunofluorescence staining and RT-qPCR. Figure 5 A). Analysis revealed that the neuronal composition comprises multimodal sensory neurons, interneurons, and motor neurons. The multimodal sensory neurons include TRP channel receptor-positive neurons, PIEZO channel receptor (PIEZO-type mechanosensitive ion channel receptor)-positive neurons (a subset of peripheral sensory-like neurons), leptin receptor (LEPR)-positive neurons, and retinal-like neurons. These multimodal sensory neurons can simultaneously express one or more of the aforementioned neuron type-specific marker proteins. Interneurons include LEPR-positive interneurons and PIEZO1 / 2-positive interneurons.

[0154] 4.6.1 A small number of motor neurons were produced: A significant proportion of newly formed neurons expressed choline acetyltransferase (ChAT), both typical markers of cholinergic neurons. Simultaneously, only a small percentage of cells expressed the motor neuron-specific transcription factors ISL1 (mature stage) and HB9 (developmental stage). Figure 5 (B, C) proves that a smaller number of motor neurons are generated.

[0155] 4.6.2 Multimodal sensory neurons were generated: RT-qPCR analysis of TiN neurons detected upregulation of sensory neuron-related receptors, including TrkA, TrkB, TrkC, and transient receptor potential (TRP) family members such as the thermal pain receptor TRPV1, the chemonoxistent receptor TRPA1, and the cold receptor TRPM8. Figure 5 D, E). Similarly, immunofluorescence staining also detected the expression of these specific receptors (D, E). Figure 5 According to statistics, the expression rate of these receptors all reached over 85%. Figure 9 These results indicate that sensory neurons that are positive for a large number of transient receptor potential (TRP) family members, including the thermal pain receptor TRPV1, the chemonoxistent receptor TRPA1, and the cold receptor TRPM8, are induced.

[0156] Calcium imaging can detect dynamic changes in intracellular calcium ion concentration, thereby reflecting cellular functional activity. To further verify the functionality of these newly formed neurons, this application employs calcium imaging technology to detect dynamic changes in calcium ion concentration under various stimuli. Studies have shown that TrkA-positive neuronal subsets can produce specific responses to different stimuli through TRP channels. Therefore, this application uses TRP channel agonists such as Capsaicin (TRPV1), Menthol (TRPM8), and AITC (TRPA1) for stimulation, and the results show that TiN neurons all exhibit significant calcium signal fluctuations after stimulation. Figure 5 G), indicating its functional responsiveness to multiple receptor agonists. Furthermore, after sorting and seeding newly generated neurons into 24-well plates with embedded electrodes, morphological observation showed that 7 to 15 days after induction, the cells gradually extended their processes and formed a neural network structure, covering the electrodes within the wells. Figure 5 MEA also detected that newly formed neurons could produce significant firing activity after stimulation with corresponding receptor agonists (such as Capsaicin, Menthol, and AITC). Figure 5 I).

[0157] 4.6.3 Multimodal sensory neurons include a subset of neurons with mechanosensitive transduction capabilities: Immunofluorescence staining detected PIEZO1 and PIEZO2 positive neurons in TiN ( Figure 6 According to statistics, the expression rates of these receptors all reach over 85%. Figure 9 RT-qPCR analysis detected upregulation of PIEZO1 and PIEZO2 expression. Figure 6 B), calcium imaging detected significant calcium signal fluctuations in TiN neurons after stimulation with the PIEZO1-specific stimulant YODA1. Figure 6 C), under the same stimulation conditions, MEA also detected the electrical signal response induced by this stimulant ( Figure 6 D). This indicates that TiN exhibits the expression characteristics of mechanosensitive ion channels, suggesting that this cell population possesses the ability to sense and transduce mechanostimuli, and belongs to a neuronal subpopulation with mechanosensory functions.

[0158] 4.6.4 Multimodal sensory neurons include LEPR-positive neurons, a population of neurons that respond to leptin signals. LEPR-positive neurons were detected by immunofluorescence staining in newly generated neurons. Figure 7 According to statistics, the expression rates of these receptors all reach over 85%. Figure 9 RT-qPCR also detected upregulation of LEPR expression. Figure 7 B), calcium imaging detected very significant calcium signal fluctuations in TiN neurons after leptin (LEP) stimulation. Figure 7 C), under the same stimulation conditions, MEA also detected a leptin-induced electrical signal response ( Figure 7 D).

[0159] 4.6.5 Multimodal sensory neurons include Retinal-like neurons. In the embodiments of this application, TiN neurons were cultured for 9 days and 21 days and extracted to obtain neuronal subpopulations. Based on cluster analysis and cell type annotation results, this subpopulation was defined as a Retinal neuron-like (Retinal NL) cell population (…). Figure 8 (A, B) This result suggests that some TiN cells, during reprogramming, not only acquired mature neuronal characteristics but also further activated specific transcriptional programs related to retinal neuron development and function. Further analysis of the spatial distribution of UMAP revealed that the classic retinal-related genes OTX2 and EYS showed significant enrichment in the same specific region ( Figure 8 C), further supporting the existence of the Retinal NL subset. To further validate the single-cell sequencing results, RTqPCR was used to detect several key retinal-related genes (C). Figure 8 E). The results showed that VSX2, a key transcription factor for the development of retinal progenitor cells and retinal neurons, was significantly elevated in TiN, with its expression level reaching 2581±78.7 times that of the control group (E). Figure 8D), further examination was conducted on the expression of classic RGC marker genes POU4F1 (BRN3A) and RBPMS, as well as the expression of OPN4, a photosensitive protein specific to intrinsically photosensitive retinal ganglion cells (ipRGCs). The results showed that POU4F1, RBPMS, and OPN4 were increased by 30.26±0.7 times, 11.35±0.88 times, and 11.02±0.58 times, respectively, in TiN. Figure 8 G). Among them, POU4F1 is an important regulator of RGC development and survival, and is widely used as a marker of mature RGCs; RBPMS is a highly specific RGC cytoplasmic marker protein; and OPN4 is a specific photoreceptor for ipRGCs. Immunofluorescence staining further confirmed the presence of BRN3A in TiN. + and OPN4 + Cell population ( Figure 8 F). Simultaneously, parallel staining was performed using a full-slice patch of mouse retina as a positive control to verify the antibody's specificity. Figure 8 (F) The control results showed that the antibody exhibited a specific expression pattern consistent with that reported in the literature in native mouse retinal tissue, further demonstrating the reliability of the relevant positive signal in TiN. These results further confirm at the protein level that some TiN cells have indeed acquired molecular features associated with RGC / ipRGC.

[0160] More notably, the embodiments of this application further revealed that TiN also significantly expresses a variety of classical photoreceptor-related photosensitizing proteins, including rod-cell-specific rhodopsin RHO and cone-cell-related opsin proteins OPN1MW, OPN1SW, and OPN1LW, as shown by RT-qPCR. The results showed that the expression levels of these genes in TiN increased by 65.3±0.6-fold, 82.3±1.6-fold, 35.3±1.0-fold, and 5.0±0.7-fold, respectively. Figure 8 G). RHO is mainly found in rod cells and participates in low-light vision; OPN1MW, OPN1SW, and OPN1LW correspond to photoreceptor proteins in cone cells sensitive to medium, short, and long wavelengths, respectively. These results indicate that TiN, during reprogramming, not only activated some ipRGC-related programs but also exhibited significant expression characteristics of photoreceptor-related molecules. Subsequently, immunofluorescence experiments further confirmed the expression of the above photoreceptor proteins in TiN, and parallel staining was performed using mouse retinal sections as positive controls to verify the specificity and reliability of the antibody. Figure 8H). Notably, these photosensitive proteins are not uniformly diffused in TiN cells, but rather form relatively localized structured regions within the cytoplasm, exhibiting discrete aggregated signals. This unique localization pattern suggests that certain subcellular structures related to photoreceptor function may have already formed within TiN cells, or that a membrane protein transport and localization system similar to that of photoreceptor cells may be being established.

[0161] MEA was used to detect the response of TiN neurons to different light stimuli. The results showed that these neurons only produced a significant electrical signal response to 475nm blue light. Figure 8 (I, J), This selective blue light response further illustrates that cells express members of the light-sensitive opsin family, especially the melanopsin (OPN4)-related signaling pathway, which is involved in this photoinduced electrophysiological response.

[0162] 4.6.6 Interneurons were generated. For example... Figure 7 As shown in E, the bioinformatics analysis results confirmed the existence of LEPR-positive interneurons and PIEZO1 / 2-positive interneurons. These two types of neurons belong to interneurons. According to the specific marker grouping, purple represents LEPR-positive interneurons and light blue represents PIEZO1 / 2-positive interneurons. PIEZO1 and PIEZO2 are also shown in enlarged font in the figure.

[0163] In summary, the results indicate that the reprogrammed TiN neurons exhibit hybrid neuronal subtype characteristics, producing a multimodal composition of sensory neurons, interneurons, and motor neurons. Statistically, the positive rates of specific receptors for each neuronal subtype, including TRPV1, TRPA1, TRPM8, PIEZO1, PIEZO2, LEPR, OPN4, OPN1 family, and RHO, all reached approximately 80%. Figure 9 The proportion of strong positive signals for each receptor is between 20% and 60%, demonstrating that this multimodal sensory neuron can simultaneously express one or more of the above-mentioned neuron type-specific marker proteins.

[0164] 4.7. TiN reprogrammed neurons are regulated by multiple key signaling pathways. Sequencing analysis was performed on reprogrammed cells from the early stage (0-7 days). Figure 10 Cells were grouped according to specific markers (A, B), mainly into THP-1, cT, TtN, TiN, and Macro ( ). Figure 10 C), and preliminary analysis showed the expression of neuronal development-related genes EBF1 and DCX (C). Figure 10D), the enrichment analysis of pathways showed that multiple signaling pathways, including but not limited to the Apelin signaling pathway, Hippo signaling pathway, and Wnt signaling pathway, were significantly upregulated in the early formation stage of TiN. Figure 10 E). Based on the pseudo-temporal expression pattern analysis of genes, several key molecules in the apelin signaling pathway were identified, such as MEF2A, which showed the most significant changes, and PRKCE, which was co-enriched in the Hippo pathway. Figure 10 F).

[0165] 4.8. XMU-MP-1 activation of YAP promotes early reprogramming of THP-1, significantly increasing the structural complexity of mature TiN. Conversely, inhibition by the YAP inhibitor Verteporfin delays this process. The test results showed that adding the YAP activator XMU-MP-1 in the early stages of reprogramming (using the baseline conditions of FSK, LDN, and FGF2, i.e., FLF2) significantly promoted the early elongation of induced neuronal (TiN) neurites (Figure 11C), while the inhibitor Verteporfin significantly inhibited this process. Figure 11 A, B). Two days after cells were transferred to neuron-inducing medium (corresponding to the early immature stage of reprogramming), immunofluorescence detection of TUJ1 expression and cell morphology showed that under FLF2 conditions, approximately 50% of GFP... + / TUJ1 + Cells developed prominent neural neurites, while the remaining cells maintained a relatively rounded morphology; however, under the condition of XMU-MP-1 addition, over 75% of GFP... + / TUJ1 + The cells formed complex and clearly extended neural neurites, and quantitative results showed significant differences between the two groups.

[0166] To further evaluate the effect of XMU-MP-1 on the late maturation stage of TiN, four induction conditions were set up in this application: LDN+FGF2, FSK+LDN+FGF2, XMU-MP-1+LDN+FGF2, and XMU-MP-1+FSK+LDN+FGF2. After 8 days of induction, all groups were uniformly replaced with maturation differentiation medium (as described above) and cultured for another week. The morphology of TiN and the expression of TUJ1 and MAP2 were assessed by immunofluorescence. The results showed that, compared with the selected optimal basic combination FLF2 (FSK+LDN+FGF2), although the total number of TiN generated in the XMU-MP-1+LDN+FGF2 group was slightly lower, its neuronal morphology was significantly more complex, showing a significant increase in the number of neurite branches. In addition, the XMU-MP-1+FSK+LDN+FGF2 group not only had an advantage in the total number of TiN, but also showed higher morphological maturity and more complex neurite structures. Figure 11 D).

[0167] 4.9 The generated motor neurons can form a small number of neuromuscular junctions with the induced mature myotubes. Immunofluorescence results after co-culturing TiN with the induced mature myotubes showed α-BTX staining positivity and co-localization with GFP and SV2, suggesting the formation of neuromuscular junctions. GFP positivity represents reprogrammed TiN. SV2 is a typical synaptic vesicle protein; expression of SV2 in reprogrammed neurons indicates that the cell has entered the preparation stage for synapse formation and neurotransmitter release, which is one of the important molecular markers of "functional maturation." Figure 12 ).

[0168] 4.10. The generated neuronal composition can survive and mature in mice. Figure 15 ).

[0169] Based on the above analysis, this application has the following advantages: 1. Establishment of innovative culture method: For the first time, a culture method was established to directly, rapidly and efficiently reprogram human blood mononuclear cell line THP-1 into functional neurons.

[0170] 2. Well-developed technical process: A stable induction process from suspended immune cells to adherent neurons has been established, with good reproducibility and ease of operation.

[0171] 3. Unique model system: It establishes an ideal model for studying the cross-border switching mechanism between the immune system and the nervous system.

[0172] 4. Rigorous functional verification: Sensory channel function was verified by detecting changes in calcium signals in sensory neurons stimulated by TRPV1, TRPM8, and TRPA1 agonists and the calcium signal response of LEPR-positive neurons stimulated by LEPR; spontaneous discharge was detected by MEA (microelectrode array) to prove the presence of a neuronal electrical activity network, and the electrical signal response of retinal-like neurons to light signals was detected; the dual verification makes the definition of "functional neuron" more rigorous.

[0173] 5. Wide range of application potential: Derived from human cells, it can theoretically be further extended to autologous immune cell reprogramming, providing a feasible cell source for future personalized neural repair.

[0174] 6. Drug screening value: TRP channel positive, PIEZO channel positive, and LEPR positive cells can be used for pain drug screening and TRP channel modulator testing, and have significant translational application value.

[0175] Example 5: Culture medium This embodiment provides a culture medium, as described in the previous embodiments, which includes a basal culture medium and a first small molecule compound.

[0176] The first molecular compound combination includes one or more of XMU-MP-1, FSK, and LDN.

[0177] In one possible implementation, the first molecular compound combination also includes FGF family proteins.

[0178] Furthermore, the FGF family protein is selected from at least one of the group consisting of FGF2-FGF8. Preferably, the FGF family protein is selected from FGF2 or FGF8.

[0179] In one possible implementation, the first small molecule compound combination, based on complete culture medium, comprises 2.5-20 μM of FSK, 0.25-1 μM of XMU-MP-1, 0.5-2 μM of LDN, and 10-50 ng / mL of FGF2 or FGF8.

[0180] Preferably, the amount of FSK added is 10 μM, the amount of XMU-MP-1 added is 0.5 μM, the amount of LDN added is 1 μM, and the amount of FGF2 or FGF8 added is 10 ng / mL.

[0181] Example 6: Culture medium This embodiment provides a culture medium, as described in the previous embodiments, the culture medium comprising a basal culture medium and a first small molecule compound; The first molecule of compounds includes: XMU-MP-1; and One or both of FSK and LDN.

[0182] In one possible implementation, the first molecular compound combination also includes FGF family proteins.

[0183] Furthermore, the FGF family protein is selected from at least one of the group consisting of FGF2-FGF8. Preferably, the FGF family protein is selected from FGF2 or FGF8.

[0184] In one possible implementation, the first small molecule compound combination, based on complete culture medium, comprises 2.5-20 μM of FSK, 0.25-1 μM of XMU-MP-1, 0.5-2 μM of LDN, and 10-50 ng / mL of FGF2 or FGF8.

[0185] Preferably, the amount of FSK added is 10 μM, the amount of XMU-MP-1 added is 0.5 μM, the amount of LDN added is 1 μM, and the amount of FGF2 or FGF8 added is 10 ng / mL.

[0186] Application Example 1 Application of the cultured neurons in Example 1.

[0187] 1. Drug screening 1.1. As a novel in vitro neuropharmacological screening platform: detecting neuroprotective agents and regeneration promoters. 1.1.1 Detection of neuroprotective agents Neuronal compositions were obtained after induction and maturation. Neuroprotective agents to be screened were added to the culture medium containing the neuronal compositions for a period of time. Immunofluorescence staining was used to detect the neuronal marker protein TUJ1 and the maturation marker protein MAP2. The effects of the neuroprotective agents were evaluated by statistical analysis of multiple aspects, such as neuronal morphology, expression ratio of marker proteins, synaptic length, and synaptic branching complexity.

[0188] 1.1.2 Screening of regeneration accelerators In the early stage of neuronal composition induction, i.e., according to the method provided in Example 1 of this application, the regeneration promoter to be screened is added for 48 hours or longer within 1 week. Subsequently, the neuronal marker protein TUJ1 and the mature marker protein MAP2 are detected by immunofluorescence staining. The effect of the regeneration promoter is evaluated by statistical analysis of multiple aspects such as neuronal morphology, expression ratio of marker proteins, synapse length and synaptic branch complexity.

[0189] 1.2 Screening for TRP channel modulators (such as analgesics, anti-inflammatory drugs, and antidepressants), PIEZO channel modulators, and LEPR receptor channel modulators.

[0190] Filtering methods include: 1.2.1. Three weeks after induction with the neuronal composition, Ca was used. 2+ Fluorescent probes Fluo-4 AM (MCE, HY-101896) and Rhod-2 AM (MCE, HY-D0989) were used to perform calcium imaging on TiN to detect the calcium signal responsiveness of neurons to drugs in multiple channels, in order to assess the responsiveness of different channels to multiple drugs.

[0191] 1.2.2 To monitor the calcium response, after monitoring the fluorescence baseline for 30 seconds, TRP channel modulators, PIEZO channel modulators, and LEPR receptor channel modulators were randomly added to the flow chamber in sequence at a concentration of 10×. The control used the corresponding volume of DMSO. The monitoring lasted for 5-8 minutes.

[0192] 1.2.3 Calcium response was determined by calculating the fluorescence change of initial fluorescence (F-F0) / F0, where F = fluorescence at a certain time point, and F0 = the average unstimulated fluorescence at the basal layer of each cell. A non-responsive region of a DMSO control was selected for fluorescence normalization and background removal to exclude spontaneous neuronal calcium activity. To avoid misinterpreting background noise or spontaneous neuronal calcium activity as a stimulus response, the response threshold was determined based on the baseline ΔF / F0 distribution during the unstimulated period. The mean and standard deviation (sd) of ΔF / F0 were calculated during the unstimulated period, and the response threshold was set to mean + 5 × sd. A positive calcium response was only defined as a ΔF / F0 signal exceeding this threshold and higher than the maximum value of ΔF / F0 in the DMSO control group.

[0193] See Figure 13 The figure shows the calcium imaging response of the neuronal composition of this embodiment to different drugs. As can be seen from the figure, the neuronal composition produces significant calcium signal responses to drugs targeting both TRP and PIEZO channels. Therefore, this can be used as a basis for screening drug efficacy and sensitivity.

[0194] 1.3 Screening for drugs that regulate retinal-like neuron-related receptors Filtering methods include: 1.3.1 In the embodiments of this application, retinal-like neurons were generated in the neonatal neuron composition. Since these retinal-like neurons express a variety of photoreceptors, they can be used to screen for drugs that regulate retinal-like neuron-related receptors.

[0195] The specific method is as follows: after the neuronal composition is induced to mature, the electrical activity of TiN is detected using MEA multi-array electrodes to detect the electrical signal responsiveness of the neuronal composition to light stimulation of different wavelengths, in order to screen drugs that regulate receptors related to retinal-like neurons.

[0196] 1.3.2 The screening criteria are: after stimulating neurons in MEA wells with drugs that activate or inhibit relevant receptors, the electrical signal response to light stimulation of different wavelengths is evaluated.

[0197] See Figure 14 The figure shows the electrical signal response of the neuronal composition of this embodiment to light stimulation of certain wavelengths. As can be seen from the figure, blue light induces Spike firing of the neuronal composition, thus it can be used to screen for drugs that regulate receptors associated with retinal-like neurons.

[0198] 2. Research on neural regeneration and cell transplantation The neuronal composition described in this application can serve as a stable donor cell source for neuronal cell transplantation research, providing a new experimental basis and cellular material support for nerve injury repair and transplantation research for neurodegenerative diseases.

[0199] The neuronal composition includes: multimodal sensory neurons, interneurons, and motor neurons.

[0200] Methods for studying the transplantation of neuronal compositions, taking spinal cord transplantation as an example, include: 2.1. Spinal cord transplantation of TiN cells (1) TiN cells were induced according to the method in Example 1. After one week of induction, a large number of adherent GFP cells were observed. + TiN cells were sorted by flow cytometry and prepared for transplantation.

[0201] (2) Prepare 12-week-old immunodeficient mice with Nod Scid. After anesthetizing them with isoflurane, open the skin on their backs, cut open the muscles of the T10 segment, and open the spine.

[0202] (3) Use a spinal cord striker to strike the patient with parameters of 0.8 m / s for a minor injury, 0.3 mm for a wound depth, and 0.4 s for a dwell time.

[0203] (4) After the attack, locate the center of the lesion under a stereomicroscope, and inject TiN cells at two points on both sides of the central tube, with an injection volume of 1 L at each point and a total cell count of 1 × 10⁻⁶. 5 One cell was injected at a rate of 300 nL / min, and the injection was stopped for 10 minutes after the injection was completed.

[0204] (5) After the injection, the mice were sutured with absorbable sutures and allowed to recover.

[0205] 2.2. Immunofluorescence examination of TiN survival in mice.

[0206] (1) Four weeks after transplantation, mice were perfused and the spinal cord segments that had been injected with cells were collected. The tissue was fixed with formaldehyde for 24 h and dehydrated with 30% sucrose.

[0207] (2) Slicing: The spinal cord is frozen in a microtome and then sliced.

[0208] (3) Immunofluorescence staining: Immunofluorescence staining of tissues was performed until mounting. The primary antibodies used were: rabbit mouse anti-Tuj1, g-pig anti-MAP2, ck anti-GFP, and g-pig anti-GFAP.

[0209] 2.3. Andorra confocal microscopy was used for image capture and export, based on GFP... + TUJ1 + MAP2 + Preliminary assessment of TiN's survival and maturation capabilities in vivo.

[0210] See Figure 15 The diagram shows the survival effect of neurons after spinal cord transplantation in mice in this embodiment. The cells have the ability to survive in vivo and can mature without the administration of neurotrophic factors. Immunofluorescence detection of MAP2 shows that MAP2 expression increases significantly with the extension of time of transplanted cells in vivo, confirming that neurons can gradually mature after transplantation in vivo.

[0211] 3. Construct an in vitro neuromuscular junction functional model The construction methods include: Primary mouse skeletal muscle cells or C2C12-induced myotubes co-cultured with neuromuscular junctions (1) Mouse skeletal muscle cells were extracted by digestion with type II collagenase, cultured and differentiated to form myotubes, and co-cultured with the neuronal composition of Example 1. C2C12 cell lines were induced to differentiate into myotubes using 2% sheep serum and co-cultured with the neurons of Example 1.

[0212] (2) Place it in an incubator for incubation. The co-culture system uses an induction maturation medium.

[0213] (3) Continue culturing for 2-3 weeks, and then use α-BTX staining to detect the formation of neuromuscular junction.

[0214] See Figure 12The study demonstrates that the motor neurons in the neuronal composition cultured in the example can establish functional connections with myotubes and form typical neuromuscular junction (NMJ) structures. Immunofluorescence results show that α-BTX staining is positive and co-localizes with GFP and SV2, suggesting that TiN has the ability to establish functional synaptic connections with target cells, indicating that the motor neurons can be used to construct an in vitro neuromuscular junction functional model.

[0215] Application Example 2 A kit containing one or more of the neuronal compositions described in Example 1 for screening neuroprotective agents, regeneration promoters, and drugs regulating TRP channels, PIEZO channels, LEPR receptors, and retinal-like neuron-related receptors.

[0216] The specific screening method is the same as in Application Example 1.

[0217] Application Example 3 Application of the culture medium described in Example 5 or Example 6: Use of the culture medium in inducing differentiation of human peripheral blood mononuclear cells into neurons based on NGN2-SOX11.

[0218] The above description is merely a preferred embodiment of this application, but the scope of protection of this application is not limited thereto. Any modifications, equivalent substitutions, and improvements made by those skilled in the art within the scope of the technology disclosed in this application should be included within the scope of protection of this application.

Claims

1. A method for reprogramming and culturing neuronal compositions, characterized in that, include: A vector containing a combination of cell transdifferentiation genes was constructed; the combination of cell transdifferentiation genes includes NGN2 and SOX11. The vector is used to infect or transfect initiating cells; the initiating cells include human peripheral blood mononuclear cells. Infected or transfected initiating cells are cultured in a neuron-inducing conversion medium and induced to differentiate, resulting in early neurons. The neuron-inducing conversion medium comprises a basal medium and a combination of a first small molecule compound. Early neurons were cultured using a neuronal differentiation and maturation culture medium to obtain mature neurons; the neuronal differentiation and maturation culture medium included a basal culture medium and a combination of second small molecule compounds.

2. The method according to claim 1, characterized in that, In the process of culturing infected or transfected starting cells, the culture container is pre-coated with a coating matrix selected from at least one of laminin, gelatin, fibronectin, and Matrigel.

3. The method according to claim 1, characterized in that, The first small molecule compound combination includes one or more of XMU-MP-1, FSK, and LDN.

4. The method according to claim 3, characterized in that, The first small molecule compound combination also includes FGF family proteins.

5. The method according to claim 1, characterized in that, The second small molecule compound combination includes one or more of the following: FSK, Kenpaullone, CHIR-99021, LDN, SB, RA, and Hit3.

6. A neuronal composition, characterized in that, The neuronal composition obtained by the method described in any one of claims 1-5 includes multimodal sensory neurons, interneurons, and motor neurons; the multimodal sensory neurons are capable of expressing specific marker proteins, and the specific marker proteins include specific marker proteins expressed by one or more of peripheral sensory-like neurons, retinal-like neurons, and LEPR-positive neurons.

7. Use of the neuronal composition of claim 6 in screening neuroprotective agents, regeneration promoters, and drugs that regulate TRP channels, PIEZO channels, LEPR receptors, and retinal-like neuron-related receptors.

8. A reagent kit, characterized in that, The kit contains the neuronal composition of claim 6 for screening neuroprotective agents, regeneration promoters, and drugs that regulate TRP channels, PIEZO channels, LEPR receptors, and retinal-like neuron-related receptors.

9. A method for transplantation research using the neuronal composition of claim 6 for non-therapeutic purposes, characterized in that, The transplantation study is used for animal models of nerve injury or neurodegenerative diseases, and the method includes: transplanting the neuronal composition of claim 6 into the central nervous system of a non-human mammal and detecting the survival of the neuronal composition.

10. Use of the neuronal composition of claim 6 in constructing an in vitro neuromuscular junction functional model.

11. A neuron-inducing transformation culture medium, characterized in that, include: Basic culture medium, combination of first small molecule compounds, and combination of second small molecule compounds; The first molecular compound combination includes one or more of XMU-MP-1, FSK, and LDN; The second small molecule compound combination includes one or more of the following: FSK, Kenpaullone, CHIR-99021, LDN, SB, RA, and Hit3.

12. Use of the culture medium of claim 11 in a composition for inducing differentiation of human peripheral blood mononuclear cells based on NGN2-SOX11 to obtain multimodal sensory neurons, interneurons and motor neurons.

Images