A cas12a-based nucleic acid rapid detection method and kit
Patent Information
- Application Number
- CN202611293357.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-08-25
- Publication Date
- 2026-09-29
AI Technical Summary
本发明提供的核酸快速检测方法具有序列设计无需PAM、操作便捷、特异性高、灵敏度强的优点,解决了呼吸道相关病原体早期筛查灵敏度低、费时费力、技术要求高等难题
(1)本发明提供的检测方法操作流程简便快捷,检测时只需将样本加入预混好的反应液,放入恒温封闭的荧光检测设备,减少了设备成本;且整个反应体系在一个封闭的环境中,不存在气溶胶污染的问题;
Smart Images

Figure CN122833145A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biological detection technology, specifically relating to a rapid nucleic acid detection method and kit based on Cas12a. Background Technology
[0002] As the global respiratory disease epidemic becomes increasingly complex, it is showing characteristics such as multi-pathogen co-circulation and seasonal pattern adjustments. Detection methods for respiratory pathogens mainly include viral isolation and culture and immunological detection. Viral isolation and culture is the primary method for early detection of viruses and bacteria, offering high specificity, but it is time-consuming, complex, and many pathogens are difficult to culture, failing to meet the needs of rapid clinical diagnosis. Immunological detection primarily targets pathogen-specific antigens or host-produced antibodies, offering advantages such as ease of operation, low cost, and no need for specialized equipment. However, its sensitivity is relatively low, easily leading to missed diagnoses in the early stages of infection or when pathogen load is low; furthermore, due to the window period for antibody detection, it is difficult to effectively distinguish between past and current infections.
[0003] Nucleic acid testing (NAT) is a technique that directly detects the genetic material (DNA or RNA) of pathogens at the gene level. It can accurately identify specific gene sequences of different pathogens and has extremely high sensitivity and specificity. Polymerase chain reaction (PCR) is currently the most widely used molecular diagnostic technique. It has excellent detection sensitivity and specificity and can achieve precise quantification. However, PCR technology is heavily dependent on sophisticated thermal cyclers and professional-grade laboratory environments. The detection process typically takes 1-4 hours, and the operation steps are complex, requiring specialized technicians.
[0004] To adapt to more scenarios, isothermal amplification technology has gradually gained attention. It can amplify nucleic acids at a constant temperature, requiring no complex instruments and having low equipment requirements, making it more suitable for on-site detection. However, it also has drawbacks such as complex primer design, the possibility of false positives due to non-specific amplification, and sensitivity generally still lower than qPCR. In recent years, the CRISPR / Cas system, especially the Cas12a protein, has been widely used in in vitro diagnostics and detection due to its unique targeted recognition and non-specific trans-cleavage activity. The Cas12a system consists of the Cas12a protein, crRNA, and a fluorescent reporter probe. After recognizing the target DNA, it activates cis and trans-cleavage activities, cleaving the reporter probe and releasing fluorescence. However, most existing CRISPR / Cas12a detection methods rely on the PAM sequence in the target sequence for recognition, limiting their versatility. Furthermore, while there is room for improvement in sensitivity, it often requires pre-amplification steps such as isothermal amplification, increasing operational complexity and the risk of contamination.
[0005] Therefore, developing a simple, PAM-sequence-independent, highly sensitive, and versatile nucleic acid detection method is of great significance for meeting the needs of rapid on-site diagnosis. Summary of the Invention
[0006] To address the aforementioned challenges, this invention provides a rapid nucleic acid detection method and kit based on Cas12a. The rapid nucleic acid detection method provided by this invention has the advantages of not requiring PAM sequence design, convenient operation, high specificity, and high sensitivity, solving the problems of low sensitivity, time-consuming and labor-intensive, and technically demanding early screening of respiratory-related pathogens.
[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows: A rapid nucleic acid detection method based on Cas12a, wherein the method activates Cas12a to cleave HP1 to release a phosphate-thioester modified Key, and the phosphate-thioester modified Key binds to HP2 with its own PAM sequence, activating universal crRNA2 / Cas12a for secondary cleavage to generate a fluorescent signal, thereby achieving nucleic acid detection without PAM sequence and with autocatalytic signal amplification, comprising the following steps: S1. Extract nucleic acid from the sample to be tested to obtain the test extract; S2. Anneal HP1 and HP2 separately for later use; HP1 is a closed hairpin probe, which includes thiomodified DNA, and the thiomodified DNA sequence is 5'-G*A*G*A*C*C*C*A*A*A-3'; HP2 is a half-hairpin probe with its own PAM sequence, which is complementary to the thiomodified DNA sequence. S3. The HP1 and HP2 after re-annealing in step S2 are mixed with crRNA1, crRNA2, lbCas12a, fluorescent probe and 10×reaction buffer to obtain a reaction solution; the crRNA1 is an RNA sequence designed for the test extract in step S1; the crRNA2 is a universal RNA sequence, including a handle sequence and a spacer sequence, wherein the handle sequence binds to the lbCas12a protein and the spacer sequence is complementary to HP2; S4. Take the extract to be tested obtained in step S1, mix it with the reaction solution prepared in step S3, and place it on a PCR analysis system for reaction.
[0008] Preferably, the specific process of annealing HP1 and HP2 in step S2 is as follows: dilute HP1 or HP2 with deionized water to 8~15μM, then place them on a PCR analysis system and anneal at 90~97℃ for 5~10min, and then cool to room temperature.
[0009] Preferably, the 10×reaction buffer in step S3 comprises 450~550mM NaCl, 80~120mM Tris-HCl, 80~120mM MgCl2 and 800~1200μg / mL Recombinant Albumin.
[0010] Preferably, the nucleotide sequence of the fluorescent probe in step S3 is 5'-ROX-CCCCCC-BHQ1-3'.
[0011] Preferably, the reaction conditions in step S4 are 28~33℃ for 50~80 min.
[0012] This invention also provides a rapid nucleic acid detection kit, which activates Cas12a to cleave HP1 to release a phosphate-thioester modified Key. The phosphate-thioester modified Key binds to HP2 with its own PAM sequence, activating universal crRNA2 / Cas12a for secondary cleavage to generate a fluorescent signal, thereby achieving nucleic acid detection without PAM sequence and with autocatalytic signal amplification. The kit includes HP1, HP2, crRNA1, crRNA2, 1bCas12a, fluorescent probe, 10×reaction buffer, and deionized water. HP1 is a closed hairpin probe, which includes thiomodified DNA with a sequence of 5'-G*A*G*A*C*C*C*A*A*A-3'; HP2 is a half-hairpin probe with a built-in PAM sequence that is complementary to the thiomodified DNA sequence. The crRNA1 is an RNA sequence designed for the target; the crRNA2 is a universal RNA sequence, including a handle sequence and a spacer sequence, wherein the handle sequence binds to the lbCas12a protein, and the spacer sequence is complementary to HP2.
[0013] Preferably, the nucleotide sequence of the fluorescent probe is 5'-ROX-CCCCCC-BHQ1-3'; the 10×reaction buffer comprises 450-550 mM NaCl, 80-120 mM Tris-HCl, 80-120 mM MgCl2 and 800-1200 μg / mL Recombinant Albumin.
[0014] Traditional pathogen detection mainly relies on virus isolation and culture and immunological detection. The former is time-consuming and requires highly skilled laboratories and personnel, while the latter is simple and rapid but prone to missed diagnoses. Polymerase chain reaction (PCR) is the gold standard for nucleic acid detection, offering high sensitivity and specificity, but it is time-consuming. Therefore, developing a convenient, rapid, and accurate detection method is of paramount importance.
[0015] Based on this, the present invention provides a rapid nucleic acid detection method based on Cas12a, the specific process of which is as follows: First, a corresponding crRNA1 is designed for the target pathogen nucleic acid. The crRNA1 and Cas12a complex is used to search for and initially cleave cancer cell-related targets. For the initial cleavage, a closed hairpin probe (HP1) is designed. The hairpin stem on this probe is double-stranded to block a thiolated DNA segment (Key), preventing Key from being captured by the crRNA1 and Cas12a complex. During the initial cleavage, Cas12a can cleave the unthiolated portion of the closed probe and release Key, which can then combine with a defective hairpin (HP2) designed for Key to form a complete double-stranded target that can be recognized by the crRNA2 and Cas12a complex. HP2 cannot be recognized by the crRNA2 and Cas12a complex alone. It can only be activated by Cas12a for secondary cleavage when it is present with Key. This cleavage can cleave the HP1 that was not cleaved during the primary cleavage, releasing Key to further promote secondary cleavage. Both cleavages can cleave the fluorescent probe to produce fluorescence. Through autocatalytic secondary cleavage, the low fluorescence signal caused by the primary cleavage due to low target concentration can be compensated, which greatly improves the fluorescence intensity and enhances the sensitivity of detection.
[0016] Therefore, the technical principles of the present invention (such as...) Figure 1 The main steps (as shown) are as follows: First, a corresponding crRNA1 is designed for the target nucleic acid to be detected. This design does not require consideration of the PAM sequence. After crRNA1 and Cas12a form a complex that recognizes the target DNA, the first cleavage is activated, breaking down HP1 and releasing a large number of keys. The key is designed as a DNA sequence enclosed in the hairpin structure of HP1 and modified by thiophosphorylation, making the key unreadable and preventing it from being cleaved by the activated Cas12a. Another universal crRNA2 / Cas12a complex in the system cannot be activated when HP2 is alone. After the first cleavage releases a large number of keys, it coexists with HP2 and is thus read by the crRNA2 / Cas12a complex. Subsequently, the Cas12a protein is activated and undergoes a second cleavage, producing a large amount of readable fluorescence. HP2 has a semi-hairpin structure, and the key is the phosphorylation DNA shown in the figure, which can pair complementaryly with the single strands in the HP2 structure, thus making the incomplete target complete and thus activating Cas12a.
[0017] In actual detection, the first cleavage will not occur if crRNA1 does not recognize the correct target. The Key is blocked, thus preventing subsequent reactions. The reaction can only proceed after crRNA1 recognizes the correct target. In the entire nucleic acid detection system, only crRNA1 needs to be designed. crRNA2 is a universal sequence that only recognizes the Key and HP2. HP2 has its own PAM sequence, and only a small amount of target activation for the first cleavage can autocatalyze the generation of a large amount of fluorescence. Therefore, the PAM sequence does not need to be considered for the recognized target, greatly increasing the versatility and sensitivity of the detection system.
[0018] Compared with the prior art, the present invention has the following advantages: (1) The detection method provided by the present invention has a simple and quick operation process. During detection, the sample only needs to be added to the premixed reaction solution and placed in a constant temperature and sealed fluorescence detection device, which reduces the equipment cost. Moreover, the entire reaction system is in a closed environment, and there is no problem of aerosol pollution. (2) In the detection process of this invention, after the crRNA recognizes the viral target, it activates the initial cleavage of the CRISPR / Cas12a protein, generating a fluorescent signal and releasing a key. The released key activates the secondary cleavage of the CRISPR / Cas12a protein, further generating a large amount of fluorescent signal. The signal is amplified by the autocatalytic effect of the CRISPR / Cas12a system, which greatly enhances the detection sensitivity. (3) This invention only requires the design of corresponding crRNA1 for different targets, which can detect ssDNA and dsDNA. Furthermore, because this invention designs a universal crRNA2, the design of crRNA1 is greatly reduced to be dependent on the target PAM sequence. For RNA targets, only a transfer probe or reverse transcription to convert to DNA targets is required. For protein targets, nucleic acid aptamers can be introduced into the system to convert to DNA targets. It has strong versatility and covers a wide range of targets. Attached Figure Description
[0019] Figure 1 This is a schematic diagram of the technical principle of the present invention; Figure 2 Image showing the results of HP2 and Key sequence filtering; Figure 3 Image showing the results of HP1 sequence screening; Figure 4 The image shows the results of a specific analysis of Bordetella pertussis nucleic acid. Figure 5 The figure shows the results of the detection limit test for Bordetella pertussis nucleic acid detection. Detailed Implementation
[0020] The present invention is further illustrated below with reference to specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions in the art or as recommended by the manufacturer; the raw materials and reagents used, unless otherwise specified, are all commercially available from the conventional market. Any non-substantial changes and substitutions made by those skilled in the art based on the present invention are within the scope of protection claimed by the present invention.
[0021] In this experiment, the 10×reaction buffer consisted of: 500 mM NaCl, 100 mM Tris-HCl, 100 mM MgCl2, and 1000 μg / mL recombinant albumin.
[0022] Example 1: Sequence screening of HP1 and HP2 hairpins in a Cas12a-based nucleic acid detection method First, HP2 and Key sequences were designed based on universal crRNA2 to activate Cas12a protein.
[0023] The purpose of designing crRNA2 is to serve as a universal crRNA sequence, applicable to the detection system described in this method. For different targets, only the corresponding crRNA1 needs to be replaced, thus crRNA2 can be used in detection systems for different targets. Therefore, the randomly designed crRNA2 sequence is as follows: 5'-UAAUUUCUACUAAGUGUAGAU GGUCUCUUUGGUCAAUCCCG -3' (SEQ ID NO.4).
[0024] Based on the spacer sequence (marked by dashed underline) in the designed crRNA2, the HP2 and Key sequences were designed using NUPACK: HP2 has a semi-hairpin structure. The 3' end sequence after annealing and folding serves as the TS (Target DNA Strand), which can complementaryly pair with the crRNA2 spacer region. The 5' end sequence serves as the NTS (Non-target DNA Strand), which complementarily pairs with the TS, forming a partial double-stranded DNA target. When present alone, it cannot activate the CRISPR / Cas12a protein. In addition to the complete NTS sequence, the 5' end also incorporates a PAM sequence, enabling HP2 to stably bind to the Cas12a protein, enhancing the recognition efficiency of the Cas12a protein, and thus reducing the dependence of the crRNA1 sequence design on the target PAM sequence. Key is a short-chain DNA, which also cannot activate the CRISPR / Cas12a protein when present alone. When HP2 is present in the system, Key can complementarily pair with HP2 to form a complete double-stranded DNA target, thereby activating the CRISPR / Cas12a protein. The HP2 and Key sequences are shown below, with a one-to-one correspondence between the sequence designs: HP2-1:5'-TGCA TTTGGGTCTCTTTGGTCAATCCCG CACC CGGGATTGACCAAA -3' (SEQ ID NO. 13); HP2-2:5'- GGTCTCTTTGGTCAATCCCG CACC CGGGATTGACCAAAGAGACCCAAATTTCAGG -3' (SEQ ID NO.14); HP2-3:5'-TGCA TTTGGGTCTCTTTGGTCAATCCCG CACC CGGGATTGACCAAAG -3' (SEQ ID NO. 15); Key-0:5'-GAGACCCAAA-3' (SEQ ID NO.9); Key-1:5'-G*A*G*A*C*C*C*A*A*A-3' (SEQ ID NO.10); Key-2:5'-C*C*T*G*A*A*A*T*T*T*G-3' (SEQ ID NO.11); Key-3:5'-A*G*A*C*C*C*A*A*A-3' (SEQ ID NO.12); FQ Probe: Its nucleotide sequence is: 5'-ROX-CCCCCC-BHQ1-3'.
[0025] In the above sequences, the underlined portion of the HP2 design is complementary to the double-underlined portion, forming an intramolecular hairpin. The wavy lines represent single-stranded free sequences, which are complementary to the keys to form hairpin structures. Specifically, HP2-1 is complementary to key-0 and key-1, HP2-2 is complementary to key-2, and HP2-3 is complementary to key-3. The bolded portion of HP2 is the inherent PAM sequence, and the double-underlined portion is the sequence recognized by the spacer region of crRNA2. * indicates thiophosphorylation modification, and the same applies below.
[0026] Feasibility analysis systems for HP2-1 and Key-0 sequences were prepared according to the formulations and concentrations in Table 1 below, and two control systems were set up according to Tables 2 and 3.
[0027] Table 1. Screening system with simultaneous addition of HP2-1 and Key-0 sequences.
[0028] Table 2 only includes the HP2-1 single control system.
[0029] Table 3. Key-0 standalone control system only.
[0030] Similarly, following the above method, refer to Table 1 to prepare screening system 1 with HP2-1 and Key-1 sequences added simultaneously, and refer to Tables 2 and 3 to prepare separate control systems for HP2-1 and Key-1 respectively; refer to Table 1 to prepare screening system 2 with HP2-2 and Key-2 sequences added simultaneously, and refer to Tables 2 and 3 to prepare separate control systems for HP2-2 and Key-2 respectively; refer to Table 1 to prepare screening system 3 with HP2-3 and Key-3 sequences added simultaneously, and refer to Tables 2 and 3 to prepare separate control systems for HP2-3 and Key-3 respectively.
[0031] Then, fluorescence detection was performed. The prepared reaction systems were placed on the SLAN-96S fully automated medical PCR analysis system for isothermal reaction. The program was to react at 30℃ for 60 minutes, and fluorescence signals were collected.
[0032] The test results are as follows Figure 2As shown, when only Key is present in the detection system, all groups maintain a low fluorescence level. This is because the minimum number of bases required for TS to activate Cas12a protein is 15 nt, which extends from the 5' end to the 3' end. The TS-containing lengths designed by Key are all less than 15 nt. The crRNA2 and CRISPR / Cas12a complex cannot read the complete target, and the Cas12a protein cannot effectively activate and cleave the FQ Probe fluorescent probe, thus maintaining an extremely low fluorescence intensity.
[0033] Similarly, Figure 2 As shown, when HP2-1 exists alone in the detection system, the fluorescence intensity of the detection results remains at an extremely low level. This is because HP2-1 is designed as a hairpin structure with a partially incomplete TS sequence, containing a TS sequence length of less than 15 nt, making it unable to effectively activate and cleave the FQ Probe fluorescent probe. Notably, HP2-2, when present alone in the detection system, can activate Cas12a for fluorescent cleavage. This is because, unlike HP2-1, the incomplete portion of HP2-2 is the PAM sequence region of the double-stranded target NTS, while the TS region is intact and partially exposed. This allows the crRNA2 and CRISPR / Cas12a complex to read and unwind the TS sequence when the target PAM sequence is missing, exposing the complete TS and ultimately activating the Cas12a protein's cleavage activity to cleave the fluorescent probe. HP2-3, when present alone in the detection system, can activate Cas12a for fluorescent cleavage because HP2-3 is designed with a TS length of 15 nt, meeting the minimum base number required to activate the Cas12a protein. Therefore, in the absence of the key, the FQ Probe fluorescent probe is cleaved and produces fluorescence.
[0034] In systems including both HP2 and Key, the cleavage intensity produced by CRISPR / Cas12a activation in system 0 was lower than that in system 1. This is because Key-1 undergoes full-sequence thiophosphorylation modification, which inhibits CRISPR / Cas12a's DNA cleavage activity, maintaining its concentration and allowing it to bind with HP2-1 to form a complete double-stranded target. Key-0, however, is not thiophosphorylated; when CRISPR / Cas12a is activated, its trans-cleavage activity cleaves any single-stranded DNA, significantly reducing its concentration and consequently lowering the concentration of the complete target, thus reducing CRISPR / Cas12a's cleavage efficiency. In system 1, HP2-1 was designed to contain 14nt TS. Considering both the Key-1 and HP2-1 controls, Cas12a protein activation cleavage of FQ only occurred when both were present simultaneously with Key-1. The FQ Probe fluorescent probe produces fluorescence. In system 2, the missing part of HP2-2 is the NTS in the double-stranded DNA target recognized by CRISPR / Cas12a. Key-2 is present as a supplement to the missing NTS. The TS in this system is complete. Combining the Key-2 control and the HP2-2 control alone, the FQ Probe fluorescent probe is cleaved and produces fluorescence when Key is absent. In system 3, HP2-3 is designed to contain a 15nt TS. Combining the Key-3 control and the HP2-3 control alone, HP2-3 can activate the Cas12a protein to cleave the FQ Probe fluorescent probe and produce fluorescence when the PAM sequence is missing.
[0035] In summary, the Key sequence was selected as SEQ ID NO.10 and the HP2 sequence as SEQ ID NO.13 for subsequent experiments.
[0036] Then, a sequence for the autocatalytic hairpin HP1 based on the closed key sequence was designed.
[0037] The HP1 sequence was designed for two main purposes: First, HP1 acts as a blocking probe, trapping the Key internally and preventing it from binding to HP2, thus preventing Cas12a activation and maintaining extremely low fluorescence levels. Second, HP1 acts as a self-catalytic relay probe, generating sufficient Key during the first cleavage after the crRNA1-Cas12a complex recognizes the pathogen target, further triggering a second cleavage and improving detection sensitivity. Therefore, the HP1 sequence designed using NUPACK is as follows (FAM fluorescent groups and BHQ quenchers were introduced into the sequence for easier observation of the cleavage effect): HP1-0:5'- TTTGGGTCTC-BHQ-TTTTTTATTTTTTGAGACCCAAA-FAM-3' (SEQ ID NO.5); HP1-1:5'- TTTGGGTCTC TTTTTTATTTTTTG*A*G*A*C*C*C*A*A*A-3' (SEQ ID NO.6); HP1-2:5'-C*C*T*G*A*A*A*T*T*T*GTTTTTTATTTTTT CAAATTTCAGG -3' (SEQ ID NO. 7); HP1-3:5'- AAACGCTGTGGACTTTTGCG A*G*A*C*C*C*A*A*A CGCAAAAGTCCACAGCGTTT -3' (SEQ ID NO.8).
[0038] In the above sequences, the bolded part is the key sequence. HP1-0, HP1-1, HP1-2, and HP1-3 use key-0, key-1, key-2, and key-3 as key sequences (the bolded sequences), respectively. In HP1-0, HP1-1, and HP1-2, the underlined part of the sequence is complementary to the key sequence. In the HP1-3 sequence, the two underlined parts are complementary.
[0039] In this embodiment, Bordetella pertussis was used as the detection strain, and the target was the IS1663 gene. Since the HP2 sequence inherently contains a PAM sequence, the design of crRNA1 based on the IS1663 gene does not require reliance on the target PAM sequence. The sequence of crRNA1 designed for the IS1663 gene sequence is as follows: The nucleotide sequence of crRNA1 is: 5'-UAAUUUCUACUAAGUGUAGAUCCAAGGCCUUGGCGCUGCGC-3' (SEQ ID NO.3). Cas12a crRNA2 is a universal RNA sequence. The nucleotide sequence designed in this experiment is as follows: 5'-UAAUUUCUACUAAGUGUAGAUGGUCUCUUUGGUCAAUCCCG-3' (SEQ ID NO. 4).
[0040] For experimental safety and ease of sequence verification, a short double-stranded DNA fragment of the Bordetella pertussis IS1663 gene was extracted and synthesized for sequence verification. This fragment was named Activator, and its sequence is as follows: Activator TS:5'-GCGCAGCGCCAAGGCCTTGGCAAA-3' (SEQ ID NO.1); Activator NTS:5'- TTTG CCAAGGCCTTGGCGCTGCGC-3' (SEQ ID NO. 2).
[0041] In the above sequences, the bolded portion of crRNA1 is the spacer sequence of crRNA1, which is complementary to the bolded portion of the Activator TS sequence; the bolded portion of crRNA2 is the spacer sequence of crRNA2; and the underlined sequence in the Activator NTS sequence is the PAM sequence.
[0042] Prepare HP1 sequence feasibility analysis system 0 according to the formula and concentration in Table 4 below. At the same time, prepare HP1-0 / HP2 (i.e. HP2-1) false positive system against crRNA2 according to Table 5. Prepare HP1-0 as a separate control according to Table 6.
[0043] Table 4. Feasibility Analysis System for HP1 Sequence
[0044] Table 5 False positive system for HP1-0 / HP2 against crRNA2
[0045] Table 6 HP1-0 Single Control System
[0046] Then, prepare HP1 sequence feasibility analysis system 1 according to Table 7 below, prepare HP1-1 / HP2 false positive system against crRNA2 according to Table 5, and prepare HP1-1 single control system according to Table 8.
[0047] Table 7. Feasibility Analysis System for HP1 Sequence 1
[0048] Table 8 HP1-1 Single Control System
[0049] Then, referring to Table 7, we prepared feasibility analysis system 2 including HP1-2; referring to Table 5, we prepared the HP1-2 / HP2 false positive system against crRNA2; referring to Table 8, we prepared the single control system including HP1-2; referring to Table 7, we prepared feasibility analysis system 3 including HP1-3; referring to Table 5, we prepared the HP1-3 / HP2 false positive system against crRNA2; referring to Table 8, we prepared the single control system including HP1-3.
[0050] Then, fluorescence detection was performed. The prepared reaction system was subjected to an isothermal reaction on the SLAN-96S fully automated medical PCR analysis system. The program was to run the reaction at 30℃ for 60 minutes, and the fluorescence signal was collected.
[0051] The test results are as follows Figure 3 As shown, in system 0, only when the target activator is present is the DNA cleavage activity recognized and activated by the crRNA1 and Cas12a protein complex. HP1-0 with fluorescent and quenching groups is cleaved and produces a fluorescent signal. However, in the false positive test of HP1-0 / HP2 against crRNA2, no fluorescence is produced. This is because when the target activator is absent, HP1-0 remains stable, and the blocked key cannot be read by crRNA2 to activate Cas12a cleavage and produce fluorescence. In system 1, the difference between HP1-1 and HP1-0 is that HP1-1 is not modified with a fluorescent group. Combining the false positive of HP1-1 / HP2 against crRNA2 with the control of HP1-1 alone, when the target activator is present, the crRNA1 and Cas12a protein complex activates and cleaves HP1-1, releasing the key to bind to HP2, further activating the crRNA2 and Cas12a protein complex to cleave the fluorescent probe. Furthermore, the uncleaved HP1-1 cannot activate the crRNA2 and Cas12a protein complex to produce a fluorescent signal with HP2.
[0052] In System 2, combining HP1-2 / HP2 for false positives against crRNA2 and HP1-2 as a standalone control, in the presence of the target activator, the crRNA1-Cas12a protein complex activates and cleaves HP1-2, releasing the Key which binds to HP2. This further activates the crRNA2-Cas12a protein complex to cleave the fluorescent probe. However, uncleaved HP1-2 and HP2 activate the crRNA2-Cas12a protein complex, producing a fluorescent signal. This is because the Key in HP1-2 is designed at the 5' end. Due to the DNA respiration effect, the Key binds to HP2, causing the crRNA2-Cas12a protein complex to recognize and activate it, generating fluorescence. In contrast, the Key in HP1-1 is designed at the 3' end. Even with the DNA respiration effect, the steric hindrance of the hairpin loop in HP1-1 prevents binding to HP2, thus preventing recognition by the crRNA2-Cas12a protein complex and maintaining low fluorescence intensity.
[0053] In system 3, the HP1-3 / HP2 combination was used as a false positive for crRNA2 and as a control for HP1-3 alone. When the target activator was present, the crRNA1 and Cas12a protein complex activated and cleaved HP1-3, releasing Key which bound to HP2. This further activated the crRNA2 and Cas12a protein complex to cleave the fluorescent probe. However, the uncleaved HP1-3 and HP2 activated the crRNA2 and Cas12a protein complex, producing a fluorescent signal. This is because the Key in HP1-3 is designed at the hairpin loop. Due to the single-strand conformation of the hairpin loop, the Key part binds to HP2, causing the crRNA2 and Cas12a protein complex to recognize and activate it, producing fluorescence.
[0054] In conclusion, the HP1 (HP1-1) sequence was selected as SEQ ID NO.6.
[0055] Therefore, the optimal hairpin sequence for detecting Bordetella pertussis IS1663 gene based on Cas12a without PAM dependence and with high sensitivity is to use the sequences of HP1-1 and HP2-1 as the sequences for subsequent experiments.
[0056] HP1-1:5'- TTTGGGTCTC TTTTTTATTTTTTG*A*G*A*C*C*C*A*A*A-3' (SEQ ID NO.6); HP2-1:5'-TGCATTTGGGTCTC TTTGGTCAATCCCG CACC CGGGATTGACCAAA -3' (SEQ ID NO.13).
[0057] Example 2: Specificity analysis of a Cas12a-based nucleic acid detection method for detecting Bordetella pertussis nucleic acid. Sample processing: Artificial plasmids were constructed using the IS1663 gene (Gene ID: 69603623) of Bordetella pertussis, the ply gene (Gene ID: 45652855) of Streptococcus pneumoniae, and the nuc gene (Gene ID: 3919380) of Staphylococcus aureus. These plasmids were then commercially synthesized by Beijing Qingke Biotechnology Co., Ltd. After synthesis, the plasmids were diluted to 10⁻⁶. 6 Copies / μL were used as specific detection samples, and three sets were repeated as shown in Table 9 below.
[0058] Table 9. Sample types in this test
[0059] Prepare a 10× reaction buffer according to the formula and concentration in Table 10.
[0060] Table 10 Preparation of the 10× reaction buffer system in this experiment
[0061] HP1 and HP2 were diluted to 10 μM with deionized water and annealed on the SLAN-96S fully automated medical PCR analysis system at 95°C. After annealing, they were cooled to room temperature to form hairpin structures.
[0062] Prepare the reaction solution according to the formula and concentration in Table 11.
[0063] Table 11 Reaction system of this experiment
[0064] Take 5 μL of each plasmid sample and add it to 15 μL of reaction solution. React at 30℃ for 1 h, detect the fluorescence signal and analyze the results. All reactions were performed on the SLAN-96S fully automated medical PCR analysis system.
[0065] The results are as follows Figure 4 As shown, this detection system only produces fluorescent signals for Bordetella pertussis nucleic acid samples, while maintaining low fluorescence levels for Streptococcus pneumoniae and Staphylococcus aureus nucleic acid samples. Furthermore, the fluorescence signal reaches a plateau phase at around 40 minutes, indicating that the detection system has a specific response only to Bordetella pertussis.
[0066] Example 3: Detection limit test of Bordetella pertussis using a Cas12a-based nucleic acid detection method. Sample processing: Take the Bordetella pertussis IS1663 gene plasmid and dilute it with purified water to the corresponding concentration according to the numbers in Table 12 below.
[0067] Table 12 Concentration and sample number of each sample during this experiment
[0068] Prepare a 10× reaction buffer according to the formulation and concentration in Table 10 of Example 2.
[0069] HP1 and HP2 were diluted to 10 μM with purified water and annealed on a SLAN-96S fully automated medical PCR analysis system at 95°C, then cooled to room temperature to form hairpin structures. The reaction system was prepared according to the formula and concentration in Table 11 of Example 2.
[0070] Then, 5 μL of diluted viral plasmid was added to the 15 μL reaction solution in Table 11 of Example 2, and reacted at 30°C for 1 h. The fluorescence signal was detected and the results were analyzed. All reactions were performed on the Hongshi SLAN-96S fully automated medical PCR analysis system.
[0071] The test results are as follows Figure 5 As shown, the detection limit of this system for the IS1663 gene of Bordetella pertussis is as low as 1×10⁻⁶. 2 Copy / μL.
[0072] Finally, it should be noted that the above description of the embodiments is intended to enable those skilled in the art to understand and use the invention. Those skilled in the art will readily make various modifications to these embodiments and apply the general principles described herein to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments, and any improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the invention should be within the protection scope of the present invention.
Claims
1. A rapid nucleic acid detection method based on Cas12a, wherein the nucleic acid detection method activates Cas12a to cleave HP1 to release a phosphate-thioester modified Key, and the phosphate-thioester modified Key binds to HP2 with its own PAM sequence, activating universal crRNA2 / Cas12a for secondary cleavage to generate a fluorescent signal, thereby achieving nucleic acid detection without PAM sequence and with autocatalytic signal amplification, characterized in that, Includes the following steps: S1. Extract nucleic acid from the sample to be tested to obtain the test extract; S2. Anneal HP1 and HP2 separately for later use; HP1 is a closed hairpin probe, which includes thiomodified DNA, and the thiomodified DNA sequence is 5'-G*A*G*A*C*C*C*A*A*A-3'; HP2 is a half-hairpin probe with its own PAM sequence, which is complementary to the thiomodified DNA sequence. S3. The annealed HP1 and HP2 from step S2 are mixed with crRNA1, crRNA2, lbCas12a, a fluorescent probe, and a 10× reaction buffer to obtain a reaction solution. The crRNA1 is an RNA sequence designed for the test extract in step S1. The crRNA2 is a universal RNA sequence, including a handle sequence and a spacer sequence, wherein the handle sequence binds to the lbCas12a protein, and the spacer sequence is complementary to the HP2. S4. Take the extract to be tested obtained in step S1, mix it with the reaction solution prepared in step S3, and place it on a PCR analysis system for reaction.
2. The rapid nucleic acid detection method as described in claim 1, characterized in that, The specific process of annealing HP1 and HP2 in step S2 is as follows: Dilute HP1 or HP2 with deionized water to 8~15μM, then place them on a PCR analysis system and anneal at 90~97℃ for 5~10min, and then cool to room temperature.
3. The rapid nucleic acid detection method as described in claim 1, characterized in that, The 10×reaction buffer mentioned in step S3 includes 450~550mM NaCl, 80~120mM Tris-HCl, 80~120mM MgCl2 and 800~1200μg / mL Recombinant Albumin.
4. The rapid nucleic acid detection method as described in claim 1, characterized in that, The nucleotide sequence of the fluorescent probe in step S3 is 5'-ROX-CCCCCC-BHQ1-3'.
5. The rapid nucleic acid detection method as described in claim 1, characterized in that, The reaction conditions for step S4 are 28~33℃ for 50~80 min.
6. A rapid nucleic acid detection kit, wherein the rapid nucleic acid detection kit activates Cas12a to cleave HP1 to release a phosphate-thioester modified Key, the phosphate-thioester modified Key binds to HP2 with a built-in PAM sequence, and then activates universal crRNA2 / Cas12a for secondary cleavage to generate a fluorescent signal, thereby achieving nucleic acid detection without the need for a PAM sequence and with autocatalytic signal amplification, characterized in that, Includes HP1, HP2, crRNA1, crRNA2, lbCas12a, fluorescent probe, 10×reaction buffer, and deionized water; HP1 is a closed hairpin probe, which includes thiomodified DNA with a sequence of 5'-G*A*G*A*C*C*C*A*A*A-3'; HP2 is a half-hairpin probe with a built-in PAM sequence that is complementary to the thiomodified DNA sequence. The crRNA1 is an RNA sequence designed for the target; the crRNA2 is a universal RNA sequence, including a handle sequence and a spacer sequence, wherein the handle sequence binds to the lbCas12a protein, and the spacer sequence is complementary to HP2.
7. The kit according to claim 6, characterized in that, The nucleotide sequence of the fluorescent probe is 5'-ROX-CCCCCC-BHQ1-3'; the 10×reaction buffer includes 450~550mM NaCl, 80~120mM Tris-HCl, 80~120mM MgCl2 and 800~1200μg / mL Recombinant Albumin.