Seov gene, recombinant vector, recombinant virus, application and vaccine thereof

Abstract

The present application relates to the technical field of biology, and in particular to a SEOV gene, a recombinant carrier, a recombinant virus and application and a vaccine thereof.The SEOV gene is obtained by mutation and truncation of a SEOV M gene, and includes mutation of isoleucine at the 530th position of a protein coded by the SEOV M gene into lysine, mutation of serine at the 1092th position into leucine, and deletion of six amino acids at the C-terminal end of the protein coded by the SEOV M gene; the nucleotide sequence of the SEOV M is shown as SEQ ID NO.9.The SEOV vaccine prepared by the present application provides a new candidate vaccine for prevention and treatment of hemorrhagic fever with renal syndrome, and sufficient protection effect can be obtained by single vaccination.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to an SEOV gene, a recombinant vector, a recombinant virus, their applications, and vaccines. Background Technology

[0002] Seoul virus (SEOV) belongs to the order Bunyaviruses (Synoptic Virus). Bunyavirales Hantaviridae ( Hantaviridae SEOV is an enveloped, negative-sense RNA virus with a genome divided into three segments: S, M, and L, encoding the nucleocapsid protein NP, the envelope glycoprotein GPC (which is cleaved into Gn and Gc after translation within the cell), and the RNA-dependent RNA polymerase RdRp, respectively. SEOV is an emerging global health threat that can cause HFRS with a mortality rate of approximately 2%. There are currently no approved treatments for SEOV infection. While it is not yet clear whether SEOV causes clinical disease in rats, it can be transmitted through aerosol exposure or direct contact with infected animals, leading to disease in humans. Human SEOV infection is often mild or asymptomatic, but some individuals may develop HFRS with symptoms such as fever, headache, muscle pain, and abdominal pain. Clinical manifestations include acute kidney injury, which can progress to oliguric renal failure and conjunctival hemorrhage; the mortality rate of SEOV-associated HFRS is approximately 2%. Medical responses to SEOV and other hantaviruses are limited. The existing bivalent inactivated vaccine for hemorrhagic fever with renal syndrome (Vero cell) has played a positive role in the occurrence and spread of HFRS through its widespread use. However, the vaccine still has some shortcomings, mainly the weak ability of the antigen sequence encoded by the vaccine's genes to induce neutralizing antibodies. Summary of the Invention

[0003] To address the above problems, this invention provides a SEVO gene, a recombinant vector, a recombinant virus, its applications, and a vaccine.

[0004] A SEVO gene, wherein the SEVO gene is obtained by mutating and truncating the SEVO M gene, including mutating isoleucine at position 530 to lysine, serine at position 1092 to leucine, and deleting 6 amino acids at the C-terminus of the SEVO M gene-encoded protein. Among them, amino acid position 530 corresponds to three nucleotides 1588-1590 of the gene locus, and amino acid position 1092 corresponds to three nucleotides 3274-3276 of the gene locus; the nucleotide sequence of SEVOV M is shown in SEQ ID NO.9.

[0005] A recombinant vector is obtained by ligating the SEVO gene and the pVSVΔG-GFP vector using the In-Fusion enzyme.

[0006] A recombinant virus is obtained by transfecting virus-producing cells with the recombinant vector and helper plasmid, thereby packaging the recombinant virus.

[0007] Preferably, the virus-producing cells are BHK cells that have been infected with poxvirus.

[0008] Preferably, the helper plasmids are PBS-N, PBS-P, PBS-G, and PBS-L.

[0009] Preferably, the poxvirus is VV-T7.

[0010] The application of the recombinant virus in the preparation of Seoul virus vaccine.

[0011] A vaccine for preventing Seoul virus infection, comprising the recombinant virus and vaccine-acceptable excipients.

[0012] Compared with the prior art, the beneficial effects of the present invention are as follows: After immunizing mice with the vaccine described in this invention, effective neutralizing antibodies were induced in the mice. The results observed at 0.5, 1, 2, 3 and 4 months after immunization showed that the neutralizing antibodies began to increase after immunization and reached a peak at 3 months after immunization.

[0013] This invention provides a SERV vaccine based on the vesicular stomatitis virus (VSV) vector, and the prepared SERV vaccine provides a novel candidate vaccine for the prevention and treatment of hemorrhagic fever with renal syndrome, which can achieve sufficient protective effect with a single dose.

[0014] VSV virus used as a vaccine vector has the following advantages: (1) VSV is an animal virus with low infectivity to humans and good safety; (2) There are no pre-existing antibodies in the population, so the efficacy of the vaccine will not be reduced due to immunization against the vector; (3) The genome is small, with a total length of only 11knt, making reverse genetics operations easy; (4) It can accommodate nearly 6kb of foreign genes and has strong compatibility; (5) VSV vaccines only require a single dose to induce effective protection. Attached Figure Description

[0015] Figure 1 Figure 1 shows the results of PCR amplification of seg1, seg2 and seg3; Figure 2 Figure 1 shows the results of four parallel PCR tests for pCAGGS-SEOV M (I530K / S1092L). Figure 3 The image shows the results of three parallel PCR amplifications of SEVOV M(I+S+C6). Figure 4 A graph showing the results of seven parallel PCR tests for identifying rVSV-SEOV M(I+S+C6); Figure 5 The results of Western blotting analysis of rVSV-SEOV-GP are shown in the figure. Figure 6 Image showing the results of SDS-PAGE detection of rVSV-SEOV-GP; Figure 7 The image shows the results of neutralizing antibody testing half a month after rVSV-SEOV-GP immunization; Figure 8 The image shows the results of neutralizing antibody testing one month after rVSV-SEOV-GP immunization; Figure 9 The image shows the results of neutralizing antibody testing 2 months after rVSV-SEOV-GP immunization; Figure 10 The image shows the results of neutralizing antibody testing 3 months after rVSV-SEOV-GP immunization; Figure 11 The image shows the results of neutralizing antibody testing 4 months after rVSV-SEOV-GP immunization. Detailed Implementation

[0016] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods.

[0017] Material information used in this invention: Escherichia coli DH5α competent cells (DL1001M) and Stbl 3 competent cells (DL1046M) were purchased from Shanghai Weidi Biotechnology Co., Ltd.; pUC-SEOV opti GPC plasmid was synthesized by Nanjing GenScript Biotech Co., Ltd.; pCAGGS-X-myc was kindly provided by the Chinese Academy of Agricultural Sciences; pVSVΔG-GFP was synthesized by Nanjing GenScript Biotech Co., Ltd.; pBS-N, pBS-P, pBS-G, pBS-L, and pCAGGS-VSV G plasmids are described in the literature Yan Q, Wu L, Chen L, Qin Y, Pan Z, Chen M. Vesicularstomatitis virus-based vaccines expressing EV71 virus-like particles elicit strong immune responses and protect newborn mice from lethalchallenges. Vaccine2016;34(35):4196-4204; BHK-21 cells (CCL-10) and Vero E6 cells (CRL-1586) were purchased from the American Type Culture Collection. The poxvirus VV-T7 expressing T7 polymerase is described in the literature: Yan Q, Wu L, Chen L, Qin Y, Pan Z, Chen M. Vesicular stomatitis virus-based vaccines expressing EV71 virus-like particles elicit strong immune responses and protect newborn mice from lethalchallenges. Vaccine 2016;34(35):4196-4204.

[0018] Antibody VSV G was purchased from Abcam (EPR28362-204); antibody HRP-Goat Anti-mouse IgG was purchased from Sangon Biotech (Shanghai) Co., Ltd. (D110087); restriction endonucleases used in this invention were purchased from TAKARA Biotechnology Co., Ltd.; Q5 high-fidelity DNA polymerase was purchased from NEB; 5×In-Fusion Enzyme Premix was purchased from TAKARA Biotechnology Co., Ltd.; gel extraction kit was purchased from Sangon Biotech (Shanghai) Co., Ltd. (B110092); plasmid mini-prep kit was purchased from OMEGA (D6934-03); plasmid large-prep kit was purchased from OMEGA (D6926-04); DNA marker, 4S Red Nucleic Acid Stain, ampicillin, 50×TAE, 20×TBS and Tween-20 were all purchased from Sangon Biotech (Shanghai) Co., Ltd.; Lipofectamine TM 2000 was purchased from Thermo; protein marker was purchased from Yeasen; 4× sampling buffer was provided by GenScript; 10× loading buffer was purchased from Sangon Biotech (Shanghai) Co., Ltd.; BSA was purchased from Yeasen; methanol was purchased from Tianjin Fuyu Fine Chemical Co., Ltd.; and precipitated TMB membrane substrate solution was purchased from Baizhi Biotechnology.

[0019] DMEM and Opti-MEM media were purchased from Gibco; FBS was purchased from Yeasen; DPBS was purchased from Corning; and penicillin-streptomycin-gentamicin mixture and trypsin-EDTA digestion solution were purchased from Solarbio.

[0020] BALB / c mice were purchased from the Animal Center of Air Force Medical University.

[0021] The present invention employs the following technical solution: The full-length sequence of the SERV M gene encoding SERV opti GPC is 3402 bp. Using this plasmid as a template, point mutations are performed at amino acid positions 530 and 1092. Amino acid position 530 corresponds to nucleotides 1588-1590 at the gene locus, and amino acid position 1092 corresponds to nucleotides 3274-3276 at the gene locus. In this invention, isoleucine (I) at position 530 is mutated to lysine (K), and serine (S) at position 1092 is mutated to leucine (L), yielding SEOVM(I+S). SERV M(I+S) is then ligated to the vector pCAGGS-X-myc using In-Fusion enzyme to construct the double mutant plasmid pCAGGS-SEOV M(I530K / S1092L), abbreviated as pCAGGS-SEOV M(I+S).

[0022] The C-terminus of the SEEV M(I+S) fragment was truncated by PCR (ΔC6) to obtain the target fragment SEEV M(I+S+ΔC6). Finally, SEEV M(I+S+ΔC6) was ligated into pVSVΔG-GFP (synthesized by Nanjing GenScript) using In-Fusion enzyme to construct the plasmid rVSV-SEOV(I+S+C6)-GFP, abbreviated as rVSV-SEOV-GP.

[0023] rVSV-SEOV-GP was co-transfected with VSV helper plasmids PBS-N, PBS-P, PBS-G, and PBS-L into cells already infected with poxvirus (VV-T7 expressing T7 polymerase) to rescue the recombinant virus rVSV-SEOV-GP expressing SEOV GP. This recombinant virus was used in vaccines, and its efficacy in inducing neutralizing antibody titers in mice immunized with BALB / c was tested.

[0024] Example 1 The SEVO M gene used in this experiment was selected from SEVO L99 strain. To improve the protein expression level of this gene in eukaryotic cells, the M gene sequence of wild-type strain L99 was codon optimized and synthesized by Nanjing GenScript Biotech Co., Ltd., thus obtaining the SEVO M gene. The full-length sequence of the SEVO M gene is 3402 bp, and the nucleotide sequence is shown in SEQ ID NO.9. The protein encoded by the SEVO M gene is named SEVO opti GPC. The SEVO M gene was linked to the pUC18 vector and named pUC-SEOV opti GPC.

[0025] Using pUC-SEOV opti GPC as a template, primers were designed to mutate isoleucine (I) at position 530 of the SEVO opti GPC to lysine (K), and serine (S) at position 1092 to leucine (L). The SEVO M gene was amplified in segments using three pairs of primers, yielding PCR products seg1, seg2, and seg3. These seg1, seg2, and seg3 were then linked together in the order seg1-seg2-seg3 to form SEVO M(I+S), as shown below. Figure 1 As shown, the size of the PCR amplification products was consistent with the expectation. The gel was cut and the PCR amplification products were recovered using a gel recovery kit. The upstream primer for amplifying seg1 was pCAG-seg1-F and the downstream primer was seg1-R. The upstream primer for amplifying seg2 was seg2-F and the downstream primer was seg2-R. The upstream primer for amplifying seg3 was seg3-F and the downstream primer was pCAG-seg3-R-Myc. The sequences are shown in Table 1.

[0026] Subsequently, seg1, seg2, and seg3 were cloned into the digested pCAGGS-X-myc vector using In-Fusion enzyme to obtain the double mutant plasmid pCAGGS-SEOV M (I530K / S1092L), which was then identified.

[0027] like Figure 2 As shown, PCR identification of the double mutant plasmid yielded a product of approximately 4200 bp, preliminarily proving the successful construction of the plasmid. The plasmid was then sent to Sangon Biotech for sequencing analysis, and the correct plasmid was stored for future use. Using the double mutant plasmid pCAGGS-SEOV M (I530K / S1092L) as a template, primers were designed to amplify the target fragment SEEV M (I+S+ΔC6) by PCR. The upstream primer for amplifying SEEV M (I+S+ΔC6) was Sph I-seg1-F, and the downstream primer was Sph I-seg1-R. The specific sequences are shown in Table 1. The PCR amplification results are as follows. Figure 3As shown, the target fragment SEEV M(I+S+ΔC6) was ligated with the pVSVΔG-GFP vector (synthesized by Nanjing GenScript Biotech Co., Ltd.) linearized with SphI restriction enzyme via In-Fusion enzyme at the Sph I site to obtain the plasmid rVSV-SEOV(I+S+C6)-GFP, abbreviated as rVSV-SEOV-GP.

[0028] like Figure 4 The image shows the PCR identification results of the rVSV-SEOV-GP plasmid, indicating that the PCR amplified fragment is the same size as expected. The plasmid was further sent to Sangon Biotech for sequencing analysis, and the correct plasmid was stored for future use.

[0029] Table 1 Primer sequences pCAG-seg1-F CATTTTGGCAAAGAATTCgccaccATGTGGTCCCTGCTGCTGCTGG SEQ ID NO.1 seg1-R CTCCTTttTCTTCCTCAGGATAGCCTTGAAGCG SEQ ID NO.2 seg2-F CAAGGCTATCCTGAGGAAGAaaAAGGAGGAGTTCGAAAAGACC SEQ ID NO.3 seg2-R CTCCtaACTTCTTGAACCAGCAGGTCACACC SEQ ID NO.4 seg3-F CTGCTGGTTCAAGAAGTtaGGAGAGTGGGTGATGGGAATCATCAAC SEQ ID NO.5 pCAG-seg3-R-Myc CGGGTACCTTACAGATCCTCTTCTGAGATGAGTTTTTGTTCAGACTTCTTGTGCTTCCTC SEQ ID NO.6 Sph I-seg1-F GTACTTAGCCTTTTATGCATGCATGTGGTCCCTGCTGCTGCTGG SEQ ID NO.7 Sph I-seg3-R CATCTCTATGTCGTACCGCATGCTTAAGACTTCTTGTGCTTCCTCACAGGG SEQ ID NO.8

[0030] Example 2 Preparation of recombinant virus rVSV-SEOV-GP BHK-21 cells (purchased from the U.S. Type Culture Collection) were seeded in six-well plates and cultured overnight until the cells reached approximately 90% confluence. BHK cells were then infected with poxvirus (VV-T7) at MOI=5 for 2 hours.

[0031] The rVSV-SEOV-GP plasmid and helper plasmids PBS-N, PBS-P, PBS-G, and PBS-L were sequentially added to a 500 μL EP tube of opti-MEM (tube number 1) in a ratio of 5:3:5:8:1, with dosages of 1.25 μg, 0.75 μg, 1.25 μg, 2 μg, and 0.25 μg, respectively. 11 μL of transfection reagent LP2000 was added to another 500 μL EP tube of opti-MEM (tube number 2). Tubes 1 and 2 were incubated at room temperature for 5 min each. The liquid from tube 2 was then added to tube 1, mixed thoroughly, and incubated at room temperature for 20 min to obtain the plasmid-transfection reagent mixture.

[0032] VV-T7 cells were aspirated from the six-well plates, and plasmid-transfection reagent mixture was added. After 6 hours, the medium was changed to DMEM containing 10% FBS. GFP expression was observed after 24 hours. After 48 hours, obvious cytopathic effects were observed in the cells. The supernatant was harvested, centrifuged at 5000×g for 4 minutes to remove cell debris, filtered through a 0.1μm filter to remove poxvirus, and stored at -80℃ for later use.

[0033] BHK cells were re-inoculated into six-well plates and grown overnight. After growth, pCAGGS-VSV G 2 μg / well was transfected. After 6 hours, the medium was changed to DMEM with 10% FBS. After 24 hours, the filtrate stored at -80℃ was directly used to infect the pCAGGS-VSV G-transfected BHK cells. The medium was changed again after 2 hours. GFP expression was continuously observed. The observation of GFP expression proved that the rVSVSEOV-GP virus was initially successfully packaged. The harvested supernatant was stored at -80℃ for later use.

[0034] Example 3 Western blot and SDS-PAGE detection of recombinant virus rVSV-SEOV-GP After large-scale amplification of rVSV-SEOV-GP virus in Vero E6 cells (purchased from the U.S. Type Culture Collection), the cell supernatant was collected and purified. In Western blotting, SEEVGc was identified using convalescent serum from HFRS patients, and rVSV-GFP was identified using the VSV G monoclonal antibody.

[0035] The results showed that SEOV Gc could be detected in the convalescent serum of HFRS patients (donated by Tangdu Hospital). Figure 5 As shown, and the same size as the SEVO Gc protein; the membrane was further incubated with VSV G monoclonal antibody, and VSV G protein was successfully detected. Simultaneously, SDS-PAGE detected structural proteins in rVSV-SEOV-GP, such as... Figure 6 In the rVSV-SEOV-GP lane, VSV-related proteins N, P, L, and M, as well as the SEVO envelope glycoproteins Gn and Gc, were successfully detected. In the rVSV-GFP lane, VSV-related proteins N, P, L, and M, as well as the VSV envelope glycoprotein G, were successfully detected. These results indicate that SEVO GP protein is successfully expressed in the rVSV-SEOV-GP recombinant virus.

[0036] Example 4 Mice were immunized with rVSV-SEOV-GP and the neutralizing antibody titer was detected. To evaluate the immunogenicity of rVSV-SEOV-GP in BALB / c mice (purchased from the Animal Center of Air Force Medical University), mice were immunized intramuscularly with different doses of rVSV-SEOV-GP. Blood samples were collected at 0.5 months, 1, 2, and 3 months post-immunization. A corresponding control group, rVSV-GFP, was established with the same immunization dose and method as rVSV-SEOV-GP. Additionally, a bivalent inactivated HFRS vaccine was used as a positive control, administered as a two-dose vaccine two weeks apart. Blood samples were collected at each time point, and neutralizing antibodies were quantified using a neutralization assay. The immunization methods are shown in Table 2.

[0037] Table 2 Immunization methods Example 5 FRNT detection of neutralizing antibodies in rVSV-SEOV-GP-immunized BALB / c mice: Vero E6 cells were seeded in 96-well plates and allowed to grow overnight. Once the cell confluence was greater than 90%, mouse immunization serum was diluted to 100 μL at concentrations of 1:20, 1:40, 1:80, 1:160, 1:320, 1:640, 1:1280, 1:2560, 1:5120, 1:10240, 1:20480, and 1:40960. Each diluted solution was then mixed with an equal volume of 100 FFU of SEOV L99. After thorough mixing, the cells were incubated at 37°C for 1 hour to ensure adequate contact between the virus and serum. The culture medium was then discarded from the 96-well plates. The virus-serum mixture was added to each well at a concentration of 100 μL, with two replicates for each dilution. Additionally, wells were set up for SEOV infection. Infect cells with the virus-serum mixture for 2 hours to allow the virus to fully infect the cells. After 2 hours, discard the liquid and add 100 μL of covering medium to each well of a 96-well plate. Incubate the cell culture plate at 37°C in a 5% CO2 incubator for 5 to 7 days. Wash away the covering solution with DPBS, fix cells with 4% paraformaldehyde, and incubate at room temperature for 30 min. Discard the fixative, add 0.5% Triton X-100, and rupture the membrane at room temperature for 15 min. Dilute 1A8 antibody with 3% FBS in DPBS and add it to a 96-well plate. Incubate overnight at 4°C. Discard 1A8 antibody and wash cells twice with DPBS. Dilute secondary antibody HRP-Goat Anti-mouse IgG (purchased from Sangon Biotech (Shanghai) Co., Ltd.) with 3% FBS in DPBS and add it to a 96-well plate. Incubate at room temperature for 1 h. Discard the secondary antibody and wash cells twice with DPBS. Add 100 μL of precipitant TMB chromogenic solution to each well and incubate at room temperature in the dark for 15-30 min. Add 100 μL of DPBS to each well to stop the chromogenic reaction. Dark spots will be visible at the bottom of the plate. Observe the spots and count them. Calculate the neutralizing titer of the serum using the spot reduction method.

[0038] Mice were immunized with the recombinant vaccine rVSV-SEOV-GP, and blood samples were collected at fixed time points to detect neutralizing antibody titers. Table 3 below shows the neutralizing antibody values ​​at 2 weeks after immunization. Figure 7 This is a graph showing the results of neutralizing antibody detection half a month after immunization. It shows that all three dose groups of rVSV-SEOV-GP induced the production of neutralizing antibodies, with the 1×10⁻⁶ dose group showing the highest level. 7 The PFU group had the highest antibody titer. In addition, all three doses of rVSV-SEOV-GP were higher than those of the HFRS inactivated vaccine group (23.11±1.628).

[0039] Table 4 below shows the neutralizing antibody levels one month after immunization. Figure 8 The graph shows the results of neutralizing antibody testing one month after immunization. It can be seen that the antibody levels in all groups increased at one month compared to half a month after immunization, and the three doses of rVSV-SEOV-GP were all higher than those in the HFRS inactivated vaccine group (37.92±3.032).

[0040] Table 5 below shows the neutralizing antibody levels 2 months after immunization. Figure 9 The graph shows the results of neutralizing antibody testing 2 months after immunization. It can be seen that, compared with 1 month after immunization, the antibody levels in all groups continued to increase in 2 months, and the three doses of rVSV-SEOV-GP were all higher than those of the HFRS inactivated vaccine group (42.12±2.765).

[0041] Table 6 below shows the neutralizing antibody levels 3 months after immunization. Figure 10 The graph shows the results of neutralizing antibody testing 3 months after immunization. It can be seen that, compared with 2 months after immunization, the antibody levels of all groups continued to rise in 3 months, and the three doses of rVSV-SEOV-GP were all higher than those of the HFRS inactivated vaccine group (61.26±18.78).

[0042] Table 7 below shows the neutralizing antibody levels at 4 months after immunization. Figure 11 The graph shows the results of neutralizing antibody testing 4 months after immunization. It can be seen that the antibody levels in each group decreased in 4 months compared to 3 months after immunization, and the three doses of rVSV-SEOV-GP were all higher than those of the HFRS inactivated vaccine group (62.08±8.216).

[0043] Based on the above results on neutralizing antibodies, it can be concluded that rVSV-SEOV-GP immunization induced the production of effective neutralizing antibodies in mice. Among the three dose groups of rVSV-SEOV-GP, 1×10⁻⁶ showed the highest neutralizing effect. 7 The PFU group had the highest level of neutralizing antibodies and the best immunization effect. Furthermore, observations at 0.5, 1, 2, 3, and 4 months post-immunization showed that 1×10⁻⁶ antibodies... 7 Neutralizing antibodies in the PFU group began to rise after immunization, peaked 3 months after immunization, and then began to decline. In April, antibody levels were comparable to those in February.

[0044] The neutralization assay (FFA) results showed that, compared with the vector control group rVSV-GFP, the rVSV-SEOV-GP vaccine induced higher neutralizing antibody titers in BALB / c mice; at the same time, the neutralizing antibody titers induced by the rVSV-SEOV-GP vaccine were higher than those induced by the HFRS inactivated vaccine.

[0045] Table 3. Neutralizing antibody titers 0.5 months after immunization <![CDATA[rVSV-SEOV-GP 1×10 7 PFU]]> 85.29±6.259 <![CDATA[rVSV-SEOV-GP 1×10 6 PFU]]> 74.15±2.873 <![CDATA[rVSV-SEOV-GP 1×10 5 PFU]]> 55.49±9.763 <![CDATA[rVSV-GFP 1×10 7 PFU]]> 13.52±1.251 <![CDATA[rVSV-GFP 1×10 6 PFU]]> 9.627±1.235 <![CDATA[rVSV-GFP 1×10 5 PFU]]> 4.155±0.4110 HFRS bivalent inactivated vaccine 23.11±1.628 Table 4 Neutralizing antibody titers one month after immunization <![CDATA[rVSV-SEOV-GP 1×10 7 PFU]]> 113.4±7.347 <![CDATA[rVSV-SEOV-GP 1×10 6 PFU]]> 94.27±7.882 <![CDATA[rVSV-SEOV-GP 1×10 5 PFU]]> 49.48±7.388 <![CDATA[rVSV-GFP 1×10 7 PFU]]> 11.92±1.690 <![CDATA[rVSV-GFP 1×10 6 PFU]]> 10.63±0.7931 <![CDATA[rVSV-GFP 1×10 5 PFU]]> 5.955±0.7705 HFRS bivalent inactivated vaccine 37.92±3.032 Table 5 Neutralizing antibody titers 2 months after immunization <![CDATA[rVSV-SEOV-GP 1×10 7 PFU]]> 1672±516.4 <![CDATA[rVSV-SEOV-GP 1×10 6 PFU]]> 715.2±282.3 <![CDATA[rVSV-SEOV-GP 1×10 5 PFU]]> 72.97±10.21 <![CDATA[rVSV-GFP 1×10 7 PFU]]> 11.92±1.821 <![CDATA[rVSV-GFP 1×10 6 PFU]]> 10.63±0.9648 <![CDATA[rVSV-GFP 1×10 5 PFU]]> 5.955±0.9873 HFRS bivalent inactivated vaccine 42.12±2.765 Table 6 Neutralizing antibody titers 3 months after immunization <![CDATA[rVSV-SEOV-GP 1×10 7 PFU]]> 4126±1178 <![CDATA[rVSV-SEOV-GP 1×10 6 PFU]]> 2389±741.2 <![CDATA[rVSV-SEOV-GP 1×10 5 PFU]]> 225.1±88.64 <![CDATA[rVSV-GFP 1×10 7 PFU]]> 41.69±6.631 <![CDATA[rVSV-GFP 1×10 6 PFU]]> 41.04±9.792 <![CDATA[rVSV-GFP 1×10 5 PFU]]> 30.00±4.846 HFRS bivalent inactivated vaccine 61.26±18.78 Table 7 Neutralizing antibody titers 4 months after immunization <![CDATA[rVSV-SEOV-GP 1×10 7 PFU]]> 2769±1041 <![CDATA[rVSV-SEOV-GP 1×10 6 PFU]]> 1638±1121 <![CDATA[rVSV-SEOV-GP 1×10 5 PFU]]> 571.7±348 <![CDATA[rVSV-GFP 1×10 7 PFU]]> 129.6±6.39.88 <![CDATA[rVSV-GFP 1×10 6 PFU]]> 94.97±14.79 <![CDATA[rVSV-GFP 1×10 5 PFU]]> 134.7±28.66 HFRS bivalent inactivated vaccine 62.08±8.216 It should be noted that when numerical ranges are mentioned in the claims of this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, the present invention describes preferred embodiments.

[0046] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

[0047] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A SEOV gene, characterized in that, The SEVO gene was obtained by mutating and truncating the SEVO M gene, including mutating isoleucine at position 530 to lysine, serine at position 1092 to leucine, and deleting 6 amino acids from the C-terminus of the SEVO M gene-encoded protein; the nucleotide sequence of SEVO M is shown in SEQ ID NO.

9.

2. A recombinant vector, characterized in that, It is obtained by ligating the SEVOV gene of claim 1 with the pVSVΔG-GFP vector via In-Fusion enzyme.

3. A recombinant virus, characterized in that, The recombinant vector of claim 2 and the helper plasmid are transfected into virus production cells, thereby packaging to obtain recombinant virus.

4. The recombinant virus according to claim 3, characterized in that, The virus-producing cells are BHK cells that have been infected with poxvirus.

5. The recombinant virus according to claim 4, characterized in that, The helper plasmids include PBS-N, PBS-P, PBS-G, and PBS-L.

6. The recombinant virus according to claim 5, characterized in that, The poxvirus in question is VV-T7.

7. The use of the recombinant virus according to any one of claims 3 to 6 in the preparation of a vaccine for the prevention of Seoul virus infection.

8. A vaccine for preventing Seoul virus infection, characterized in that, Includes the recombinant virus and vaccine acceptable excipients according to any one of claims 3 to 6.

Images