An antisense oligonucleotide ASO-2 targeting TSC2 gene mutation site and a pharmaceutical composition and application prepared therefrom

Abstract

The application discloses an antisense oligonucleotide ASO-2 targeting a TSC2 gene mutation site, a pharmaceutical composition prepared by the antisense oligonucleotide ASO-2 and application thereof, and belongs to the technical field of gene targeting drugs. The application obtains the antisense oligonucleotide ASO-2 capable of targeting the TSC2 gene mutation site through screening, the nucleotide sequence of the antisense oligonucleotide ASO-2 is shown as SEQ ID NO. 1; the antisense oligonucleotide ASO-2 has a 2'-O-methyl modification structure, can correct the intron retention existing in TSC2 c.848+281C>T, can target the binding site of a splicing factor SF2 / ASF, and realizes specific correction of intron retention caused by incorrect splicing. The antisense oligonucleotide ASO-2 precisely and efficiently regulates variable splicing of a mutant gene, provides a new targeted intervention means and path for tuberous sclerosis caused by the TSC2 gene mutation, and has popularization and application value.

Description

Technical Field

[0001] This invention belongs to the field of gene-targeted drug technology, specifically relating to an antisense oligonucleotide ASO-2 that targets the TSC2 gene mutation site, a pharmaceutical composition prepared therefrom, and its applications. Background Technology

[0002] Antisense oligonucleotides (ASOs) are precise gene regulation tools. They are synthetic single-stranded nucleic acid molecules, typically composed of 15-30 nucleotides, that target cellular pre-mRNA through base complementarity pairing to achieve highly specific regulation of key post-transcriptional processes and develop personalized therapies based on patient-specific mutations. ASOs can bind to target mRNA to form DNA-RNA hybrid double strands, recruiting RNase H1 enzymes to degrade the target mRNA. They can also regulate pre-mRNA splicing or block translation through steric hindrance effects, altering pre-mRNA splicing patterns and promoting or inhibiting the inclusion of specific sequences.

[0003] Tuberous sclerosis (TSC) is an autosomal dominant genetic disorder caused by mutations in the TSC1 or TSC2 genes. TSC can lead to uncontrolled cell proliferation and differentiation, resulting in benign hamartomas in multiple organs, including the skin, brain, eyes, mouth, heart, lungs, kidneys, liver, and bones. The main symptoms include epilepsy, intellectual disability, vitiligo, and facial angiofibromas. When the TSC1 or TSC2 genes are inactivated by mutation, the overactivated target of rapamycin (mTOR) promotes cell metabolism and abnormal cell proliferation, leading to the disease.

[0004] In clinical reports, TSC2 c.848+281C>T has caused severe epilepsy, brain calcification, and melanin plaque deposition. This intron mutation causes missplicing, resulting in the retention of some introns. TSC2 c.848+281C>T forms a new splice donor site at the mutation site, which, together with the receptor site in the upstream intron, forms a pseudo-exon that is misrecognized by the spliceosome, resulting in the insertion of an 89 bp pseudo-exon. This causes the reading frame to shift, leading to the production of truncated proteins.

[0005] Therefore, for the severe clinical phenotype caused by this tuberous sclerosis mutation, there is an urgent need for specific ASO drugs to target the mutation sequence to prevent missplicing and improve their targeting and efficiency, so as to provide a specific and efficient gene therapy for genetic diseases caused by gene mutations. Summary of the Invention

[0006] Based on the above-mentioned technical needs, the purpose of this invention is to provide an antisense oligonucleotide ASO-2 targeting the TSC2 gene mutation site, a pharmaceutical composition thereof, and its application. This invention obtains an antisense oligonucleotide ASO-2 capable of targeting the TSC2 gene mutation site by screening for intron TSC2 c.848+281C>T mutants. This antisense oligonucleotide ASO-2 can solve the technical problem of lacking specific targeted drugs for TSC2 c.848+281C>T patients with gene mutations.

[0007] To achieve the above objectives, the present invention is implemented through the following solution:

[0008] This invention provides an antisense oligonucleotide ASO-2 that targets the TSC2 gene mutation site, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0009] Furthermore, the antisense oligonucleotide ASO-2 has a 2'-O-methyl modified structure.

[0010] Furthermore, the specific TSC2 gene mutation site is TSC2 c.848+281C>T.

[0011] Furthermore, the antisense oligonucleotide ASO-2 can target the binding site of the splicing factor IgM-BRCA1, the nucleotide sequence of which is CGGACGT.

[0012] The present invention also provides a pharmaceutical composition comprising the aforementioned antisense oligonucleotide ASO-2 and a pharmaceutically acceptable carrier.

[0013] The present invention also provides the use of the aforementioned antisense oligonucleotide ASO-2 or the aforementioned pharmaceutical composition in the preparation of formulations for the treatment of tuberous sclerosis.

[0014] Furthermore, tuberous sclerosis is a condition caused by a mutation in the TSC2 gene.

[0015] Furthermore, the concentration of the antisense oligonucleotide ASO-2 is 1 nm-500 nm.

[0016] Furthermore, the antisense oligonucleotide ASO-2 or the pharmaceutical composition can correct the TSC2 c.848+281C>T mutation and promote normal protein expression.

[0017] The present invention also provides the application of the aforementioned antisense oligonucleotide ASO-2 in the preparation of formulations that correct intron retention in the presence of TSC2 c.848+281C>T.

[0018] Compared with the prior art, the beneficial effects of the present invention are as follows: By providing a specific sequence of antisense oligonucleotide ASO-2, the present invention can target the binding site of the splicing factor IgM-BRCA1, specifically correct the intron retention caused by missplicing, and provide a targeted intervention for the treatment of gene mutation patients. By efficiently and accurately regulating the alternative splicing of mutated genes, the invention addresses the occurrence and development of diseases at the gene level, and has good market application prospects. Attached Figure Description

[0019] Figure 1 This is a schematic diagram of designing ASO-2 sequences based on predicted splicing factor (ESE) binding sites near mutation sites, where E8 is exon 8.

[0020] Figure 2 Figure A shows the nucleic acid electrophoresis and sequencing results of cellular RT-PCR. Figure A shows the RT-PCR results after plasmid and ASO transfection, with E8 representing exon 8. From left to right, lane 1 is the DL2000 Marker, lane 2 is the pSPL3 empty vector, lane 3 is WT-E8 (WT represents wild type), lane 4 is Mut-E8 (Mut represents mutant type), and lanes 5 to 10 show the results of Mut-E8 co-treated with 50 nM and 100 nM ASO-1, ASO-2, and ASO-3, respectively. Figure B shows the RT-PCR results of Mut-E8 co-transfected with ASO-2. From left to right, lane 1 is the DL2000 Marker, lane 2 is the pSPL3 empty vector, and lanes 3 to 9 show the results of Mut-E8 co-treated with 0 nM, 1 nM, 5 nM, 10 nM, 20 nM, and 30 nM ASO-2, respectively. The results of co-treatment with nM and 50nM ASO-2; In Figure C, ① is the PCR product containing exon 8 and 89 bp intron sequence (exon SD + exon SA + exon 8 + 89 bp intron fragment), ② is the PCR product containing exon 8 sequence (exon SD + exon SA + exon 8), and ③ is the PCR product generated after exon 8 skips (SD + SA).

[0021] Figure 3 Cell viability graphs of human embryonic kidney cells (HEK-293T) treated with ASO-2 showed no statistically significant difference (P>0.05).

[0022] Figure 4 The images show protein imprinting of plasmids and ASO-2 transfected at the cellular level. From left to right, lane 1 is the protein marker, lane 2 is for transfection of WT-E7+E8 (E7 is exon 7, E8 is exon 8), lane 3 is for transfection of Mut-E7+8, and lanes 4 to 6 are for co-transfection of Mut-E7+8 and different concentrations of ASO-2.

[0023] Figure 5 This diagram illustrates the post-transcriptional splicing of plasmids WT-E8, Mut-E8, WT-E7+8, and Mut-E7+8. Green boxes represent exons, red boxes represent retained introns, and straight lines and broken lines represent introns that skipped. Detailed Implementation

[0024] The technical solution of the present invention will be further described in detail with reference to the following specific examples, but the scope of protection of the present invention is not limited to the scope described in the examples.

[0025] Example 1

[0026] This embodiment provides the design and synthesis of ASO, specifically including the following:

[0027] 1. Analysis of bioinformatics websites

[0028] Bioinformatics analysis software was used to predict the TSC2 c.848+281C>T mutant to screen for mutations that may have a potential impact on pre-mRNA splicing. The online websites SpliceAI (https: / / spliceailookup.broadinstitute.org / ), ESEfinder 3.0 (https: / / esefinder.ahc.umn.edu / cgi-bin / tools / ESE3 / esefinder.cgi), and BDGP (https: / / www.fruitfly.org / ) were used to assess the impact of variants on the consensus 5' donor site (DS) or 3' acceptor site (AS). Scoring of the corresponding classical splicing site in exon 8 (E8) of TSC2 was analyzed using the BDGP website, and the scoring results are shown in Table 1.

[0029] Table 1. Results of mutation site scoring in bioinformatics analysis

[0030]

[0031] The DS for E8 was 0.99, and c.848+281C>T generated a new DS at the mutation site with a score of 0.99. SpliceAI was used to predict its impact on the splice site, and the results included receptor gain (AG), receptor loss (AL), donor gain (DG), and donor loss (DL). A Δ score greater than 0.2 indicated high recall, greater than 0.5 was the recommended threshold, and greater than 0.8 indicated high precision.

[0032] The results showed that TSC2 c.848+281C>T (AG=0.86, DG=0.91) reached the high precision threshold (>0.8), suggesting that this deep intron variant will significantly affect splicing, leading to aberrant splicing by creating new acceptor and donor sites, which can have pathogenic consequences.

[0033] ESEfinder 3.0 was used to predict splice enhancer (ESE) binding sites in sequences. The results, shown in Table 2, indicate that ESE sequences bind to splicing factor SF2 / ASF (IgM-BRCA1) (the nucleotide sequence of SF2 / ASF is CGGACGT) during RNA splicing, enhancing the identification of correct splice sites and improving the efficiency and accuracy of splicing. An ASO-2 sequence was designed to target the ESE sequence near the TSC2 c.848+281C>T mutation, blocking SR protein binding through steric hindrance and reducing the probability of missplicing.

[0034] Table 2. ESE binding sites near the TSC2 c.848+281C>T mutation predicted by ESEfinder 3.0

[0035]

[0036] 2. Design and Synthesis of ASO

[0037] ASO sequence design based on ESE prediction of SF2 / ASF binding sites near mutation sites is illustrated in the diagram below. Figure 1 As shown, ASO sequence design was performed using the software RNAstructure (http: / / rna.urmc.rochester.edu / rnastructure.html) to predict ASO and ASO-ASO free energies, with the ideal values ​​being ASO > -4 and ASO > -15. Then, the binding energy between ASO and the target sequence was calculated, with the ideal range being -18 to -28. BLAST analysis was used to check ASO specificity, avoiding complete homology within consecutive 15 nt segments as much as possible.

[0038] The ASO-2 and TSC2 genes (NM_000548.4, whose nucleotide sequence is shown in SEQ ID NO.2) have inverse complementary positions at bases 229-246 of intron 8, with the entire strand modified by 2'-O-methyl (2'-O-Me).

[0039] ASO-2:(2'-0-Me-U)(2'-0-Me-G)(2'-0-Me-G)(2'-0-Me-A)(2-0-Me-G)(2'-0-Me-G)(2'-0-Me-A)(2-0-Me-C)(2-0-Me- G)(2-0-Me-U)(2-0-Me-C)(2'-0-Me-C)(2'-0-Me-G)(2'-0-Me-A)(2'-0-Me-G)(2'-0-Me-C)(2'-0-Me-A)(2'-0-Me-U).

[0040] Table 3 ASO sequence and free energy calculation

[0041]

[0042] Example 2

[0043] This embodiment provides relevant experiments on the splicing regulation of deep intron mutations in TSC2, and further investigates the role of the antisense oligonucleotide ASO-2 in the splicing regulation of deep intron mutations in TSC2. The specific content is as follows:

[0044] 1. Mini-gene experiments

[0045] To investigate the splicing regulation of deep intron mutations in TSC2, a mini-gene was constructed using pSPL3 exon capture plasmids. A wild-type plasmid (WT-E8) was obtained by constructing exon 8 of the TSC2 gene and its upstream and downstream intron sequences containing the mutation site. The mutant plasmid (Mut-E8) was then introduced into the WT plasmid using the QuikChange II site-directed mutagenesis kit (Stratagene, La Jolla, CA). Both the wild-type and mutant plasmids were validated by sequencing before further experiments.

[0046] (1) Cell transfection experiment

[0047] Human embryonic kidney cells (HEK-293T) (purchased from [unspecified source]) were seeded into 12-well plates at a base area ratio of 1:3 when they reached 90% confluency. The next day, when they reached 60%-70% confluency, transfection was performed using Lipo3000 reagent (Invitrogen, USA) to transfect wild-type, mutant, and empty vector mini-gene (negative control) cells separately, using serum-free medium for dilution throughout. Transfection system A: In a sterile 1.5 mL centrifuge tube, add 50 µL of serum-free medium. Gently mix the Lipo3000 reagent (do not vortex), and add 1.5 µL to the serum-free medium. Gently pipette or tap the tube wall to mix, and incubate at room temperature for 5 minutes. Transfection system B: In another sterile 1.5 mL centrifuge tube, add 50 µL of serum-free medium. Calculate the volume of plasmid and ASO-2 stock solution according to the desired final concentration (ASO-2 concentration gradient set from 0-50 nm). Add this to the serum-free medium. Add the entire diluted tube A to the diluted tube B. Note the order: add the liposomes to the nucleic acid. Gently pipette 3 to 5 times to mix, or tap the tube wall lightly to mix. Do not vortex. Let stand at room temperature for 10 to 15 minutes to allow the liposomes to fully form a stable complex with the plasmid and ASO-2. The solution may become slightly turbid. Add 100 µL of the prepared transfection complex dropwise evenly to the wells containing cells. Gently shake the culture plate back and forth and side to side to distribute the complex evenly in the culture medium. Return to a 37°C, 5% CO2 incubator and continue incubation for 48 h.

[0048] (2) Cell RNA extraction and reverse transcription

[0049] First, transfer the collected cells into a 1.5 mL RNase-free EP tube, add 500 μL of Trizol, and vortex for 10 s (if not performing the following steps immediately, store at -80°C); then centrifuge at 12000 rpm for 15 min at 4°C; transfer the supernatant to a new EP tube, let it stand at room temperature for 5 min, and then add chloroform to the tube (usually 200 μL, chloroform:supernatant = 1:5). Vigorously shake for 15 seconds until it turns pink, let it stand at room temperature for 5 minutes, then centrifuge in layers and centrifuge at 12000 rpm for 15 minutes at 4°C. Transfer the supernatant to a new EP tube (approximately 200 μL), add isopropanol at a 1:1 ratio, mix well, and let stand at -20°C for 20 minutes or at room temperature for 10 minutes. Then centrifuge at 12000 rpm for 10 minutes at 4°C. Remove the supernatant, add 1 mL of 75% ethanol (freshly prepared) to the tube for washing, shake well, and centrifuge at 7500 rpm for 10 minutes at 4°C. Remove the supernatant and dry the EP tube in a desiccator for 15 minutes or on ice (with the cap open). Then add 30 μL of DEPC water to resuspend the precipitate. Measure the RNA concentration using a Nanodrop RNA concentration analyzer (catalog number: 840-317400, Thermo Fisher Scientific), and follow the instructions for the TAKARA reverse transcription kit (PrimeScript™ II 1st Strand cDNASynthesis). Kit (item number: 6210A) was used to prepare cDNA.

[0050] (3) PCR and nucleic acid gel electrophoresis

[0051] The obtained cDNA was amplified by PCR. The upstream primer SD6 was 5'TCTGAGTCACCTGGACAACC 3' (SEQ ID NO. 3); the downstream primer SA2 was 5'ATCTCAGTGGTATTTGTGAGC 3' (SEQ ID NO. 4). The amplification reaction was as follows: 2 µL of cDNA and 25 µL of 2×PrimeStar (PreMix) (TAKARA, Japan) were added to a 50 µL volume. Each primer was 1 µM. The heating conditions in a thermal cycler (Applied Biosystems, USA) were: 98℃ for 30 s, 58℃ for 30 s, 72℃ for 90 s for 29 cycles, and finally 72℃ for 10 minutes. During this period, a 1.5% agarose gel was prepared: 1.5 g of agar powder was weighed, 100 mL of 1×TAE was measured with a graduated cylinder, and the gel was heated in a microwave oven for 3 min until it became clear and transparent without any precipitate. The gel was then placed at approximately 60℃, 5 μL of nucleic acid dye was added, and the gel was poured into a template and allowed to cool and solidify for later use. The amplified products were separated by 1.5% agarose gel electrophoresis at 120 V for 30 min, and images were taken using a nucleic acid gel imaging system. The intensity of each band was quantified using ImageJ software. The target DNA band was cut and purified using a gel extraction kit (CWBIO). The transcripts were then sequenced to obtain the specific sequence and peak diagram.

[0052] The results are as follows Figure 2 As shown, the electrophoresis images and sequencing results of HEK-293T cells transfected with wild-type plasmid (WT-E8), mutant plasmid (Mut-E8), and mutant plasmid co-transfected with ASO-2 are presented: WT-E8 produces a single transcription product band of 337 bp (74 bp + 263 bp, where 74 bp is the sequence of exon 8 and 263 bp is the sequence length of exons SD and SA inherent in the pSPL3 vector). Mut-E8 produces two transcription products, one of which is a larger molecular weight product of 426 bp (74 bp + 263 bp + 89 bp, where 89 bp is the intron fragment) that retains some intron fragments. Co-transfection with ASO-2 and Mut-E8 reduces the proportion of intron retention; when the concentration is 20 nm, the intron-retained product disappears (see schematic diagram). Figure 5 (As shown).

[0053] 2. Cell viability experiment

[0054] Human embryonic kidney cells (HEK-293T) in good growth condition were normally digested and counted, according to 2×10⁻⁶ cells. 4Cells were seeded in 96-well plates and cultured in a 37°C, 5% CO2 incubator. On the second day, when the cells were in the logarithmic growth phase, they were treated with the drug. The cells were divided into three groups: blank group (no cells), control group (cells without ASO-2), and drug-treated group (50 nm, 100 nm, 500 nm). ASO-2 was transfected into the cells using Lipo3000. After culturing for 48 h, the supernatant was discarded and DEME basal medium containing 10% CCK8 was added. The cells were incubated at 37°C for 120 min in the dark. The absorbance was recorded at a wavelength of 450 nm and the cell viability (%) was calculated. Cell viability (%) = OD sample - OD blank / OD control - OD blank × 100%.

[0055] The results are as follows Figure 3 As shown, within the concentration range of 0-500 nM, the ASO-2 activity was not significantly different from the control group (P>0.05), and there was no significant inhibition or promotion of cell proliferation, nor was there any obvious cytotoxicity.

[0056] 3. Protein level experiment

[0057] The exons 7 to 8 of the TSC2 gene and their adjacent introns were ligated into the vector pcDNA3.1-3xFlag-N. The mutant was then introduced into the plasmid using the QuikChange II site-directed mutagenesis kit, resulting in a wild-type plasmid (WT-E7+8) and a mutant plasmid (Mut-E7+8) tagged with the Flag tag. Cell transfection experiments were then performed (as described above) to verify the ASO-2 correction effect at the protein level.

[0058] First, the collected cells were lysed on ice for 30 min using RIPA (containing protease inhibitors), and then further disrupted by sonication. The supernatant was aspirated for BCA protein quantification (BCA protein concentration assay kit, Beyotime, P0012) to determine the protein concentration. Then, the PVDF membrane was transferred to a 10% PAGE gel electrophoresis membrane and blocked with 5% skim milk powder at room temperature for 1 h. The membrane was then incubated overnight at 4°C with the tag antibody Flag (1:1000, Anti-DDDDK-tag mAb, M185-3S, MBL) and the internal control β-Actin (1:10000, ABcam). The next day, the membrane was washed three times with TBST for 5 min each time, and then incubated with secondary antibody at room temperature for 1 h. Finally, the membrane was developed using a chemiluminescence analyzer to obtain the results.

[0059] The results are as follows Figure 4As shown, the protein levels after transfection with wild-type plasmid (WT-E7+8) and mutant plasmid (Mut-E7+8), as well as co-transfection with mutant plasmid (Mut-E7+8) and ASO-2 concentration gradients, were analyzed. The Flag antibody incubation bands showed that WT-E7+8 produced protein bands corresponding to the transcription and translation of exons 7 and 8, while Mut-E7+8 did not produce significant protein bands corresponding to exons 7 and 8 or retained intron sequences (or the translation products carrying introns were easily degraded). After co-transfection with Mut-E7+8 and ASO-2, the level of the target protein gradually increased with increasing drug concentration gradient, indicating that ASO-2 can correct the protein level reduction caused by mutation sites at the protein level (see schematic diagram). Figure 5 (As shown).

[0060] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions claimed by the present invention.

Claims

1. A targeted TSC2 The antisense oligonucleotide ASO-2 at the gene mutation site is characterized by, The nucleotide sequence of the antisense oligonucleotide ASO-2 is shown in SEQ ID NO.

1.

2. The antisense oligonucleotide ASO-2 according to claim 1, characterized in that, The antisense oligonucleotide ASO-2 has a 2'-O-methyl modified structure.

3. The antisense oligonucleotide ASO-2 according to claim 1, characterized in that, The TSC2 The specific gene mutation site is TSC2c.848+281C>T.

4. The antisense oligonucleotide ASO-2 according to any one of claims 1 to 3, characterized in that, The antisense oligonucleotide ASO-2 can target the binding site of the splicing factor IgM-BRCA1, whose nucleotide sequence is CGGACGT.

5. A pharmaceutical composition, characterized in that, It comprises the antisense oligonucleotide ASO-2 as described in claim 1 and a pharmaceutically acceptable carrier.

6. The use of the antisense oligonucleotide ASO-2 of claim 1 or the pharmaceutical composition of claim 5 in the preparation of an agent for treating tuberous sclerosis.

7. The application according to claim 6, characterized in that, The tuberous sclerosis is caused by TSC2 Diseases caused by gene mutations.

8. The application according to claim 6, characterized in that, The concentration of the antisense oligonucleotide ASO-2 is 1 nm-500 nm.

9. The application according to claim 6, characterized in that, The antisense oligonucleotide ASO-2 or the pharmaceutical composition can correct the TSC2 c.848+281C>T mutation and promote normal protein expression.

10. The use of the antisense oligonucleotide ASO-2 according to claim 1 in the preparation of formulations that correct intron retention in the presence of TSC2 c.848+281C>T.

Images