Establishment and application of gene editing transformation system of "red beauty" strawberry

CN122833073APending Publication Date: 2026-09-29THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610673998.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-05-15
Publication Date
2026-09-29

AI Technical Summary

Technical Problem

[0005]当前国际上草莓基因编辑体系效率低、再生率不高、编辑精准度不足,因此建立高效精准的八倍体草莓基因编辑体系,是突破育种瓶颈、推动草莓产业高质量发展的重要措施

Benefits of technology

(1)本发明通过靶向编辑FvEBZIP53-5基因保守uORF区域,实现了对八倍体草莓多拷贝同源基因的精准调控,克服了传统基因编辑方法难以应对多倍体基因功能冗余的技术瓶颈;

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122833073A_ABST
    Figure CN122833073A_ABST
Patent Text Reader

Abstract

The application discloses a "red beauty" strawberry gene editing transformation system and application. FvEBZIP53-5 The application discloses a "red beauty" strawberry gene editing transformation system and application. The application discloses a "red beauty" strawberry gene editing transformation system and application. The application discloses a "red beauty" strawberry gene editing transformation system and application. The application discloses a "red beauty" strawberry gene editing transformation system and application. The application discloses a "red beauty" strawberry gene editing transformation system and application. The application discloses a "red beauty" strawberry gene editing transformation system and application. The application discloses a "red beauty" strawberry gene editing transformation system and application. The application discloses a "red beauty" strawberry gene editing transformation system and application. The application discloses a "red beauty" strawberry gene editing transformation system and application. The application discloses a "red beauty" strawberry gene editing transformation system and application. The application discloses a "red beauty" strawberry gene editing transformation system and application. The application discloses a "red beauty" strawberry gene editing transformation system and application. The application discloses a "red beauty" strawberry gene editing transformation system and application. The application discloses a "red beauty" strawberry gene editing transformation system and application. The application discloses a "red beauty" strawberry gene editing transformation system and application. The application discloses a "red beauty" strawberry gene editing transformation system and application. The application discloses a "red beauty" strawberry genetic editing transformation system and application.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to gene editing and transformation systems for plants, and more particularly to the establishment of a gene editing and transformation system for the "Hongyan" strawberry variety and the creation and application of new germplasm with high sugar content, belonging to the field of establishing and applying gene editing and transformation systems for strawberries. Background Technology

[0002] Strawberries are one of the world's most popular berries, prized for their attractive appearance, balanced sweet and sour taste, rich aroma, low calorie content, and high nutritional value. Their bright red, plump appearance, regular shape, and scattered seeds make them visually appealing. In terms of flavor, the ratio of soluble solids to titratable acid is well-balanced, resulting in a sweet but not cloying, and tart but not astringent taste. They also contain various volatile compounds (esters, furans, terpenes, etc.). The flesh is soft, juicy, and melts in your mouth, providing an excellent eating experience. Rich in vitamin C and anthocyanins, and with a low GI and low calorie content, strawberries meet the demands of health-conscious consumers, making them a core ingredient for both fresh consumption and processing, with consistently strong market demand.

[0003] The current strawberry industry and its varieties suffer from significant shortcomings that hinder high-quality development: First, there is a prominent contradiction between flavor and storage and transportation tolerance. Major cultivated varieties prioritize large fruit size, early maturity, and high firmness, excessively sacrificing aroma and sugar-acid balance, resulting in a generally diluted strawberry flavor. Second, the strawberry industry exhibits poor disease and stress resistance, making it susceptible to powdery mildew, gray mold, and anthracnose. Continuous cropping also presents serious obstacles, leading to reliance on large amounts of pesticides, increasing costs, and impacting quality and safety. Third, post-harvest losses are extremely high. The fruit is soft, its cell walls are easily degraded, resulting in a short shelf life at room temperature, high distribution losses, and high cold chain costs. Fourth, traditional breeding methods face significant bottlenecks. Cultivated strawberries are allooctoploids with complex genomes, long hybridization cycles, difficulty in trait aggregation, and low efficiency in targeted improvement, making it difficult to quickly achieve synergistic improvements in core traits such as flavor, resistance, and storage tolerance.

[0004] Establishing a gene-editing system for octoploid strawberries is key to overcoming the aforementioned bottlenecks and achieving precise and efficient breeding. This is mainly reflected in three aspects: First, the strawberry allooctoploid genome is vast and contains redundant homologous genes, making it difficult to separate conventional hybrid traits and precisely aggregate target traits. Gene editing can target the knockout, replacement, or activation of specific genes (such as aroma synthesis genes and disease susceptibility genes), achieving precise improvement of individual traits while preserving superior background traits and shortening the breeding cycle. Second, it precisely balances quality with industry demands, resolving core contradictions. It can directionally optimize sugar and acid metabolism and aroma synthesis pathways; simultaneously, it can edit genes related to cell wall metabolism and ethylene synthesis, improving fruit firmness, delaying softening, extending shelf life, and reducing losses; and it can edit disease-resistant genes (such as MLO) to cultivate broad-spectrum disease-resistant varieties, reducing pesticide use.

[0005] Currently, international strawberry gene editing systems suffer from low efficiency, low regeneration rate, and insufficient editing precision. Therefore, establishing an efficient and precise octoploid strawberry gene editing system is an important measure to break through breeding bottlenecks and promote the high-quality development of the strawberry industry. Summary of the Invention

[0006] The purpose of this invention is to create new strawberry germplasm with high sugar content using an octoploid strawberry regeneration and gene editing system and by utilizing the established gene editing method.

[0007] To achieve the above objectives, the main technical solutions adopted by the present invention include: This invention provides a gene editing and genetic transformation method for increasing the sugar content of strawberry fruit, comprising: (1) Constructing a targeted strawberry FvEBZIP53-5 (1) Gene editing vector of CRISPR / Cas9; (2) Transform the constructed CRISPR / Cas9 gene editing vector into Agrobacterium; (3) Induce callus tissue using strawberry stem tips or leaves as explants; (4) Infect strawberry callus tissue with Agrobacterium that has been transformed into gene editing vector and co-culture it; (5) Screen resistant callus tissue by screening selectively labeled antibiotics and antibacterial agents; (6) Obtain regenerated plants by screening and culturing resistant callus tissue through multiple rounds of screening.

[0008] A preferred embodiment of the present invention, wherein the targeted strawberry FvEBZIP53-5 The method for constructing a CRISPR / Cas9 gene editing vector includes: (1) constructing an expression cassette containing the Arabidopsis pAtU3d promoter, two target sequences and sgRNA; the nucleotide sequences of the two target sequences are shown in SEQ ID No.1 and SEQ ID No.2, respectively; (2) inserting the expression cassette into the pYLCRISPR / Cas9 vector to obtain the gene.

[0009] This invention identifies through bioinformatics analysis FvEBZIP53-5 The conserved sequences of four homologous copies of the gene were analyzed by multiple sequence alignment to identify the conserved regions of the four homologous copies; this invention identified the strawberry gene. FvEBZIP53-5 The gene's translation regulatory sequence is located in the upstream open reading frame (OPF) between 95 bp and 108 bp upstream of the main ORF. Two guide RNA target sequences are designed targeting this upstream ORF region. These two target sequences are located within the conserved uORF region and can simultaneously target the gene. FvEBZIP53-5 Four homologous copies of the gene enable efficient editing of multiple copies.

[0010] In a preferred embodiment of the present invention, when strawberry shoot tips are used as explants in step (3) and induced culture is performed using an induction medium, the growth hormones used in the induction medium are TDZ and 2,4-D; most preferably, the induction medium is MS + TDZ 0.5 mg / L + 2,4-D 0.25 mg / L; the combination of TDZ and 2,4-D can efficiently induce the formation of dense callus tissue in strawberry shoot tips, with an induction rate of up to 99.37%, which is significantly better than the traditional 6-BA and NAA formula; when strawberry leaves are used as explants and induced culture is performed using an induction medium, the growth hormones used in the induction medium are TDZ and IBA; most preferably, the induction medium is MS + TDZ 1 mg / L + IBA 0.25 mg / L.

[0011] In a preferred embodiment of the present invention, the OD of the infiltration solution in step (4) is... 600 The value is 0.3 to 0.4, and the infection time is preferably 25 minutes. This infection condition has been optimized to ensure sufficient infection efficiency while avoiding excessive proliferation of Agrobacterium and its toxicity to explants. This is the key parameter for obtaining high transformation efficiency.

[0012] In a preferred embodiment of the present invention, the selectively labeled antibiotic in step (5) is hygromycin with a final concentration of 3 mg / L; the antibacterial agent is termethin with a final concentration of 200 mg / L; the present invention uses hygromycin 3 mg / L and termethin 200 mg / L for dual screening. Hygromycin is used to screen transformed cells that have successfully integrated exogenous genes, and termethin is used to inhibit the growth of Agrobacterium. This dual screening system can effectively screen positive transformants and control Agrobacterium contamination, thereby reducing the false positive rate.

[0013] In a preferred embodiment of the present invention, the adventitious bud differentiation medium in step (6) is preferably MS + 6-BA 0.5 mg / L + IAA 0.25 mg / L; using this adventitious bud differentiation medium can induce the formation of robust and regularly shaped adventitious buds; the adventitious bud subculture medium is preferably MS + 6-BA 0.25 mg / L + IAA 0.05 mg / L, and the adventitious buds proliferated using this adventitious bud subculture medium have complete seedling shapes and low vitrification; the adventitious bud elongation culture is preferably MS + 6-BA 0.2 mg / L + IBA 0.05 mg / L + GA3 0.05 mg / L, and the adventitious bud elongation culture can effectively promote the elongation of adventitious buds, resulting in thick stems and unfolded leaves; the rooting medium is preferably 1 / 2 MS + 0.1 mg / L IBA.

[0014] The strawberry described in this invention is the octoploid cultivated strawberry "Hongyan".

[0015] The present invention has the following main advantages: (1) This invention achieves precise regulation of multiple copies of homologous genes in octoploid strawberries by targeting and editing the conserved uORF region of the FvEBZIP53-5 gene, overcoming the technical bottleneck of traditional gene editing methods in dealing with functional redundancy in polyploid genes; (2) This invention improves the stability and in vitro regeneration capacity of explant materials to a certain extent. Compared with leaf explants, callus tissue derived from shoot tips shows a more significant advantage. This invention found that, in terms of callus induction, the dense callus induced by the combination of TDZ and 2,4-D is significantly better than that induced by the traditional 6-BA and NAA formula. The pale yellow dense callus tissue induced by TDZ and 2,4-D achieved an induction rate of 99.37%. The regeneration system optimized by this invention, especially the dense callus induced by shoot tips under the conditions of TDZ and 2,4-D, provides a stable and reliable material basis for subsequent genetic transformation experiments.

[0016] (3) The present invention optimizes the genetic transformation conditions of callus tissue from the red strawberry. Callus tissue induced by the shoot tip of the red strawberry is infected, and 40 mg / L AS is added to the infection solution. The optimal concentration of the infection solution is OD. 600 =0.3~0.4, infect for 25 min, then transfer to co-culture medium with a layer of filter paper and culture at 22℃ for 4 days. Then transfer to resistant bud selection medium and bud elongation medium. The final concentration of the most suitable antibiotic hygromycin for screening culture is 3 mg / L, and the final concentration of the most suitable antibiotic termethin is 200 mg / L. The transformation efficiency of the genetic transformation system established by this invention reaches 28.1%, which is significantly better than the existing technology level, and provides a reliable technical platform for functional genomics research of octoploid strawberries.

[0017] (4) This invention improves protein translation efficiency without changing the transcription level by editing the uORF regulatory region instead of directly overexpressing the gene, thereby significantly increasing the sugar content of the fruit and ensuring normal plant growth and development. This avoids the adverse effects of plant growth inhibition caused by traditional overexpression methods.

[0018] (5) This invention reveals the important role of the FvEBZIP53-5 gene uORF in the regulation of sugar metabolism in strawberry fruit, providing a theoretical basis and technical support for improving the high sugar quality of strawberries and creating new high-quality breeding materials. At the same time, it opens up a new way for the precise molecular design breeding of polyploid crops.

[0019] In summary, this invention utilizes strawberry... FvebZIP53-5 Gene sequence homology alignment and gene editing operations revealed FvebZIP53-5The translational regulatory function of homologous copy uORF in strawberry fruit provides an important technical platform for molecular design breeding of strawberries and opens up new avenues for improving strawberry fruit quality. Attached Figure Description

[0020] Figure 1 Morphological characteristics of callus tissue under different 6-BA and NAA ratios; Note: (a)-(f) represent the callus induction growth status of leaf explants on MS1-MS6, and (g)-(l) represent the callus induction growth status of shoot tip explants on MS1-MS6.

[0021] Figure 2 Morphological characteristics of callus tissue under different ratios of TDZ and 2,4-D; Note: (a)-(f) represent the callus induction growth status of leaf explants on MS7-MS12, and (g)-(l) represent the callus induction growth status of shoot tip explants on MS7-MS12.

[0022] Figure 3 Morphological characteristics of callus tissue under different TDZ and IBA ratios; Note: (a)-(f) are the callus induction growth status of leaf explants on MS13-MS18, respectively; (g)-(l) are the callus induction growth status of shoot tip explants on MS13-MS18, respectively.

[0023] Figure 4 Results of different differentiation culture media selection; Note: (a)-(f) show the differentiation and elongation of adventitious shoots under different hormone combinations, respectively.

[0024] Figure 5 The growth status of callus tissue on different concentrations of hygromycin; Note: (a)-(e) show the callus growth status at Hgy concentrations of 0, 1, 2, 3, and 4 mg / L, respectively.

[0025] Figure 6 The effect of different hygromycin concentrations on callus growth.

[0026] Figure 7 The growth status of callus tissue at different concentrations of termethin; Note: (a)-(d) show the callus growth status at Tim concentrations of 0, 100, 200, and 300 mg / L, respectively.

[0027] Figure 8 The effect of bacterial concentration on conversion efficiency.

[0028] Figure 9 The effect of infection time on conversion efficiency.

[0029] Figure 10The regeneration process of Agrobacterium-mediated strawberry transgenic plants; Note: (a) induction of callus; (b) Agrobacterium infection; (c) selection culture; (d) differentiation culture; (e) induction into plants.

[0030] Figure 11 For the octoploid strawberry "red beauty" FvebZIP53-5 Homologous protein amino acid sequence alignment; Note: Fvb5-1 , Fvb5-2 , Fvb5-3 , Fvb5-4 for FvebZIP53-5 Four homologous copies.

[0031] Figure 12 for FvebZIP53-5 Distribution and sequence conservation of proximal uORFs of homologous genes; Note: (a): FvebZIP53-5 (a) Distribution of upstream proximal uORFs of four homologous genes CDS; (b) Sequence conservation analysis of target uORF.

[0032] Figure 13 for FvebZIP53-5 Schematic diagram of homologous gene uORF editing target sites and CRISPR / Cas9 vector; Note: (a): FvebZIP53-5 Location of the target uORF of the homologous gene. The gray box represents the uORF, the blue box represents the main coding region (CDS), and "+1" indicates the translation start site. The enlarged area shows the two CRISPR / Cas9 editing target sites designed within the target uORF, and the red bases represent the PAM sequence. (b): Schematic diagram of the CRISPR / Cas9 editing vector structure.

[0033] Figure 14 The results of PCR identification of regenerated strawberry plants.

[0034] Figure 15 for FvebZIP53-5 Expression level analysis of mutants and wild-type; Note: ns indicates no significant difference.

[0035] Figure 16The effect of uORF mutations on the translation efficiency of downstream main open reading frames (MORFs); Note: (a): Different mutation types in the uORF region. m1 represents the vector construction type expected to produce large fragment deletions in the uORF region; blue letters indicate nucleotide substitutions or deletions; gray boxes represent amino acid residues translated from wild-type uORF; orange boxes represent amino acid residues altered by mutations. (b): Schematic diagram of the dual-luciferase reporter vector structure. The vector is driven by the CaMV 35S promoter, REN is the internal control luciferase, LUC is the reporter gene, and the uORF fragment is located upstream of the LUC gene. (c): The effect of different uORF mutants on the translation efficiency of pORF (main open reading frame) in the dual-luciferase reporter system, with relative translation activity expressed as the LUC / REN ratio. Data are expressed as mean ± standard deviation (n=3); ** indicates significant difference at the 0.01 level (mean ± standard deviation). P <0.01), *** indicates that the difference is highly significant at the 0.001 level. P <0.001).

[0036] Figure 17 The results show the soluble sugar content of different transgenic strawberry lines; Note: * indicates a significant difference at the 0.05 level. P <0.05). Detailed Implementation

[0037] The present invention will be further described below with reference to specific experimental examples, and the advantages and features of the present invention will become clearer with the description. However, these experimental examples are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions to the details and form of the present invention can be made without departing from the spirit and scope of the present invention, but all such modifications and substitutions fall within the protection scope of the present invention.

[0038] Experiment Example 1: Gene editing, genetic transformation, and regeneration culture experiment on sugar content in strawberry fruit. 1. Biomaterials 1.1 Plant materials This experiment used the octoploid "Hongyan" strawberry as the test plant material. All plants were planted at the Chinese Academy of Agricultural Sciences experimental base and managed uniformly.

[0039] 1.2 Strains and Vectors pYLCRISPRCas9Pubi-H The vector was kindly provided by Liu Yaoguang's laboratory, Escherichia coli TOP10 was purchased from Zhuangmeng Technology, and Agrobacterium tumefaciens GV3101 was preserved in the inventor's laboratory.

[0040] 2. Test Methods 2.1 Construction of CRISPR / CAS9 expression vector This experiment utilized the CRISPR-Cas9 system to... FvebZIP53-5 Four homologous copies were used to predict and edit the uORF region. The backbone vector used was... pYLCRISPR / Cas9Pubi-H The two target sites were respectively used to construct complete expression cassettes with the Arabidopsis pAtU3d promoter and sgRNA, and then finally ligated into the final vector. pYLCRISPR / Cas9Pubi-H superior.

[0041] (1) Protein sequence acquisition and analysis FvebZIP53-5 The sequence was obtained from the Phytozome database (Fragaria x ananassa v1.0.a1 (Phytozome genome ID: 675 • NCBI taxonomy ID: 3747)), and its amino acid sequence was compared using the CLUSTAL_X tool in BioEdit, based on diploid strawberry. FvebZIPs1.1 For reference, the MEGA 7.0 neighbor-joining method was used to construct the phylogenetic tree, and the branch confidence was evaluated by 1000 bootstrap tests.

[0042] (2) bZIP Key gene screening This experiment analyzed the strawberry species by constructing a phylogenetic tree. FvebZIP53-5 It might be a strawberry FvebZIPs1.1 The homologous gene contains 4 homologous copies ( FvebZIP53-5-1, FvebZIP53-5-2, FvebZIP53-5-3, FvebZIP53-5-4 By using BLAST to align conserved regions of four DNA sequences, two editing target sites can be constructed at the uORF predicted locations corresponding to these regions, enabling the simultaneous knockout of four homologous genes.

[0043] (3) Target design and sgRNA expression cassette assembly Using the CRISPR-GE online tool (http: / / skl.scau.edu.cn / ) and considering the gene knockout requirements, two target sites, T1 (GACGCATGAGTGTCATAGAA (SEQ ID No. 1)) and T2 (GGAAGGCGACGGAGAAAGAG (SEQ ID No. 2)), were designed in key regulatory regions. An expression cassette containing the Arabidopsis pAtU3d promoter, target sequence, and sgRNA was constructed and inserted into the pYLCRISPR / Cas9 vector.

[0044] Table 1 Primers required for vector construction

[0045] (4) Kinmen cloning ligation vector The amplified target fragment was purified by gel extraction and then ligated into a vector using an enzyme digestion-ligation method. The ligation product was transformed into E. coli, and positive single clones were screened by PCR. The clones were then amplified by shaking, and the plasmid was extracted using the plasmid mini-prep method. After sequencing identification, the constructed vector was obtained.

[0046] Table 2 Edge-cutting and edge-connecting system

[0047] 2.2 Cultivation of aseptic seedlings from strawberry seeds Strawberry seeds were rinsed and cleaned, then immersed in 75% alcohol for 30 seconds, followed by sterilization with 84 disinfectant for 1 minute. This sterilization process was repeated three times. The treated seeds were then aliquoted into centrifuge tubes, and different concentrations of 6-BA (0, 5, 10, 15 mg / L) and NAA (0, 5, 10, 15 mg / L) solutions were added and soaked for 12 hours. Each treatment was repeated three times, with 30 seeds per replicate. After washing with sterile distilled water, the seeds were inoculated onto 1 / 2 MS medium under sterile conditions and cultured at 25℃ ± 2℃, 3000 lx light intensity, and 14 hours / day until germination, yielding sterile seedlings. Germination was assessed and the germination rate calculated after 30 days of culture.

[0048] 2.3 Callus induction Strawberry stem tips were peeled off under a stereomicroscope, and 3-5 mm stem tips were inoculated into induction medium. MS medium with B5 organic base was used, with different concentrations of TDZ, 6-BA, NAA, IBA, and 2,4-D added. 20-30 stem tips were inoculated per treatment, with three replicates. Callus induction was assessed after 30 days of culture.

[0049] Healthy strawberry plantlets of about 30 days old were selected as explants. Leaf edges and tips were removed, and the leaves were cut into pieces. The abaxial surface was placed downward and the pieces were inoculated into the culture medium. 10 to 20 pieces were placed in each dish, and the biological replicates were performed three times. The callus induction rate was counted after 30 days of culture.

[0050] Table 3. Ratio of growth regulators for inducing callus tissue

[0051] 2.4 Differentiation of callus tissue Healthy callus tissues were selected and inoculated onto MS-based differentiation media supplemented with different concentrations of plant growth regulators (Table 4). 15-20 callus tissues were treated per treatment, with 3 replicates. Subculture was performed every 3 weeks, and regeneration was assessed after 60 days.

[0052] Table 4. Ratio of growth regulators in differentiation culture medium

[0053] 2.5 Rooting and Transplanting Explant-differentiated shoot clusters were selected and inoculated into 1 / 2 MS medium containing 0.1–0.5 mg / L IBA for root induction. Healthy plantlets were selected, and after washing the roots of the culture medium, they were transplanted into a sterile mixed substrate (nutrient soil: sand: clay = 1:1:1) for indoor cultivation. Plastic wrap was used to maintain moisture, and temperature, humidity, and ventilation were controlled to ensure normal seedling growth.

[0054] 2.6 Hygromycin Screening Select pale yellow, dense callus tissue (MS + TDZ 0.5 mg / L + 2,4D 0.25 mg / L), remove the surface differentiation part, and inoculate it into the same formula medium containing different concentrations of hygromycin (0~4 mg / L), with 3 replicates.

[0055] 2.7 Selection of antibacterial concentration of termethin Dense, pale yellow callus tissue (MS + TDZ 0.5 mg / L + 2,4D 0.25 mg / L) was selected and inoculated into culture media containing 0, 100, 200, and 300 mg / L termethin. The growth of the explants was observed and recorded, and each concentration was replicated three times.

[0056] 2.8 Transformation of Agrobacterium tumefaciens with gene editing vector Take 50 μL of GV3101 Agrobacterium competent cells, add 8 μL of plasmid, and gently mix. Incubate on ice, liquid nitrogen for 5 min, heat shock, and ice for 5 min each. Add antibiotic-free LB and incubate at 28℃ with shaking for ≥ 3 h.

[0057] The bacterial culture was plated on Kan + Rif double antibody LB plates and incubated upside down at 28°C for 48 h. Single clones were picked for PCR identification. Positive colonies were mixed with 50% sterile glycerol at a 1:1 ratio, flash-frozen in liquid nitrogen, and stored at -80°C.

[0058] 2.9 Activation of Agrobacterium Agrobacterium tumefaciens at -80℃ was plated on double-antibiotic LB agar plates and incubated at 28℃ in the dark for 2 days. The bacterial cells were scraped off and resuspended in infection solution containing 40 mg / L AS to the desired OD. 600 ,spare.

[0059] 2.10 Optimization of Conversion Conditions System optimization of bacterial concentration (OD) 600 The treatments included 0.1, 0.2, 0.3, 0.4, and 0.5 min inoculation times (5, 15, 25, and 35 min), with 20-30 callus tissues inoculated for each treatment. Three replicates were set up. The resistant callus rate and resistant bud differentiation rate were used as evaluation indicators to screen for optimal genetic transformation conditions, improve transformation efficiency, and achieve exogenous gene expression.

[0060] 2.11 Agrobacterium infection and co-culture Select healthy, pale yellow strawberry callus tissue and transfer it into a 50 mL sterile centrifuge tube containing Agrobacterium suspension. Gently shake several times to ensure full contact between the bacteria and the explant. After infection, discard the bacterial suspension, blot dry the callus surface with sterile filter paper, and transfer it to co-culture medium (MS + TDZ 0.5 mg / L + 2,4-D 0.25 mg / L + AS 40 mg / L). Incubate in the dark at 22°C for 4 days.

[0061] 2.12 Resistance Tissue Screening After co-culturing, the callus tissue was washed, sterilized, and soaked in a sterile solution before being transferred to a selection medium for dark culture. Subculture was performed every 21 days for two rounds of selection. In the second round of selection, browned and dead materials were removed, and pale yellow, dense, healthy callus tissue was selected and transferred to a new medium.

[0062] 2.13 Preparation of strawberry plant tissue culture medium (1) Solid culture medium (autoclaved at 121℃ for 15 min): Shoot tip propagation / callus induction / subculture medium: MS macro-particles 50 mL / L, MS micro-particles 1 mL / L, B5 organic 1 mL / L, inositol 0.1 g / L, iron salts 5 mL / L, sucrose 30 g / L, MES 0.5 g / L, phytagel 3.0 g / L, pH 5.8, with corresponding hormones added; Co-culture: The basic formula is the above-mentioned shoot tip rapid propagation / callus induction / subculture medium, pH 5.2, with 40 mg / L AS and hormones added; Selective culture medium: The basic formula is the above-mentioned shoot tip rapid propagation / callus induction / subculture medium, wherein the sucrose is changed to 20 g / L, pH 5.8, and 200 mg / L termethin, 3 mg / L hygromycin and hormones are added; Differentiation medium: The above shoot tip rapid propagation / callus induction / subculture medium was supplemented with 1 g / L activated carbon, pH 5.8, 200 mg / L termethin and hormones; Seed germination: 1 / 2 MS, pH 5.8, with 5.5 g / L Agar and inducing hormone; Seedling strengthening: 1 / 2 MS, add 1 g / L activated carbon, pH 5.8, add 0.1 mg / L IBA.

[0063] (2) Liquid culture medium: (sterilized at 121℃ for 15 min): Infection solution: The above shoot tip rapid propagation / callus induction / subculture medium was supplemented with 10 g / L glucose, pH 5.2, 40 mg / L LAS and hormones; Recovery solution: Same as 1 / 2 MS, pH 5.8, with 200 mg / L termethin and hormones added.

[0064] (3) Basic mother liquor: MS (20×), B5 organic (1000×), MS (1000×), Fe-EDTA (200×), prepared according to conventional ratio.

[0065] (4) Reagents (all 1 mg / mL, unless otherwise specified): 6-BA, TDZ, IBA, NAA, 2,4-D: Dissolve in 1N KOH, filter and sterilize, then freeze at -20℃; Hygromycin (5 mg / mL), Termetidine (200 mg / mL): Dissolve in sterile water, filter and sterilize, then freeze at -20°C; AS (40 mg / mL): Dissolved in DMSO; GA3 and IAA: Dissolved in ethanol.

[0066] 2.14 Identification of Transformed Plants After PCR identification of strawberry genomic DNA samples, positive plants were sequenced.

[0067] Table 5 Primers used for positive identification and sequencing

[0068] 2.15 Luciferase Complementation (LUC) Assay Wild-type and three mutant 5' promoters were inserted respectively. pGreenII0800-LUC Five recombinant vectors were constructed upstream of the luciferase vector, and Agrobacterium GV3101 was used for transient transformation of tobacco. Agrobacterium was resuspended in infection solution (10 mM MgCl2, 10 mM MMEs, pH 5.6, 200 μM acetylsylcholine). Tobacco leaves with uniform growth were selected and injected for infection, and the groups were labeled. Samples were taken two days after transfection, and the LUC / REN activity ratio was measured and calculated.

[0069] 2.16 Determination of soluble sugar content (1) Sample preparation: Weigh the sample, add distilled water and grind it, heat it in a boiling water bath and centrifuge it, take the supernatant and make up the volume for later use.

[0070] (2) Instrument preheating: Preheat the spectrophotometer or microplate reader, set the wavelength and zero it with distilled water.

[0071] (3) Preparation of standard solution: Dilute the standard in a gradient for later use.

[0072] (4) Colorimetric determination: After adding the sample and mixing, develop the color in a water bath, and measure the absorbance value after cooling. Calculate the corresponding difference.

[0073] (5) Content calculation: Calculate the sample concentration based on the standard curve, and then calculate the soluble sugar content.

[0074] (6) Calculation formula: ΔA = A_test tube - A_blank tube, ΔA_standard = A_standard tube - A_blank tube A standard curve was established with the concentration of the standard (x, mg / mL) on the x-axis and the absorbance difference ΔA (y) on the y-axis. The sample ΔA was substituted into the regression equation to calculate the corresponding concentration (x, mg / mL).

[0075] Soluble sugar (mg / g mass) = (x V1) / (W V1 / V2) = 10 × 10 / W3 V1: Sample volume added, 0.04 mL; V2: Total sample volume, 10 mL; W: Sample mass, g.

[0076] 2.17 Data Statistics and Analysis Contamination rate (%) = (Number of contaminated explants / Total number of explants) × 100% Survival rate (%) = (Number of surviving explants / Total number of explants) × 100% Seedling survival rate (%) = (Number of seedling explants / Total number of explants) × 100% Rooting rate (%) = (Number of rooted plants / Total number of plants) × 100% Seed germination rate (%) = (Number of germinated seeds / Total number of seeds) × 100% Callus induction rate (%) = (Total number of explants forming callus / Total number of explants) × 100% Adventitious bud regeneration rate (%) = (Number of calluses differentiating into adventitious buds / Total number of calluses) × 100% Callus survival rate (%) = (Number of surviving calluses / Total number of calluses) × 100% Conversion rate (%) = (Number of resistant callus or plants / Total number of infected explants) × 100% Data processing and graphing were performed using SPSS and GraphPad Prism software.

[0077] 3. Experimental Results 3.1 Establishment of a rapid propagation system for *Strawberry 'Red Face'* runners via stem tips 3.1.2 Effects of exogenous hormones on strawberry growing point germination The size of the explant affects the speed and quality of shoot germination. Inoculation with growth points of 0.5–0.8 mm reduces the risk of virus transmission. Induction results are shown in Table 6. The results indicate that 6-BA plays a crucial role in inducing shoot tip formation. On hormone-free media, strawberry plants proliferated, but the proliferation was limited and insufficient for the experimental requirements. On media supplemented with 0.35 mg / L and 0.5 mg / L 6-BA, the *Strombax ceiba* 'Red Face' strawberry exhibited high seedling rates and vigorous shoot growth. However, treatment with 0.5 mg / L 6-BA resulted in slight vitrification, which worsened with subsequent subcultures. Treatment with 1 mg / L 6-BA further increased the number of vitrified seedlings. Therefore, this experiment used 0.5 mg / L 6-BA to induce shoot tip formation, and the 6-BA concentration was appropriately reduced to 0.35 mg / L during subculture. At this concentration, the plants grew vigorously and rooted naturally.

[0078] Table 6 Seedling survival rate of strawberry growing points under different treatments

[0079] Note: Different letters indicate processing rooms. P Significant difference at the <0.05 level.

[0080] 3.1.3 Effects of exogenous hormones on strawberry root growth Sterile test-tube plantlets obtained from proliferation culture were transferred to rooting medium for adventitious root induction culture. After a period of culture, the rooting status of each group of plants was recorded and the rooting rate was calculated. The rooting effects of different concentrations of IBA in this experiment were compared (Table 7). As can be seen from Table 7, the overall rooting effect was relatively ideal, indicating that strawberry rooting culture is relatively easy. However, with the extension of culture time, the inhibitory effect of high concentrations of IBA became more obvious, and the growth status of the seedlings varied greatly. After 60 days of culture, when the IBA concentration was higher than 0.3 mg / L, root growth was significantly inhibited, and the plants were shorter and had fewer and shorter roots compared with the plants treated with low concentrations. The growth vigor of the seedlings was closely related to the IBA concentration. For plants with weak growth vigor, adding 0.1~0.2 mg / L IBA helped to form roots and improve the growth vigor of the seedlings, which played a significant role in improving the survival rate of transplanted plants. Therefore, the optimal rooting medium selected in this experiment was 1 / 2 MS medium supplemented with 0.1 mg / L IBA.

[0081] Table 7 Rooting rate of strawberry seedlings under different treatments

[0082] Note: Different letters indicate processing rooms. P Significant difference at the <0.05 level.

[0083] 3.2 Optimization of the Red Beauty Strawberry Regeneration System 3.2.1 Strawberry seed germination culture Under natural conditions, strawberry seeds have a low germination rate. This experiment compared the effects of different plant growth regulators on strawberry seed germination. The germination rate in the water group was 24.33 ± 1.36%. Among the NAA treatments, the 10 mg / L concentration showed the most significant promoting effect, with a germination rate of 38.94 ± 7.12%; while the 5 mg / L and 15 mg / L concentrations showed some promotion, the effect was poor. Among the 6-BA treatments, the 10 mg / L treatment had the highest germination rate, reaching 37.83 ± 2.25%; the promoting effects of the 5 mg / L and 15 mg / L concentrations were less than that of the 10 mg / L treatment.

[0084] In summary, 10 mg / L NAA and 10 mg / L 6-BA showed the best promoting effect on strawberry seed germination, providing better seed germination treatment conditions for subsequent aseptic seedling cultivation and regeneration system construction.

[0085] Table 8 Germination rate of strawberry seeds under different treatments

[0086] Note: Different letters indicate processing rooms. P Significant difference at the <0.05 level.

[0087] 3.2.2 Callus induction Under different hormone ratios, the leaves and stem tips of the "Red Beauty" strawberry showed a high rate of callus formation, but the callus growth conditions varied considerably.

[0088] The test results are shown in Table 9 and Figure 1 In all culture media using 6-BA and NAA combinations as regulators, the callus formation rate of leaf explants reached 100%. However, the callus was mostly yellowish-brown, loose in texture, and generally exhibited vitrification and browning. Overall, the growth was poor and the activity was low, which may affect subsequent differentiation. The callus induction rate of shoot tip explants was highest in MS5 (6-BA 1 mg / L + NAA 1 mg / L) at 79.13 ± 7.30%, and lowest in MS3 (6-BA 0.5 mg / L + NAA 1.5 mg / L) at 44.34 ± 7.11%. The shoot tip callus was unhealthy yellowish-brown or grayish-white, loose in texture, and some were fluffy and easily rotted. With prolonged culture time, vitrification intensified, resulting in a water-soaked surface, loose structure, and obvious browning. Only a few incompletely browned calluses maintained weak growth and had no subsequent differentiation value.

[0089] The basal culture medium for MS1-MS18 below is MS+B5 organic, with the addition of different hormones.

[0090] Table 9. Effects of different 6-BA to NAA ratios on callus induction.

[0091] Note: Different letters indicate processing rooms. P Significant difference at the <0.05 level.

[0092] The experimental results under the combined treatment of TDZ and 2,4-D are shown in Tables 10 and 11. Figure 2 The experimental results showed that the callus induction rate of leaf explants was 100% in all cases. Despite the high induction efficiency, the browning of the callus gradually worsened with increasing hormone concentration, and mild to moderate vitrification was commonly observed. Only the low-concentration treatment group maintained relatively normal growth. Overall, the callus activity from leaf sources was low, which may adversely affect subsequent differentiation and regeneration.

[0093] In comparison, this hormone combination showed superior induction effects on shoot tip explants. MS8 (TDZ 0.5 mg / L + 2,4-D 0.25 mg / L) had the highest induction rate of 99.37%, while MS7 (TDZ 0.5 mg / L + 2,4-D 0.15 mg / L) had the lowest at 71.62 ± 3.17%. The shoot tip calluses were large, uniformly pale yellow, dense and compact, not easily broken by forceps, and showed no browning or vitrification, exhibiting good growth. With increasing hormone concentration, the calluses gradually differentiated into adventitious buds, demonstrating excellent differentiation potential.

[0094] Table 10 Effects of different TDZ to 2,4-D ratios on callus induction.

[0095] Table 11 Effects of different TDZ to 2,4-D ratios on callus induction

[0096] Note: Different letters indicate processing rooms. P Significant difference at the <0.05 level.

[0097] The experimental results under the combined treatment of TDZ and IBA are shown in Table 12 and... Figure 3 The experimental results show that the callus induction rate of leaf explants reached 100%, enabling stable and efficient callus formation. Morphological observation revealed that leaf-derived calluses were mostly yellowish-white, with a dense and compact structure, and no obvious vitrification was observed. The callus structure was particularly optimal on MS17 (TDZ 1 mg / L + IBA 0.25 mg / L), producing a large quantity of dense, healthy yellowish-white callus without browning or vitrification.

[0098] The callus induction rate of shoot tip explants in MS13-MS18 series media ranged from 78.96% to 94.59%, with the highest callus induction rate (94.59 ± 4.89%) observed in the MS17 medium treatment group and the lowest (78.96 ± 3.77%) in the MS13 (TDZ 0.5 mg / L + IBA 0.1 mg / L) medium treatment group. Morphologically, the shoot tip callus tissue was mostly yellowish-white, firm in texture, and exhibited slight browning in most cases. Adventitious bud differentiation was observed in the shoot tip callus tissue of most treatment groups.

[0099] Table 12 Effects of different TDZ to IBA ratios on callus induction

[0100] Note: Different letters indicate processing rooms. P Significant difference at the <0.05 level.

[0101] This experiment used leaves and shoot tips of *Strombocys edulis* as explants. Callus induction was statistically analyzed (using SPSS software) after 30 days of cultivation under different culture media. By comparing the combinations and concentrations of plant growth regulators and the type of explant, it was found that shoot tip explants showed the highest callus induction rate (99.37 ± 1.09%) in MS8 medium (TDZ 0.5 mg / L + 2,4-D 0.25 mg / L). The induced calluses were pale yellow, dense, and compact, without vitrification or browning, exhibiting good growth, and some calluses differentiated into adventitious buds. Overall, this treatment performed better than other combinations. Leaf explants showed a 100% callus induction rate under the condition of TDZ 1 mg / L + IBA 0.25 mg / L. The calluses were yellowish-white, compact, and without vitrification, making this the optimal culture medium for leaf callus induction.

[0102] Therefore, the optimal formulation for shoot tip callus induction was determined to be 0.5 mg / L TDZ + 0.25 mg / L 2,4-D, and for leaves, 1 mg / L TDZ + 0.25 mg / L IBA. Because shoot tip-induced callus proliferates rapidly, grows large, and possesses the potential for adventitious bud differentiation, its regeneration capacity is significantly superior to that of undifferentiated leaf-derived callus, making it more suitable for subsequent regeneration system construction and genetic transformation research. Therefore, shoot tip-induced callus was used as the transformation recipient material in all subsequent experiments.

[0103] 3.2.3 Selection of the optimal culture medium for callus differentiation By placing calluses of similar growth and good condition on differentiation media with different hormone ratios, the effects of each medium were observed after three weeks of culture. The B3 medium (6-BA 0.5 mg / L + IAA 0.25 mg / L) induced the formation of robust, well-formed adventitious shoots, making it suitable as a differentiation medium. The B4 medium (6-BA 0.25 mg / L + IAA 0.05 mg / L) produced shoots with intact morphology and low vitrification, making it suitable as a subculture medium for adventitious shoot propagation. In contrast, the B5 medium (6-BA 0.5 mg / L + NAA 0.1 mg / L) showed low differentiation rates and severe vitrification of regenerated shoots, while the B6 medium (TDZ 1 mg / L + IBA 0.2 mg / L) resulted in malformed adventitious shoots due to its high hormone concentration; both were unsuitable as differentiation media.

[0104] In adventitious shoot elongation culture, the B1 medium (6-BA 0.2 mg / L + IBA 0.05 mg / L + GA3 0.05 mg / L) effectively promoted adventitious shoot elongation, resulting in robust stems and fully expanded leaves, making it the optimal elongation medium. The B2 medium (6-BA 0.2 mg / L + IBA 0.05 mg / L + GA3 0.1 mg / L), due to its excessively high GA3 concentration, resulted in thin, elongated regenerated shoots and weak stems, which was detrimental to subsequent growth. Differences in growth morphology between different mediums are shown below. Figure 4 As shown.

[0105] Note: The following B1-B6 culture media consist of MS + B5 with different hormones.

[0106] Table 13 Effects of different hormone treatments on the differentiation rate of clustered shoots

[0107] Note: Different letters indicate processing rooms. P Significant difference at the <0.05 level.

[0108] 3.3 Analysis of Factors Affecting the Conversion Efficiency of Red Beauty Strawberries 3.3.1 Determination of Hygromycin Screening Concentration This experiment aimed to screen for an appropriate hygromycin (Hyg) concentration in the genetic transformation of strawberry callus. The Agrobacterium binary vector plasmid used carried a Hyg resistance gene. After successful transformation into strawberry explants, the induced callus acquired resistance, while untransformed callus became sensitive to Hyg and stopped growing or died. Excessive Hyg concentration inhibited normal callus growth, while insufficient concentration easily led to false positives. Therefore, screening for an appropriate antibiotic concentration was one of the key factors in ensuring successful genetic transformation.

[0109] Strawberry callus tissue was inoculated into culture media containing 0, 1, 2, 3, and 4 mg / L Hyg, respectively, and the survival rate was calculated after 30 days of incubation at a constant temperature. Results ( Figure 5 and Figure 6 The results showed that callus survival rate decreased significantly with increasing Hyg concentration: the 0 mg / L treatment group was robust with a survival rate of 94.71%, the 1 mg / L treatment group was 53.35%, the 2 mg / L treatment group was 30.03%, the 3 mg / L treatment group was 10.14%, and the 4 mg / L treatment group was only 2.89%, with almost all of them dying.

[0110] Comprehensive analysis shows that 3 mg / L Hyg can effectively inhibit the growth of untransformed callus and reduce false positives, while retaining a small amount of resistant callus tissue. Therefore, 3 mg / L Hyg was determined to be the appropriate screening concentration for the genetic transformation of strawberry callus tissue, providing reliable screening conditions for subsequent genetic transformation experiments.

[0111] 3.3.2 Determination of the antibacterial concentration of termethin To screen for the optimal concentration of termethin in the genetic transformation of *Strombocys edulis* shoot tips that inhibits bacterial growth without affecting differentiation, this study used MS medium supplemented with 0.5 mg / L TDZ and 0.25 mg / L 2,4-D, and set up four concentration treatments: 0, 100, 200, and 300 mg / L. Callus tissue derived from shoot tips was inoculated into the corresponding media, and growth and differentiation were observed after 30 days of culture. The optimal concentration was determined based on the antibacterial effect.

[0112] Results after 30 days of cultivation (Table 14 and...) Figure 7 The results showed that different concentrations had different effects on callus and adventitious bud differentiation. In the control group, callus was vigorous and adventitious bud differentiation was normal; as the concentration of termethin increased, the differentiation ability was gradually inhibited. Under the treatment of 300 mg / L, the callus mainly showed swelling growth and the number of adventitious buds was significantly reduced.

[0113] Comprehensive analysis showed that low concentrations of termethin had little effect on callus growth, while high concentrations significantly inhibited differentiation. The 100 mg / L treatment showed poor antibacterial effect and contamination was observed; 200 mg / L effectively inhibited bacteria while maintaining relatively normal callus growth and differentiation. Therefore, 200 mg / L was determined to be the optimal termethin concentration for genetic transformation of the Red Face strawberry, providing a foundation for obtaining positive plants.

[0114] Table 14. Inhibitory effect of termethin on Agrobacterium and its influence on strawberry shoot tip explant regeneration.

[0115] Note: —: Does not inhibit Agrobacterium growth, numerous bacterial spots are visible to the naked eye; +: Moderate antibacterial effect, a few bacterial spots are visible to the naked eye; ++: Good antibacterial effect, no Agrobacterium growth is observed to the naked eye.

[0116] 3.3.3 Effect of bacterial culture concentration on strawberry conversion efficiency The concentration of the bacterial culture solution is a key factor affecting the efficiency of genetic transformation. When the concentration is too high, Agrobacterium secretes excessive toxic substances, easily causing damage or even necrosis of recipient tissues, significantly reducing transformation efficiency. Conversely, when the concentration is too low, Agrobacterium's infectivity is insufficient, reducing infection efficiency and consequently, transformation efficiency. To determine the optimal bacterial culture concentration, five concentration gradients (0.1, 0.2, 0.3, 0.4, and 0.5) were set up in this experiment to compare the effects of different bacterial culture concentrations on explant transformation. The results are shown in [Figure number missing]. Figure 8 .

[0117] The results showed that the bacterial concentration was OD 600 When the concentration of the bacterial culture is 0.4, the highest conversion rate is 28.5%; the bacterial culture concentration is OD 600 =0.3 and OD 600 The transformation efficiency was basically the same at a concentration of 0.4. However, when the bacterial concentration was 0.5%, the explants were prone to browning, which inhibited their differentiation. Considering both transformation efficiency and explant growth status, the OD was determined... 600 =0.3~0.4 is the suitable concentration range for infecting bacterial solution.

[0118] 3.3.4 Effect of infection time on transformation Infection time significantly affects the efficiency of exogenous gene introduction. Excessive time can lead to excessive proliferation of Agrobacterium, producing toxicity and inhibiting explant differentiation; insufficient time results in inadequate contact between Agrobacterium and explants, leading to decreased transformation efficiency. To investigate the effect of infection time on transformation efficiency, this experiment set four time gradients: 5, 15, 25, and 35 min. The results are shown below. Figure 9 .

[0119] The results showed that excessively long infection time easily led to browning and necrosis of explants, inhibiting growth; while too short a time resulted in low exogenous gene introduction efficiency, and the newly formed tissues after screening were prone to whitening and death. Considering both explant growth status and transformation effect, 25 min was determined to be the appropriate Agrobacterium infection time.

[0120] 3.4 Obtaining Regenerated Red Beauty Strawberry Plants This experiment compared the induction effects of different plant growth regulator ratios on shoot tip explants to obtain the optimal callus induction medium. Based on this, factors affecting the efficiency of strawberry genetic transformation were systematically optimized, and a stable transformation technology system was established. The specific procedures were as follows: well-developed, dense callus tissue was selected as recipient material; Agrobacterium infection time was 25 min; and the concentration of the infection solution was OD0.05. 600=0.3~0.4, acetylsyringone 40 mg / L was added to the infection solution, and the plants were co-cultured at 22℃ for 4 days. After co-culture, the explants were transferred to a resistant shoot selection medium for selection. After two rounds of selection, they were transferred to a differentiation medium to induce seedling growth, followed by a shoot elongation medium to promote shoot growth. Finally, the obtained resistant shoots were transferred to a rooting medium to induce rooting, thus obtaining the "Hongyan" strawberry transformed plants. The regeneration and transformation process of "Hongyan" strawberry plants is described in [link to documentation]. Figure 10 .

[0121] 3.5 Octoploid strawberry FvebZIP53-5 Homologous gene identification and analysis 3.5.1 FvebZIP53-5 Identification of homologous genes To improve the sweetness of strawberries, previous reports have indicated that diploid strawberries... FvebZIPs1.1 The gene can significantly increase the sugar content of fruit. To screen for homologous genes in octoploid strawberries, Blastp sequence alignment was performed, and 25 genes were obtained from the octoploid strawberry genome. bZIP Phylogenetic trees were constructed and analyzed to identify candidate members of the family. The phylogenetic analysis results indicate that diploid strawberries... FvebZIPs1.1 Four homologous copies from octoploid strawberries FvebZIP53-5-1 , FvebZIP53-5-2 , FvebZIP53-5-3 and FvebZIP53-5-4 They are most closely related and clustered in the same evolutionary branch. The four genes mentioned above originate from different subgenomes and belong to the octoploid strawberry family. FvebZIP53-5 Homologous copies. Therefore, octoploid strawberries were selected. FvebZIP53-5 Four homologous copies were used as candidate genes for further research and were used to create new octoploid strawberry materials with significantly improved fruit sweetness.

[0122] 3.5.2 FvebZIP53-5 Bioinformatics analysis of homologous genes 3.5.2.1 FvebZIP53-5 Homologous protein sequence conservation analysis For further analysis FvebZIP53-5 The sequence conservation of homologous proteins was studied in this study, identifying four homologous copies in the octoploid cultivated strawberry 'Hongyan'. Fvb5-1 , Fvb5-2 , Fvb5-3 , Fvb5-4 Multiple sequence alignments were performed. The results showed that ( Figure 11 The amino acid sequence identity of the four homologous copies was over 95%, with only a few amino acid substitutions or deletions at a few sites, indicating a high degree of overall sequence conservation. The core functional region was completely identical across the four copies, with no amino acid variations, suggesting that this region is crucial for maintaining transcription factor function.

[0123] In the remaining non-core functional areas, only Fvb5-4 There are a few amino acid deletions and substitutions, but the sequences of the other three copies are almost identical. This result indicates that... FvebZIP53-5 The four homologous copies of this gene are highly conserved in the octoploid strawberry genome, showing no obvious subfunctionalization or neofunctionalization, suggesting significant functional redundancy. Therefore, when selecting this gene as an editing target in this study, the multi-copy compensation effect needs to be considered. Further analysis of its specific functions in fruit development and sugar metabolism regulation can be conducted through multi-target editing or spatiotemporal expression analysis.

[0124] 3.6 FvebZIP53-5 Homologous gene expression pattern analysis 3.6.1 FvebZIP53-5 Tissue-specific expression of homologous genes To explore FvebZIP53-5 The expression pattern during strawberry fruit development was investigated using qRT-PCR to detect the relative expression levels of the compound at different developmental stages of the "Hongyan" fruit. Analysis showed that... FvebZIP53-5 The expression level of the gene showed a clear "first increase, then decrease" trend as the fruit developed: in the early stage of fruit development (green fruit stage), the expression level of the gene remained at a low level; during the transition from large green fruit to white fruit and the color-changing stage, its expression level increased, showing a peak; and when the fruit entered the late color-changing stage to maturity, the expression level decreased. FvebZIP53-5 The amount of expression gradually decreased. This expression pattern suggests that... FvebZIP53-5 Homologous genes may play a regulatory role in the physiological process of strawberry fruit from the swelling stage to the initiation of ripening, and their spatiotemporal specificity is highly correlated with key turning points in fruit development.

[0125] 3.7 FvebZIP53-5 Homologous gene uORF analysis and knockout vector construction 3.7.1 uORF Analysis and Selection This experiment used the target gene's CDS start codon (ATG) as a reference, selecting approximately 660 bp upstream of it as the uORF analysis region. Bioinformatics methods were used to analyze... FvebZIP53-5 Multiple sequence alignment (MSA) analysis was performed on the uORF regions of four homologous copies, and a highly conserved upstream open reading frame (uORF, named Target uORF) was identified among the four homologous genes. This uORF is located 95–108 bp upstream of the main ORF (pORF, main open reading frame), belonging to the proximal uORF category. All copies have a sequence length of 78 bp and encode 25 amino acids. The sequence identity among the four copies reached 96.2%, indicating that this sequence is significantly conserved and may be involved in translational regulation. Figure 12Therefore, this study selected the conserved uORF as a functional knockout target to evaluate its potential regulatory effect on pORF expression.

[0126] 3.7.2 Vector target site design and vector construction Based on the selected conserved uORF sequence, target design was performed using online CRISPR-GE and CRISPR-P tools. The target length was set to 20 bp, the PAM sequence to be NGG, and the GC content controlled between 40% and 60%. After screening, two highly specific candidate targets were finally identified (…). Figure 13 a) is used for subsequent CRISPR / Cas9-mediated targeted editing of the uORF region. An sgRNA expression cassette was constructed targeting the two sites and cloned into the pYLCRISPR / Cas9 vector using GoldenGate. Figure 13 b). After transformation into E. coli, the correct plasmid was introduced into Agrobacterium GV3101 for strawberry genetic transformation, verified by colony PCR and sequencing.

[0127] 3.8 Positive identification of regenerated plants By optimizing the strawberry genetic transformation system, the constructed CRISPR / Cas9 expression vector was transformed into callus induced from shoot tips of the *Strombocys edulis* 'Red Beauty' strawberry plant, resulting in 82 genetically transformed strawberry seedlings. DNA was extracted and subjected to PCR identification to verify the presence of the CRISPR / Cas9 sequence, with a fragment size of 572 bp. 23 positive plants were found, while negative plants and wild-type plants did not amplify the target fragment. The identification results are as follows: Figure 14 As shown.

[0128] 3.9 High-throughput sequencing identification of edit sites To detect editing in T0 generation positive plants, PCR-positive plants were selected for mutation analysis. This experiment used the HI-TOM high-throughput mutation detection platform of the China National Rice Research Institute for sequencing analysis. Amplification was performed using the platform's universal primers, with a 5 bp random base combination ligated downstream of the universal primers as a sample identification code. The amplified fragment length was 144 bp, and the amplified product was sent to the China National Rice Research Institute for high-throughput sequencing. Among the 23 T0 generation plants tested, 5 showed editing at the target site. Mutation type analysis showed that KO-1, KO-2, and KO-5 were... FvebZIP53-5-1 Site-specific base substitution mutations; KO-3 in FvebZIP53-5-2 A base deletion occurred at the site; KO-4 was also detected. FvebZIP53-5-1 and FvebZIP53-5-3The edited sequences were identified as two-site mutants. Sequence alignment results showed that the mutations mainly occurred in the uORF region. The edits in KO-1, KO-2, and KO-3 were all located in the start codon ATG and adjacent key sequence regions. Base substitutions or deletions may affect translation initiation efficiency or disrupt reading frame structure, thereby interfering with the translational regulatory function of this region. Therefore, this study selected KO-1, KO-2, and KO-3 as representative edited lines for subsequent expression analysis and functional validation.

[0129] 3.10 uORF region editing strains FvebZIP53-5 Gene expression analysis To explore FvebZIP53-5-1 and FvebZIP53-5-2 The effect of uORF region editing on gene expression levels was investigated in this study. Three independently gene-edited plants (KO-1, KO-2, and KO-3) were selected, and the expression level of the target gene was detected by real-time quantitative PCR. Results ( Figure 15 The results showed that the relative expression levels of the target gene in the three edited plants exhibited a consistent trend. Compared with the wild-type plant, the transcriptional levels of the target gene in each edited line did not show statistically significant differences. These results indicate that editing the uORF region did not significantly affect the transcriptional level of the target gene.

[0130] 3.11 The impact of uORF mutations on the translation efficiency of downstream main open reading frames To clarify the impact of different mutation types in the uORF region on the translation level of the downstream main open reading frame (pORF), this experiment used a dual-luciferase reporter system for transient transformation validation. The uORF regions of wild-type (WT) and four mutant types (m1, KO-1, KO-2, KO-3) were constructed upstream of the LUC reporter gene and expressed using the CaMV 35S promoter. REN luciferase was used as an internal control. The relative LUC / REN activities were measured using an Agrobacterium-mediated transient tobacco transformation system to reflect the translation efficiency of the pORF.

[0131] Experimental results ( Figure 16 The results showed that, compared with the wild type, all uORF mutants could improve the translation level of the LUC reporter gene to varying degrees. Among them, the m1 vector, which was expected to produce a large uORF deletion, had the most significant enhancement effect on translation; the single-base mutant vectors KO-1 and KO-2 had similar promoting effects; and the deletion mutant KO-3 had a slightly higher translation activation effect than KO-1 and KO-2. Overall, this indicates that uORF region mutations can effectively relieve the translational repression of downstream pORFs, thereby improving the translation efficiency of the target gene, and the effect of large fragment knockout is more obvious.

[0132] 3.12 Determination of soluble sugar content Results of total sugar content determination ( Figure 17 The results showed that the total sugar content of the KO-1, KO-2, and KO-3 strains was significantly higher than that of the wild type. P <0.05). Overall, the total sugar content of the uORF knockout lines showed a steady upward trend, suggesting that editing of the predicted short open reading frame region upstream of the CDS may be related to changes in sugar accumulation levels. Combined with the aforementioned expression analysis results, uORF region editing did not cause significant changes in the transcriptional level of the target gene, indicating that its regulatory effect may not primarily occur at the transcriptional level.

Claims

1. A method for establishing an octoploid strawberry gene editing system and creating new germplasm with high sugar content, characterized in that, include: (1) Constructing a targeted strawberry FvEBZIP53-5 (1) A CRISPR / Cas9 gene editing vector; (2) Transform the constructed CRISPR / Cas9 gene editing vector into Agrobacterium; (3) Use strawberry stem tips or leaves as explants; (4) Infect strawberry callus with Agrobacterium that has been transformed with the gene editing vector; (5) Screen resistant callus on a selection medium containing selectively labeled antibiotics and antibacterial agents; (6) Obtain regenerated strawberry plants from resistant callus through a special culture medium.

2. The method for establishing an octoploid strawberry gene editing system and creating new germplasm with high sugar content according to claim 1, characterized in that, The targeted strawberry FvEBZIP53-5 The method for constructing a CRISPR / Cas9 gene editing vector includes: (1) constructing an expression cassette containing the Arabidopsis pAtU3d promoter, two target sequences and sgRNA; the nucleotide sequences of the two target sequences are shown in SEQ ID No.1 and SEQ ID No.2, respectively; (2) inserting the expression cassette into the pYLCRISPR / Cas9 vector to obtain the gene.

3. The method for establishing an octoploid strawberry gene editing system and creating new germplasm with high sugar content according to claim 1, characterized in that, In step (3), when strawberry shoot tips are used as explants and induced culture is carried out using an induction medium, the growth hormones used in the induction medium are TDZ and 2,4-D; when strawberry leaves are used as explants and induced culture is carried out using an induction medium, the growth hormones used in the induction medium are TDZ and IBA.

4. The method for establishing an octoploid strawberry gene editing system and creating new germplasm with high sugar content according to claim 3, characterized in that, In step (3), when strawberry shoot tips are used as explants and induction culture is performed using an induction medium, the induction medium is MS + TDZ 0.5 mg / L + 2,4-D 0.25 mg / L; when strawberry leaves are used as explants and induction culture is performed using an induction medium, the induction medium is MS + TDZ 1 mg / L + IBA 0.25 mg / L.

5. The method for establishing an octoploid strawberry gene editing system and creating new germplasm with high sugar content according to claim 1, characterized in that, The OD of the infiltration solution described in step (4) 600 The value is 0.3 to 0.4, and the infection time is 25 minutes.

6. The method for establishing an octoploid strawberry gene editing system and creating new germplasm with high sugar content according to claim 1, characterized in that, The selectively labeled antibiotic in step (5) is hygromycin with a final concentration of 3 mg / L; the antibacterial agent is termethin with a final concentration of 200 mg / L.

7. The method for establishing an octoploid strawberry gene editing system and creating new germplasm with high sugar content according to claim 1, characterized in that, The adventitious bud differentiation medium mentioned in step (6) is MS + 6-BA 0.5 mg / L + IAA 0.25 mg / L; the adventitious bud subculture medium is MS + 6-BA 0.25 mg / L + IAA 0.05 mg / L.

8. The method for establishing an octoploid strawberry gene editing system and creating new germplasm with high sugar content according to claim 1, characterized in that, The adventitious shoot elongation culture described in step (6) is MS + 6-BA 0.2 mg / L + IBA 0.05 mg / L + GA3 0.05 mg / L.

9. The method for establishing an octoploid strawberry gene editing system and creating new germplasm with high sugar content according to claim 1, characterized in that, The rooting medium mentioned in step (6) is 1 / 2 MS + 0.1 mg / L IBA.

10. The method for establishing an octoploid strawberry gene editing system and creating new germplasm with high sugar content according to claim 1, characterized in that, The strawberry mentioned is the octoploid cultivated strawberry "Hongyan".