Microinjection-based gene interference method for prawn larvae and its application

Abstract

The present application relates to the field of aquatic organism technology, and particularly relates to a method for gene interference of prawn larvae based on microinjection and application thereof. The prawn larvae are anesthetized by using anesthetic containing eugenol, and after anesthesia, a glass microinjection needle with an inner diameter of a needle tip opening not greater than 5 μm is used to inject double-stranded RNA (dsRNA) of a target interference object into the abdominal region of the prawn larvae, so as to realize gene interference of the prawn larvae. The present application significantly improves the operation success rate and result reliability of the gene interference experiment of the prawn larvae by optimizing the anesthesia scheme and microinjection parameters, and establishing a dose evaluation system, and can provide an efficient and stable technical means for the research on early development related functional genes of the prawn, and has reference value for the gene interference research on other crustacean larvae.

Description

Technical Field

[0001] This invention relates to the field of aquatic organism technology, specifically to a method for gene interference in juvenile shrimp based on microinjection and its application. Background Technology

[0002] Shrimp farming is one of the important pillars of the global aquaculture industry. Among them, Litopenaeus vannamei (Litopenaeus vannamei) Litopenaeus vannamei Due to its advantages such as rapid growth, strong environmental adaptability, and high yield, the shrimp has become the dominant species in current shrimp farming. The healthy and sustainable development of the shrimp industry largely depends on the continuous breeding of superior varieties and a stable supply of high-quality seedlings. With the development of aquatic animal genetic breeding technology, marker-assisted breeding based on molecular markers and gene function analysis has become an important approach to shrimp variety improvement. In-depth analysis of key functional genes regulating important economic traits such as growth, development, and stress resistance in shrimp, and screening for molecular targets with breeding application value, are crucial foundations for achieving precision genetic improvement and molecular design breeding.

[0003] Currently, double-stranded RNA (dsRNA)-mediated RNA interference (RNAi) technology is used in breeding processes to achieve efficient and specific interference with specific target genes, making it one of the important technical means for studying gene function. Analyzing the biological functions of key genes through RNAi technology can provide reliable target information for research on the mechanisms of important trait formation and molecular breeding. In shrimp, RNAi research currently focuses mainly on juvenile or adult shrimp, typically using a micro-syringe to inject approximately 10 μL of dsRNA solution into the individual to achieve gene interference. This injection method is feasible at relatively large developmental stages, but in the early stages of shrimp development, especially in larvae, due to their small size and fragile tissues, injection and interference techniques for larvae have not yet been established. Furthermore, juvenile shrimp are highly mobile and difficult to immobilize effectively. Traditional injection tools struggle to achieve precise drug delivery, resulting in high rates of individual injury and mortality during the procedure. This leads to insufficient reproducibility and stability of RNA interference at this stage. While existing immobilization methods primarily employ restraint or anesthesia to reduce juvenile shrimp activity and improve immobilization effectiveness, they still fall short of meeting the requirements for operational stability, positioning accuracy, and individual survival rates in juvenile shrimp microinjection. A stable gene interference technology system suitable for the juvenile stage has not yet been established. Currently, the effective dose range of dsRNA interference applicable to the juvenile stage is unclear, and a systematic dose evaluation system is lacking, further limiting the application of this technology in early developmental research.

[0004] Furthermore, the early developmental stages of shrimp are crucial periods for body axis establishment, organ differentiation, and the determination of key traits. Many key genes regulating growth, development, and stress resistance begin to function during the larval stage. Functional analysis conducted only in juvenile or adult shrimp often fails to accurately reveal the true biological functions of genes at the inception of development. Therefore, establishing a stable, efficient, and applicable gene interference technique for the larval stage is of great significance for advancing research on early shrimp development mechanisms and precision breeding. In light of this, and addressing the aforementioned shortcomings of existing technologies, there is an urgent need to develop a microinjection gene interference method suitable for the larval stage of shrimp to improve the operability, stability, and reproducibility of gene interference in early individuals, thereby providing reliable technical support for functional gene research in early development. Summary of the Invention

[0005] This invention aims to overcome the technical bottlenecks in the study of gene function in the early developmental stage of shrimp in the prior art, and to provide a stable and efficient method for gene interference in shrimp larvae based on microinjection and its application.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows: A method for gene interference in juvenile shrimp based on microinjection involves anesthetizing juvenile shrimp with an anesthetic containing eugenol, and then injecting double-stranded RNA (dsRNA) into the abdominal region of the juvenile shrimp using a glass microinjector with a needle tip opening diameter of no more than 5 μm, thereby interfering with the genes of juvenile shrimp.

[0007] In the anesthesia procedure, the final concentration of eugenol in the eugenol-containing anesthetic is 20–40 mg / L, and the anesthesia treatment time is 10–20 minutes.

[0008] The eugenol-containing anesthetic is prepared by dissolving eugenol stock solution with a purity of not less than 99% in anhydrous ethanol at a volume ratio of 1:9 and then adding seawater, so that the final concentration of eugenol in the eugenol-containing anesthetic is 20–40 mg / L. The anesthetic treatment involves immersing the shrimp larvae in the anesthetic for 10–20 minutes (preferably 15 minutes), causing the shrimp larvae to lose their balance and roll over, and become unresponsive to external stimuli.

[0009] The effective length of the microinjection needle tip is 8–9 mm. The microinjection needle is formed by two steps of drawing a glass capillary tube with an outer diameter of 1.0 mm and an inner diameter of 0.58 mm using a laser needle drawing instrument (P-2000, Sutter Instrument, USA). The drawing process starts from the first step (LINE=1). The parameters for the first step are HEAT 480–550, FIL 4, VEL 50–60, DEL 130–150, PUL 30–50, and the parameters for the second step are HEAT 760–820, FIL 4, VEL 40–55, DEL 120–140, PUL 60–75. This ensures that the needle tip has an effective length of 8–9 mm, an inner diameter of 3–5 μm at the tip opening, and sufficient mechanical strength to complete the puncture of the first to second abdominal segments of the larvae. Furthermore, the needle tip does not bend, break, or experience significant liquid backflow during injection.

[0010] The double-stranded RNA of the interference target is injected into the middle region of the first to second abdominal segments of the anesthetized shrimp.

[0011] The injection parameters include: an injection pressure of 120 hPa, a compensation pressure of 30 hPa, an injection time of 1.5 s, and an injection dose of 0.1–2 μg / μl per juvenile shrimp.

[0012] The shrimp in question is Litopenaeus vannamei (Litopenaeus vannamei). Litopenaeus vannamei The larvae are PL1-5 stage larvae.

[0013] The dsRNA is prepared by dissolving dsRNA in 1× phosphate-buffered saline (PBS) to form an injection solution.

[0014] To elaborate further, (1) Take 200 mL of sterile tissue culture dish as anesthesia container, add 100 mL of culture seawater, and control the water temperature at 26–30 ℃.

[0015] (2) Mix 1 mL of eugenol stock solution (Shanghai Aladdin Biochemical Technology Co., Ltd.) with 9 mL of anhydrous ethanol (China National Pharmaceutical Group Co., Ltd.) at a volume ratio of 1:9 and add it to the anesthetic container to make the final concentration of eugenol 30 mg / L, so as to obtain the anesthetic solution.

[0016] (3) Transfer the shrimp to be anesthetized in batches to the anesthetizing solution for 15 minutes. When the shrimp loses its balance and rolls over and does not respond to external stimuli, the anesthesia is considered to be complete.

[0017] (4) Transfer the anesthetized shrimp into the limiting groove of the zebrafish micro-injection mold, and adjust the position of the shrimp to expose its abdominal area.

[0018] (5) Set the microinjection instrument parameters as follows: injection pressure 120 hPa, compensation pressure 30 hPa, injection time 1.5 s, and inject dsRNA into the middle region of the first to second abdominal segments of the shrimp, with an injection volume of 0.1 μL per shrimp.

[0019] (6) The injected shrimp were quickly transferred to normal seawater to recover. The shrimp resumed their independent activity after about 5 minutes.

[0020] (7) The dsRNA injection solution was injected into the larvae of shrimp using the microinjection method described above, thereby achieving interference.

[0021] (8) Samples were collected 48 h after injection, total RNA was extracted and reverse transcribed.

[0022] (9) The expression level of the target gene was detected by real-time quantitative PCR (RT-qPCR), and the gene interference efficiency of different concentrations of dsRNA was calculated based on the relative expression level.

[0023] (10) By comparing the interference efficiency and survival of shrimp larvae in each concentration treatment group, the appropriate injection concentration of dsRNA for the shrimp larvae stage was determined and used for subsequent shrimp larvae gene interference experiments.

[0024] The double-stranded RNA of the interference target is a functional gene that interferes with the sex differentiation of shrimp.

[0025] The gene that interferes with shrimp sex differentiation is Litopenaeus vannamei. IAG Genes and CFSH Double-stranded RNA (dsRNA) of genes; among which, interference CFSH The double-stranded RNA sequence of the gene is shown in SEQ ID NO.1, interfering with... IAG The double-stranded RNA sequence of the gene is shown in SEQ ID NO.2.

[0026] A gene that interferes with the sex differentiation of shrimp, specifically Litopenaeus vannamei. IAG Genes and CFSH Double-stranded RNA (dsRNA) of genes; among which, interference CFSH The double-stranded RNA sequence of the gene is shown in SEQ ID NO.1, interference. IAG The double-stranded RNA sequence of the gene is shown in SEQ ID NO.2.

[0027] An application of the method in shrimp sex differentiation involves injecting Litopenaeus vannamei into juvenile shrimp using the method. IAG Genes and CFSHDouble-stranded RNA (dsRNA) of the gene enables the differentiation of sex in shrimp.

[0028] The interference CFSH The double-stranded RNA (dsRNA) of the gene has the base sequence shown in SEQ ID NO.1: 5'- TAATACGACTCACTATAGGG ++ CCCTATAGTGAGTCGTATTA -3'; The interference IAG The double-stranded RNA (dsRNA) of the gene has the base sequence shown in SEQ ID NO.2: 5'- TAATACGACTCACTATAGGG+TTACTCGGATTGCTGATGCTTCTCTCGCTGACTTCGACGTCGAGCGGCTACAACGTCACGGGGATTCCTGTGGACTTCGACTGCGGTGACATCGGCGACACCATGAGCCAGATCTGCAAGACGTTCCCCACGGCCAGGCCCCACGTGAGAGTGTCAAGGTCAGCCGATACCGACGACCTCTGGCAGGACACGGGGGCAGGTCAGACAACGCCCCCTGACCTGCT CCCCCGCCGGCACCGCCTCCACCCAGGGCCCTGAATCCAACGTGGAATCTCGAAAGGGACCTGATCAGAGACATCCTAGTGAGCCCCGAAGCCGCGCACGCCCTCGTCAGGACGCCCCGGGGCCGCGCGAAGAGGTCCTACAACGTGCAGGACGAGTGCTGCAACCACGTGAGCCAGCGGCTGTGCGTGGCGGAGGAGATCCTGGAGTATTGCGAGGACCCGTA+ CCCTATAGTGAGTCGTATTA -3'.

[0029] Advantages of this invention: 1. A stable gene interference technology system suitable for the larval stage of shrimp has been established. This invention addresses the problem that while existing technologies can reduce the motility of larvae through fixation or anesthesia, achieving stable and efficient microinjection remains challenging. The anesthesia conditions, microinjection needle structure, injection site, injection parameters, and dsRNA administration conditions were synergistically optimized to ensure compatibility among all technical aspects. This improved the operational stability and positioning accuracy of microinjection while effectively reducing larval motility, resulting in a higher injection success rate, larval survival rate, and gene interference efficiency. Therefore, a stable gene interference technology system suitable for the larval stage of shrimp has been established.

[0030] 2. High gene interference efficiency and stable experimental results. This invention systematically optimizes key parameters for microinjection in shrimp larvae, including microinjection needle specifications, injection sites, injection pressure, and dsRNA injection dosage. This enables the accurate and stable delivery of target dsRNA into the larvae, achieving highly efficient interference of target gene expression, improving gene interference efficiency and the stability of experimental results, and providing reliable technical support for gene function research in the early developmental stage of shrimp larvae.

[0031] 3. Balancing Survival Rate and Gene Interference Effectiveness in Larvae. This invention optimizes the matching relationship between anesthesia conditions and microinjection parameters, effectively reducing mechanical damage and operational stress to larvae during injection while ensuring gene interference effectiveness. Larvae recover to normal activity quickly after injection, maintaining a high post-operative survival rate. This provides ample experimental material for medium- to long-term developmental phenotypic observation after gene interference and expands the observation window for larval developmental stages.

[0032] 4. The method has a high degree of standardization and good application value. This invention establishes a standardized operating procedure covering anesthesia, microinjection, and recovery culture. Each technical step has been systematically optimized and verified, demonstrating good stability and reproducibility. This method is not only applicable to gene function studies in the larval stage of Litopenaeus vannamei, but can also provide a technical reference for gene interference studies in the early larvae of other crustaceans. It provides a new technical means for studying the early developmental mechanisms of crustaceans and for molecular-assisted breeding, and has good application value. Attached Figure Description

[0033] Figure 1 Different eugenol concentrations provided in this embodiment of the invention have effects on PL5 stage larvae (body length 5.4 ± 0.3 mm, weight 3.5 ± 0.2 mg). n =100) The effect of anesthetic effect (A) and recovery effect (B).

[0034] Figure 2 The comparison results of different microinjection sites provided in the embodiments of the present invention are shown, where A is the injection site of the first abdominal segment and B is the injection site of the third abdominal segment.

[0035] Figure 3 This is a graph showing the interference efficiency of IAG and the survival rate of shrimp larvae under different doses of dsRNA injection provided in this embodiment of the invention; where black represents interference efficiency and gray represents survival rate; the same letter within the same group indicates no significant difference. p >0.05).

[0036] Figure 4 Different doses of dsRNA injection provided in embodiments of the present invention CFSH The graph shows the interference efficiency and survival rate of juvenile shrimp; where black represents interference efficiency and gray represents survival rate; the same letter within the same group indicates no significant difference. p >0.05). Detailed Implementation

[0037] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be described in detail below with reference to specific embodiments. The described embodiments are merely some embodiments of this invention, and not all embodiments. All other implementation methods obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0038] This invention achieves effective interference of target genes in the larval stage of shrimp by systematically optimizing anesthesia strategies and microinjection parameters, providing a stable and practical technical solution for the study of gene functions related to early development of shrimp, and filling a technological gap in this field to some extent.

[0039] The eugenol storage solution is prepared by taking 300 μl of eugenol (Shanghai Aladdin Biochemical Technology Co., Ltd.) with a purity of 99%, dissolving it in 9.6 ml of 100% alcohol (Sinopharm), and then adding it to an anesthesia container to prepare an anesthetic storage solution with a concentration of 30 mg / mL.

[0040] Example 1: Determination of the optimal anesthetic dose for microinjection into juvenile shrimp Four 500 mL beakers were used as anesthesia containers. After cleaning and disinfecting, 100 mL of normal seawater (salinity 30 PSU, water temperature 28 ℃) was added to each beaker, and 60 PL5 stage larvae were placed in each beaker.

[0041] Subsequently, 100 μL, 200 μL, 400 μL, and 800 μL of eugenol stock solution were added to each beaker, respectively, to achieve final eugenol concentrations of 30, 60, 120, and 240 mg / L. Timing was initiated 15 minutes after the addition of eugenol, followed by microinjection (see [link to relevant documentation]). Figure 1 ).

[0042] During the sedation period, the juvenile shrimp partially lose their righting reflex and balance ability, but still respond to external stimuli. During the anesthesia period, the individual rolls to its side and remains basically still, with the appendages and antennae ceasing to move and no response to external stimuli, but the jaw flap continues to sway, indicating that the water flow in the gills remains unobstructed and the respiratory function is not suppressed. During the recovery period, the juvenile shrimp resumes normal swimming. During the death period, the heartbeat and breathing stop.

[0043] Figure 1 The results showed that different concentrations of eugenol had a significant impact on the anesthetizing effect on juvenile shrimp. As the eugenol concentration increased from 30 to 240 mg / L, the time required for juvenile shrimp to reach both the sedation and anesthesia stages was significantly shortened. p<0.05, with the 120 and 240 mg / L treatment groups showing the fastest sedation and anesthesia. Meanwhile, recovery time gradually increased with increasing eugenol concentration, with the 120 mg / L treatment group showing a significantly longer recovery time than the 30 and 60 mg / L treatment groups ( p <0.05). Furthermore, the survival rate of juvenile shrimp decreased with increasing eugenol concentration. The survival rates of the 30 and 60 mg / L treatment groups remained above 90%, while the 120 mg / L treatment group showed a significant decrease, and all juvenile shrimp in the 240 mg / L treatment group died. Based on the combined analysis of sedation time, anesthesia time, recovery time, and survival rate, 30 mg / L eugenol demonstrated a suitable anesthetic effect under the experimental conditions.

[0044] Example 2: Optimization of microinjection sites in juvenile shrimp Nine 500 mL beakers were used as anesthesia containers. After cleaning and sterilization, 100 mL of normal seawater (salinity 30 PSU, water temperature 28 ℃) was added to each beaker, and 100 PL5 stage larvae were placed in each beaker. Then, 100 μL of eugenol stock solution was added to make the final anesthetic concentration 30 mg / L. Timing started from the addition of eugenol, and microinjection was performed 15 minutes after anesthesia.

[0045] To explore the effect of different injection sites on the survival rate of shrimp larvae, shrimp larvae were randomly divided into three groups, and microinjected into the 1st-2nd abdominal segments, the 3rd-5th abdominal segments, and the cephalothorax, respectively. Immediately after injection, the larvae were transferred to normal seawater for 5 minutes to recover. The number of surviving shrimp in each group was counted, and the survival rate was calculated.

[0046] Table 1. Survival rate of juvenile shrimp after RNA interference injection

[0047] Depend on Figure 2 As shown in Table 1, microinjection observation using phenol red as a tracer indicator revealed that, compared to the injection site in the third abdominal segment (B), it was easier to observe phenol red entering the shrimp tissue when the injection site was located in the first abdominal segment region, indicating that this region was more conducive to the effective delivery of the injection fluid. At the same time, the muscle tissue in this region was relatively loose, which was conducive to the implementation of microinjection operations.

[0048] Example 3: Optimization of Microinjection Parameters for Larval Shrimp To determine the appropriate microinjection needle specifications for microinjection of PL5 stage larvae, glass capillaries with an outer diameter of 1.0 mm and an inner diameter of 0.58 mm were used. Under the same needle-pulling device conditions, the needle-pulling program was adjusted to prepare microinjection needles with different tip opening inner diameters and effective tip lengths, which were then used for microinjection of larvae. Injection pressure, injection time, and injection location were kept consistent across all groups. Injection success rate and 24-hour survival rate after injection were statistically analyzed.

[0049] 1.1PL5 stage larval shrimp anesthesia A 500 mL beaker was used as the anesthesia container. After cleaning and sterilizing, 100 mL of normal seawater (salinity 30 PSU, temperature 28 ℃) was added. Sixty PL5 stage larvae were placed in each batch, followed by the addition of 100 μL of eugenol stock solution at a concentration of 30 mg / mL, bringing the final concentration to 30 mg / L. Timing was initiated 15 minutes after the addition of eugenol, and then the microinjection was performed.

[0050] 1.2 Microinjection and recovery of juvenile shrimp Anesthetized shrimp larvae were fixed in microinjection molds, and abdominal injections were performed using microinjection needles of different sizes. After injection, the larvae were transferred to normal seawater for 24 hours of recovery culture. The injection success rate and survival rate of each group were recorded, and the effects of different sizes of microinjection needles on the injection effect were compared.

[0051] Table 2 Comparison of the effects of microinjection of different specifications on PL5 stage larvae.

[0052] As shown in Table 2, different sizes of microinjection needles significantly affect the microinjection effect on juvenile shrimp. When the inner diameter of the needle tip opening is less than 3 μm, the needle tip is too thin, resulting in insufficient mechanical strength and difficulty in penetrating the first and second abdominal segments of the juvenile shrimp, leading to a low injection success rate. As the needle tip opening increases to 3–5 μm, the needle tip can successfully complete tissue puncture while effectively reducing tissue damage, maintaining a high survival rate for juvenile shrimp. When the needle tip opening further increases to over 6 μm, although puncture is easier, tissue damage increases significantly, and the mortality rate of juvenile shrimp after injection increases significantly.

[0053] Meanwhile, the effective needle tip length also significantly affects injection stability. When the effective needle tip length exceeds 9 mm, the needle tip is prone to bending, affecting puncture positioning; when it is less than 8 mm, the needle tip cone angle is larger, increasing puncture resistance and easily causing tissue tearing. After comprehensively comparing the injection success rate, postoperative survival rate, and operational stability of different specifications of microinjection needles, a microinjection needle with an effective needle tip length of 8–9 mm and a needle tip opening inner diameter of 3–5 μm was ultimately determined as the optimal parameters for this invention.

[0054] Example 4: Interference IAG Taking genes as an example, determine IAG Gene interference dose and interference efficiency This experiment will be conducted in September 2025 at the Coastal Laboratory of the Institute of Oceanology, Chinese Academy of Sciences. It targets the Litopenaeus vannamei. IAGA specific double-stranded RNA (dsRNA), with the base sequence shown in SEQ ID NO.2, was designed and synthesized to assess persistent interference during the larval stage of shrimp. IAG The effects of gene expression on male sex differentiation were investigated, and its role in sex regulation was explored. This was achieved by setting different concentration gradients... IAG dsRNA injection treatment was used to compare the gene interference effects of different treatment groups in order to determine the appropriate dsRNA injection concentration for the larval stage.

[0055] 1.1PL5 stage larval shrimp anesthesia A 500 mL beaker was used as the anesthesia container. After cleaning and sterilizing, 100 mL of normal seawater (salinity 30 PSU, temperature 28 ℃) was added. Sixty PL5 stage larvae were placed in each batch, followed by the addition of 100 μL of eugenol stock solution at a concentration of 30 mg / mL, bringing the final concentration to 30 mg / L. Timing was initiated 15 minutes after the addition of eugenol, and then the microinjection was performed.

[0056] 1.2 Microinjection and recovery of juvenile shrimp Anesthetized juvenile shrimp were transferred into the positioning groove of a microinjection mold using a pipette tip, and their position was adjusted to expose the abdominal region. The experiment consisted of 5 groups: EGFP The -dsRNA injection group served as the control group, and IAG Four concentration gradients of dsRNA were used in the injection group: 0.1 μg / μl, 0.5 μg / μl, 1.0 μg / μl, and 2.0 μg / μl. The injection pressure was set at 120 hPa, the compensation pressure at 30 hPa, and the injection time at 1.5 s. Fifty shrimp larvae were injected into each group, with a dsRNA loading volume of 5 μL in the injection needle. The dsRNA was injected into the middle region of the first to second abdominal segments of the larvae. After injection, the larvae were transferred to a culture tank containing 30 L of normal seawater to recover. The larvae resumed normal swimming after 5 minutes. They were then cultured under aeration and temperature control for another 48 hours before sampling.

[0057] 1.3 RNA extraction, cDNA synthesis, and RT-qPCR detection Forty juvenile shrimp were randomly selected from each group, and genomic DNA and total RNA were extracted from each shrimp using a DNA / RNA co-extraction method. Genomic DNA was used for genotype sex identification, and total RNA was used for subsequent cDNA synthesis. Samples of juvenile shrimp with the male genotype were selected. n= 12), cDNA was synthesized using a reverse transcription kit. The total volume of the RT-qPCR reaction system was 10 μL, including: 2 μL cDNA template, 5 μL SYBR qPCR Mix, 0.5 μL forward and reverse primers (10 μM), and 2 μL RNase-free water. 18S rRNA was used as the internal reference gene, and 2^ -ΔΔCt The method calculates the relative expression level of the target gene.

[0058] 1.4 Comparison of interference effects of different dsRNA concentrations The survival rate and disturbance efficiency of the juvenile shrimp in the different treatment groups were compared, and the results are as follows: Figure 3 As shown, with increasing dsRNA dosage, IAG The interference efficiency showed a trend of first increasing and then decreasing. In the 0.5 μg / 10 μL and 1 μg / 10 μL treatment groups, IAG The relative expression level of [a specific substance] decreased significantly, resulting in the most significant interference effect; while the interference effects of the 0.1 μg / 10 μL and 2 μg / 10 μL treatment groups were weaker. The overall survival rate of all treatment groups was high, with no significant difference compared to the control group. p >0.05).

[0059] Example 5: Determining CFSH Gene interference dose and interference efficiency This experiment was also conducted in September 2025 at the Coastal Laboratory of the Institute of Oceanology, Chinese Academy of Sciences. The study used Litopenaeus vannamei as a starting point. CFSH The gene was used as a target to synthesize the corresponding dsRNA, i.e., the base sequence shown in SEQ ID NO.1; continuous interference was performed during the larval stage to evaluate its effect on female sex differentiation and secondary sexual characteristic development. Multiple doses were used to investigate this effect. CFSH -dsRNA injection gradient, systematically compared interference efficiency, and screened suitable interference concentrations for larval shrimp.

[0060] 1.1PL5 stage larval shrimp anesthesia The anesthesia procedure was basically the same as in Example 1. 100 mL of normal seawater (30 PSU, 28 ℃) was added to a sterilized 500 mL beaker. 60 PL5 juvenile shrimp were added to each batch, followed by 100 μL of 30 mg / mL eugenol stock solution to achieve a final concentration of 30 mg / L. Microinjection was performed 15 min after treatment.

[0061] 1.2 Microinjection and recovery of juvenile shrimp The anesthetized individual was placed within the injection mold's positioning groove and their position adjusted. The experiment included an EGFP-dsRNA control group and... CFSHFour concentration groups of dsRNA were used (0.1, 0.5, 1.0, and 2.0 μg / μL). Injection parameters were the same as in Example 1 (120 hPa, 30 hPa, 1.5 s). Fifty tails were treated in each group, with a single injection volume of 0.1 μL, injected into the middle of the first to second abdominal segments. After treatment, the tails were transferred to 30 L of seawater to recover. They resumed normal activity in approximately 5 minutes and were then cultured at a constant temperature and aeration for 48 h before sampling.

[0062] 1.3 RNA extraction, cDNA synthesis, and RT-qPCR detection Forty tails were randomly selected from each group, and genomic DNA and total RNA were separated using a DNA / RNA co-extraction method. Genomic DNA was used for sex identification, and cDNA was obtained by reverse transcription of total RNA. Female individuals were screened. n = 12) Used for expression analysis. The RT-qPCR system and procedure are the same as in Example 1, using 18S rRNA as an internal reference, and employing 2^ -ΔΔCt The relative expression level is calculated using this method.

[0063] 1.4 Comparison of interference effects of different dsRNA concentrations like Figure 4 As shown, compared with the EGFP control, each dsRNA treatment group CFSH Expression levels decreased to varying degrees in all treatment groups. The 1 μg / 10 μL and 2 μg / 10 μL treatment groups showed significant downregulation, indicating good interference effects; the 0.1 μg / 10 μL treatment group showed no significant change. Survival rates remained at high levels in all treatment groups, with no significant differences between groups. p >0.05).

[0064] Finally, it should be noted that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for gene interference in larvae of shrimp based on microinjection, characterized in that: Shrimp larvae were anesthetized using an anesthetic containing eugenol. After anesthesia, double-stranded RNA was injected into the abdominal region of the larvae using a glass microinjection device with a needle tip opening diameter of no more than 5 μm, thereby interfering with the genes of the shrimp larvae.

2. The method for microinjection-based gene interference in larvae of shrimp according to claim 1, characterized in that: In the anesthetic treatment, the final concentration of eugenol in the eugenol-containing anesthetic is 20–40 mg / L, and the anesthetic treatment time is 10–20 minutes.

3. The method for microinjection-based gene interference in larvae of shrimp according to claim 1, characterized in that: The effective length of the microinjection needle tip is 8–9 mm. The microinjection needle is formed by two steps of laser needle pulling, using a glass capillary tube with an outer diameter of 1.0 mm and an inner diameter of 0.58 mm. The pulling procedure is executed from the first step, where the parameters for the first step are HEAT 480–550, FIL 4, VEL 50–60, DEL 130–150, and PUL 30–50, and the parameters for the second step are HEAT 760–820, FIL 4, VEL 40–55, DEL 120–140, and PUL 60–75. This ensures that the needle tip has an effective length of 8–9 mm, an inner diameter of 3–5 μm at the tip opening, and sufficient mechanical strength to puncture the first to second abdominal segments of the larvae. Furthermore, the needle tip does not bend, break, or experience significant liquid backflow during injection.

4. The method for microinjection-based gene interference in larvae of shrimp according to claim 1 or 3, characterized in that: The double-stranded RNA of the interference target was injected into the middle region of the first to second abdominal segments of the anesthetized shrimp.

5. The method for microinjection-based gene interference in larvae of shrimp according to claim 4, characterized in that: The injection parameters included: an injection pressure of 120 hPa, a compensation pressure of 30 hPa, an injection time of 1.5 s, and an injection dose of 0.1–2 μg / μl per juvenile shrimp.

6. The method for microinjection-based gene interference in larvae of shrimp according to claim 1, characterized in that: The shrimp in question is Litopenaeus vannamei (Litopenaeus vannamei). Litopenaeus vannamei The larvae are PL1-5 stage larvae.

7. The method for microinjection-based gene interference in larvae of shrimp according to claim 1, characterized in that: The double-stranded RNA of the interference target is a functional gene that interferes with the sex differentiation of shrimp.

8. The method for microinjection-based gene interference in larvae of shrimp according to claim 2, characterized in that: The gene that interferes with shrimp sex differentiation is Litopenaeus vannamei. IAG Genes and CFSH Double-stranded RNA of genes; among which, interference CFSH The double-stranded RNA sequence of the gene is shown in SEQ ID NO.1, interfering with... IAG The double-stranded RNA sequence of the gene is shown in SEQ ID NO.

2.

9. A gene that interferes with the sex differentiation of shrimp, characterized in that: The gene that interferes with shrimp sex differentiation is Litopenaeus vannamei. IAG Genes and CFSH Double-stranded RNA of genes; among which, interference CFSH The double-stranded RNA sequence of the gene is shown in SEQ ID NO.1, interfering with... IAG The double-stranded RNA sequence of the gene is shown in SEQ ID NO.

2.

10. An application of the method of claim 1 in shrimp sex differentiation, characterized in that: Using the method described above, Litopenaeus vannamei was injected into juvenile shrimp. IAG Genes and CFSH The double-stranded RNA of the gene enables the differentiation of sex in shrimp.

Images