A dual proximity-activated immuno-lamp ultra-sensitive method for detecting proteins

Abstract

The application discloses a kind of double proximity activated immunolamp ultra-sensitive detection protein method.The method is to be detected protein sample into containing starting chain immunoreaction system, and post in specific temperature condition, while carrying out immunoreaction and DNA chain complementary pairing reaction;After reaction, double proximity activated extension system is added, and post in specific temperature condition reaction;Again, fluorescence quantitative LAMP system is added, and post in specific temperature condition reaction, real-time collection fluorescence signal, to reach the time (Tt) of threshold value judgment detection.The application significantly reduces the background signal generated in the extension based on proximity effect, improves detection sensitivity, improves detection performance, and gives proximity activated immunodetection technology the ability of point-of-care testing (POCT), with high sensitivity, strong specificity, short detection time and simple operation and the like advantages.

Description

Technical Field

[0001] This invention belongs to the field of biodetection technology, specifically involving the cross-technology of nucleic acid amplification and immunodetection, and in particular a method for ultrasensitive detection of proteins using immuno-LAMP. Background Technology

[0002] Proteins, as key executors of life activities, participate in a variety of intracellular processes, including DNA replication, metabolic catalysis, molecular transport, and cell signaling. However, proteins in biological matrices are typically present at ultra-trace levels, and complex sample compositions can easily lead to cross-interference. Therefore, developing highly sensitive and specific methods for protein detection and identification has significant application value in fields such as clinical diagnosis, food safety assessment, and environmental monitoring.

[0003] Currently, traditional protein detection methods mainly include electrochemical detection, mass spectrometry, and immunoassay. While electrochemical detection offers high sensitivity, it is susceptible to environmental interference; mass spectrometry boasts high resolution and accuracy, but its sample pretreatment process is lengthy and complex, easily leading to the loss of low-abundance proteins. In contrast, immunoassays are widely used due to their low cost, ease of operation, rapid detection speed, and high selectivity and sensitivity. However, commonly used immunoassays, such as enzyme-linked immunosorbent assay (ELISA) and lateral flow assay (LFA), typically have sensitivities only at the picomolar (pM) level, which is insufficient for detecting ultra-low abundance proteins in biological fluids, down to femtomolar (fM) or even atomolar (aM) levels. Summary of the Invention

[0004] To address the problems and shortcomings of the prior art, the present invention aims to provide a method for ultrasensitive protein detection using dual proximity activation immuno-LAMP, thereby meeting the urgent need for ultrasensitive detection in the field of bioassay technology. It also solves the technical problems of existing immuno-PCR techniques, which require multiple temperature cycles to achieve nucleic acid amplification, rely on sophisticated thermal cycling instruments, are time-consuming, and are difficult to implement for rapid on-site detection.

[0005] The method of this invention utilizes antibody-DNA conjugates and a dual proximity-activated DNA extension reaction mediated by the initiation strand to generate a template for loop-mediated isothermal amplification (LAMP). Then, by leveraging the high sensitivity and high specificity of LAMP, ultrasensitive detection of protein targets can be achieved.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: (1) The protein sample to be tested is added to an immune reaction system containing the initiating chain and then placed under specific temperature conditions to simultaneously carry out the immune reaction and the complementary pairing reaction of the DNA chain. (2) Add the double proximity activated extension system to the solution after the reaction in step (1), and then react it under specific temperature conditions; (3) Take 2.5 μL of the solution after the reaction in step (2) and add it to the fluorescence quantitative LAMP system. Then, place it under specific temperature conditions for reaction and finally collect the fluorescence signal. The time Tt to reach the threshold is used to determine the high-sensitivity detection target protein.

[0007] The target proteins described in this invention can typically be allergens, pathogen proteins, cytokines, signaling pathway proteins, tumor markers, myocardial markers, low-abundance transcription factors, antibody drugs, and other target proteins. The target protein sample is a solution containing the target protein.

[0008] In step (1), the immune reaction system containing the initiating chain includes two antibody-DNA conjugates that can bind to different sites of the target protein and an initiating chain that is partially complementary to the DNA chain in one of the conjugates; the immune reaction system is placed at a constant temperature of 37°C and the reaction time is 30 minutes. The antibody-DNA conjugates used in the immune response system include, but are not limited to: antibody-DNA conjugates prepared by copper-free click chemistry, antibody-DNA conjugates prepared by the streptavidin-biotin system, antibody-DNA conjugates prepared by sodium 4-(N-maleimidemethyl)cyclohexane-1-carboxylic acid sulfonyl succinimide ester (sulfon-SMCC), and antibody-DNA conjugates prepared by disuccinimide octanoate (DSS).

[0009] Furthermore, the immune response system also includes: 1-100 ng each of two antibody-DNA conjugates, 50-5000 fmol of the starting chain, 0.1% (w / v) BSA, 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4, and the target protein.

[0010] Preferably, in the immune reaction system, the amount of each antibody-DNA conjugate is 10 ng, and the amount of the starting chain is 500 fmol.

[0011] Furthermore, in the immune response, the DNA chains of the two antibody-DNA conjugates each contain consecutive complementary nucleotide fragments in the 3′ end region, and the complementary fragments have 5 to 9 bp base pairs; preferably, the complementary fragments have 7 bp base pairs.

[0012] In step (2), the dual proximity activation extension system contains Bst 2.0 DNA polymerase and four dNTPs. The dual proximity activation extension system is reacted for 20 minutes under a constant temperature condition in the range of 25-45℃. The concentration of Bst 2.0 DNA polymerase in the double proximity activation extension system was 0.077 U / μL. The four dNTPs were dATP, dTTP, dCTP and dGTP, and the molar concentration of each of the four dNTPs in the double proximity activation extension system was 417 μM.

[0013] The dual proximity activation extension system includes, but is not limited to, extension using any one of Bst DNA polymerase, Bsu DNA polymerase, and phi29 DNA polymerase.

[0014] Furthermore, the extended system of dual proximity activation also includes: Bst 2.0 DNA polymerase 0.2-5 U, Tris-HCl 41.7 mM, KCl 104 mM, (NH4)2SO4 20.8 mM, MgSO4 16.7 mM, and dNTP mixture 417 μM.

[0015] Preferably, in the dual proximity activated extended system, Bst 2.0 The amount of DNA polymerase used is 1 U.

[0016] In the extended system with dual proximity activation, the reaction is carried out at a constant temperature, provided in the range of 25-45°C. Preferably, the reaction temperature is 35-40°C. More preferably, the reaction temperature is 37°C.

[0017] In step (3), the quantitative real-time LAMP system includes Bst 2.0 DNA polymerase, LAMP primers, four dNTPs and the fluorescent dye syto-9; the LAMP amplification system is reacted at a constant temperature in the range of 61-69℃ for 40 minutes. The molar concentration of Bst DNA polymerase in the quantitative real-time LAMP system was 0.356 U / μL. The four dNTPs were dATP, dTTP, dCTP, and dGTP, and the molar concentration of each dNTP in the quantitative real-time LAMP system was 222 μM.

[0018] The LAMP primers consist of two outer primers, F3 and B3, two inner primers, FIP and BIP, and one loop primer, LB. The molar concentrations of F3 and B3 in the quantitative real-time LAMP system are both 222 nM, the molar concentrations of FIP and BIP are both 1.78 μM, and the molar concentration of LB is 444 nM. The molar concentration of the fluorescent dye syto-9 in the quantitative real-time LAMP system is 2.2 μM.

[0019] Furthermore, the LAMP amplification system also includes: Bst 2.0 DNA polymerase 4-16 U, Tris-HCl 22.2 mM, KCl 55.6 mM, (NH4)2SO4 11.1 mM, MgSO4 8.89 mM, dNTP mixture 222 mM, betaine 888.8 mM, outer primer F3 1-10 nmol, outer primer B3 1-10 pmol, inner primer FIP 10-100 pmol, inner primer BIP 10-100 pmol, loop primer LF 5-50 pmol, and fluorescent dye syto-9 10-100 pmol. The outer primer F3, outer primer B3, inner primer FIP, inner primer BIP, and loop primer LF are SEQ ID No. 5 to SEQ ID No. 9, respectively.

[0020] Preferably, the amount of Bst DNA polymerase is 8 U, the amount of outer primer F3 and outer primer B3 is 5 pmol, the amount of inner primer FIP and inner primer BIP is 40 pmol, the amount of loop primer LF is 10 pmol, and the amount of fluorescent dye syto-9 is 50 pmol.

[0021] In the ring-mediated isothermal amplification reaction system, the reaction is carried out at a constant temperature, provided in the range of 61-69°C. Preferably, the reaction temperature is 63-67°C. More preferably, the reaction temperature is 65°C.

[0022] In step (3), the time required for the fluorescence value to reach the fluorescence threshold automatically determined by the fluorescence quantitative PCR instrument software (i.e., threshold time Tt) is used as the evaluation parameter for the following judgment: The threshold time Tt is negatively correlated with the concentration of the target protein; that is, the lower the Tt value, the higher the concentration of the target protein in the sample to be tested. The obtained Tt value is then substituted into a preset standard curve to calculate the content of the target protein in the sample to be tested. The standard curve is pre-established by using target protein standards with known concentration gradients through the same detection process.

[0023] This invention provides the application of the proximity effect in immune LAMP, the application of which includes: using two antibody-DNA conjugates to bind to a protein target, then generating a template for LAMP amplification through a dual proximity activation extension reaction mediated by the antibody-DNA conjugate and the initiating strand, and finally realizing the quantitative detection of the protein target by detecting the generated DNA template through real-time LAMP.

[0024] like Figure 1 As shown in the experiment, the present invention found that introducing the 5'-3' polymerase activity and strand displacement activity of Bst DNA polymerase into adjacent-activated immunoPCR, and generating a nucleic acid amplification template through two adjacent-activated extension reactions, can significantly reduce the detection background and thus improve the detection sensitivity.

[0025] In the dual proximity activation immuno-LAMP method described in this invention, the antibody-DNA conjugate first binds to the target antigen, forming a sandwich immune complex. Subsequently, the starting strand binds complementary to the DNA sequence in one of the conjugates, forming a double-stranded structure. Under the 5'-3' polymerase activity of Bst DNA polymerase, this double-stranded structure uses the starting strand as an extension template to mediate the elongation reaction of its complementary conjugate DNA strand. Then, under the synergistic action of the 5'-3' polymerase activity and strand displacement activity of Bst DNA polymerase, the DNA in the other conjugate undergoes a first proximity activation elongation reaction with the starting strand, displacing the pre-bound and elongated conjugate DNA strand from the double-stranded DNA. The released conjugate DNA strand undergoes a second proximity activation elongation reaction with the other conjugate DNA strand under the action of the 5'-3' polymerase of Bst DNA polymerase, thereby generating the template strand for nucleic acid amplification. Through these two proximity activation elongation reactions, this invention effectively suppresses the generation of non-specific background signals, achieving highly sensitive and specific detection of the target protein.

[0026] Furthermore, due to the low coupling efficiency of long DNA fragments with antibodies, single-proximity activation extension reactions based on sandwich immune complexes typically only generate nucleic acid templates shorter than 150 bp, which is insufficient to meet the template length requirements (150-300 bp) for LAMP amplification. Dual-proximity activation extension reactions, by introducing a starter strand with freely controllable length, can generate longer template strands, thus effectively combining the proximity effect with immunoLAMP technology. Compared to PCR, LAMP technology offers shorter detection times and eliminates the need for complex temperature cycling devices. Therefore, by integrating the proximity effect with LAMP technology, the dual-proximity activation immunoLAMP method described in this invention holds promise for on-site detection.

[0027] The sandwich immune complex is formed by two antibody-DNA conjugates recognizing different sites of the same antigen.

[0028] The proximity-based extension can be performed using, but is not limited to, any one of Bst DNA polymerase, Bsu DNA polymerase, and phi29 DNA polymerase.

[0029] The "proximity effect" refers to the following: when two antibody-DNA conjugates simultaneously bind to different epitopes of the target antigen, the two complementary DNA strands at their ends produce a local high concentration effect due to their spatial proximity, thereby efficiently undergoing an extension reaction under the action of polymerase to generate complete double-stranded DNA; conversely, when the two antibodies fail to bind to the target protein simultaneously, the two DNA strands are spatially far apart and cannot effectively undergo an extension reaction, thus failing to generate a large amount of DNA templates available for nucleic acid amplification.

[0030] The dual proximity activation immuno-LAMP method of the present invention can effectively reduce detection background and improve detection sensitivity based on proximity activation immuno-PCR, and is applicable to protein detection in fields such as environmental monitoring, food safety testing, agricultural and livestock testing, and clinical diagnosis. Detection targets include, but are not limited to, allergens, pathogen proteins, cytokines, signaling pathway proteins, tumor markers, myocardial markers, low-abundance transcription factors, and antibody drugs. In this invention, the reaction tubes and heating blocks used are not specifically limited, as long as they can ensure a stable reaction temperature.

[0031] This invention provides an immuno-LAMP technique that, by introducing an additional starting strand in addition to an antibody-DNA conjugate, performs a dual proximity-activated extension reaction to generate a template for LAMP amplification, thereby enabling the detection of target proteins. Unlike single proximity-activated extension reactions, this invention requires a dual proximity-activated extension reaction to effectively generate nucleic acid amplification template, thereby significantly reducing the background signal generated in proximity-based extension and improving detection sensitivity.

[0032] The beneficial effects of this invention are as follows: (1) This invention discloses an extension reaction based on an antibody-DNA conjugate, which involves introducing a starting strand for dual proximity activation. Compared to single proximity activation extension reactions, dual proximity activation extension reactions can only generate a template strand for nucleic acid amplification after two proximity activation extension reactions, and have higher tolerance to background signals. Therefore, they have the advantages of low background, high sensitivity and no false positives.

[0033] (2) This invention discloses for the first time a method for generating LAMP template strands through a dual proximity activation extension reaction, thereby combining the proximity activation extension reaction with the LAMP reaction. Compared to proximity activation immunoPCR, dual proximity activation immunoLAMP has higher detection sensitivity and specificity. More importantly, it has a shorter detection time and can be used for on-site detection. The entire dual proximity activation immunoLAMP detection process can be completed within 2 hours without the need for an additional temperature cycling device.

[0034] Furthermore, this method for target protein detection has advantages such as high sensitivity, strong specificity, short detection time, and simple operation. Attached Figure Description

[0035] Figure 1 This is a schematic diagram of the immune LAMP principle of dual proximity activation.

[0036] Figure 2 This is a comparison of the threshold time of dual-proximity activated immune LAMP when different amounts of Bst DNA polymerase are used in the proximity activation extension step in Example 1.

[0037] Figure 3 This is a comparison of the threshold time of dual-proximity activated immune LAMP when different amounts of antibody-DNA conjugate are used in the immune reaction step in Example 2.

[0038] Figure 4 This is a comparison chart of the detection thresholds of dual proximity activated immune LAMP, single proximity activated immune PCR, and dual proximity activated immune PCR in Example 3. Detailed Implementation

[0039] The present invention will be further described below with reference to specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the invention.

[0040] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.

[0041] The Listeria monocytogenes used in this embodiment was obtained by culturing and counting Listeria monocytogenes strains, and adjusting the bacterial concentration to 10. 8 CFU / mL, then dilute sequentially (10) 7 CFU / mL, 10 6 CFU / mL, 10 5 CFU / mL, 10 4CFU / mL, 10 3 CFU / mL, 10 2 CFU / mL, 10 1 (CFU / mL), using different concentrations of bacteria as detection targets for dual proximity-activated immune LAMP.

[0042] In the examples, the antibody-DNA conjugates were obtained by conjugating two monoclonal antibodies that specifically bind to the Listeria monocytogenes p60 protein to single-stranded oligonucleotides. The conjugation mechanism used for the antibody and DNA strand was a ring-strain-promoted azide-alkyne cycloaddition reaction.

[0043] In the examples, the DNA sequences conjugated with the two Listeria monocytogenes antibodies in the immune LAMP used for dual proximity activation are as follows: A1: 5'-TAAAACCTCCGCATTCCTGTGACTGCTGAGGTTGGATCAGGCTACTTCAAGATGACTGATGTGTCC-3', SEQ ID No. 1.

[0044] A2: 5'-TCAGTCACTTCGAGTGCTCGGCCCTCCACGGGAGTGATGACAAGCATCTTCTTCCTTGAATCTAG-3', SEQ ID No. 2.

[0045] The starting strand DNA sequence used in the dual proximity activation immune LAMP in the example is as follows: A3: 5'-CTTCCTTCATCTGTGCATCAGACTTTCCATTGCGGATCTTGATTTTGCCCAAGGTGTCGCTGTCAAAGGACACATCAGTCATCTTGATCTAGATTG-3', SEQ ID No. 3.

[0046] The LAMP primer sequences for the template strand used in this embodiment for LAMP amplification are as follows: F3: 5'-AAAACCTCCGCATTCCTG-3', SEQ ID No. 4.

[0047] B3: 5'-CAGTCACTTCGAGTGCTC-3', SEQ ID No. 5.

[0048] FIP: 5'-CCAAGGTGTCGCTGTCAAAGACTGCTGAGGTTGGATCA-3', SEQ ID No. 6.

[0049] BIP: 5'-CCGCAATGGAAAGTCTGATGCCACGGGAGTGATGACAAG-3', SEQ ID No. 7.

[0050] LF: 5'-ACATCAGTCATCTTGAAGTAGCC-3', SEQ ID No. 8.

[0051] In the examples, the DNA sequences conjugated with the two Listeria monocytogenes antibodies in the single-neighbor activation immunoPCR were as follows: AA1: 5'-TCGCATCTGCTGTTCAGTCTCACGCTTATCACCTCAGTTATTAATCTACCGATCCAG-3', SEQ ID No. 9.

[0052] AA2: 5'-TCTGACCGGCTGAAAGCATCACTACTTACCTACCTCTGTCACTGGATC-3', SEQ ID No. 10.

[0053] In the examples, the DNA sequences conjugated with the two Listeria monocytogenes antibodies in the dual proximity-activated immunoPCR are as follows: AAA1: 5'-TGAGCGAATACTGACCGGCTGAAAGCATCACTGACCGACTTATAGGATGAACTG-3', SEQ ID No. 11.

[0054] AAA2: 5'-TACATGTCGCATCTGCTGTTCAGTCTCACGTATCACCTCAGTTATTAATCTATCGATCCAG-3', SEQ ID No. 12.

[0055] In this embodiment, the starting strand DNA sequence used in the dual proximity activation immunoPCR is: AAA3: 5'-CAGTTAGTCTTCGCTCAGTTCATCCTATAAGTCGGCCTCTGTCACTGGATCTCCTACT-3', SEQ ID No. 13.

[0056] The PCR primer sequences used for PCR amplification in this example are as follows: F: 5'-CTGACCGGCTGAAAGCATC-3', SEQ ID No. 14.

[0057] R: 5'-ATCTGCTGTTCAGTCTCACG-3', SEQ ID No. 15.

[0058] Example 1 This embodiment utilizes a dual proximity-activated immune LAMP system to detect Listeria monocytogenes.

[0059] To investigate the effect of different amounts of Bst DNA polymerase (0.2, 1, 5 U) on the detection efficiency of double proximity activated immuno-LAMP in a double proximity activated extension system.

[0060] Immunoreaction system (13 μL): 10 ng of two antibody-DNA conjugates, 500 fmol of starting chain, 0.1% (w / v) BSA, 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4, and 10 μL of other solutions. 2 -10 7 10 μL of Listeria monocytogenes CFU / mL culture. Replace the bacterial solution in the immunization system with 0.01 M phosphate-buffered saline (PBS, pH 7.4) as a negative sample, otherwise follow the same procedure.

[0061] Immune response procedure: 37℃ for 30 minutes.

[0062] Add a dual proximity activation extension system to the solution after the immune response.

[0063] Dual proximity activation extended system (12 μL): Bst 2.0 DNA polymerase 0.2–5 U, Tris-HCl 41.7 mM, KCl 104 mM, (NH4)2SO4 20.8 mM, MgSO4 16.7 mM, dNTP mixture 417 μM. Any volume less than 12 μL in the reaction mixture was made up with DEPC H2O.

[0064] Extended reaction procedure with dual proximity activation: react at 37°C for 20 minutes.

[0065] 2.5 μL of the product from the double proximity activation extension reaction was added to a real-time quantitative LAMP system for detection.

[0066] The quantitative real-time LAMP system (22.5 μL) consisted of: Bst 2.0 DNA polymerase 8 U, Tris-HCl 22.2 mM, KCl 55.6 mM, (NH4)2SO4 11.1 mM, MgSO4 8.89 mM, dNTP mixture 222 μM, betaine 888.8 mM, outer primer F3 5 pmol, outer primer B3 5 pmol, inner primer FIP 40 pmol, inner primer BIP 40 pmol, loop primer LF 10 pmol, and fluorescent dye syto-9 50 pmol. Any volume less than 22.5 μL was made up with DEPC H2O.

[0067] LAMP reaction procedure: react at 65℃ for 40 minutes, and collect fluorescence signals in real time.

[0068] The results are as follows Figure 2 As shown, when the amount of Bst DNA polymerase is 0.2 U, the Tt values ​​of negative and weakly positive samples are very high, indicating that the background signal of detection is relatively weak. However, the Tt values ​​of strongly positive samples are also relatively high, indicating that the positive detection signal is also relatively weak, resulting in a significant decrease in detection sensitivity. When the amount of Bst DNA polymerase was 5 U, the positive signal was acceptable, but the background signal was significantly increased, resulting in a significant decrease in detection sensitivity. When the amount of Bst DNA polymerase is 1 U, the background signal is greatly reduced without significantly decreasing the positive signal, thus achieving the highest detection sensitivity, detecting as low as 10 in a 10 μL sample. 3 Listeria monocytogenes CFU / mL.

[0069] In summary, 1 U Bst DNA polymerase is the optimal amount for the dual proximity activation extension reaction, which can effectively suppress background interference while maintaining a strong positive signal, achieving highly sensitive and specific detection.

[0070] Example 2 This embodiment utilizes a dual proximity-activated immune LAMP system to detect Listeria monocytogenes.

[0071] To investigate the effect of different dosages (1, 10, 100 ng) of antibody-DNA conjugate on the detection efficiency of dual proximity-activated immuno-LAMP reaction.

[0072] Immunoreaction system (13 μL): two antibody-DNA conjugates 1-100 ng, starting chain 500 fmol, 0.1% (w / v) BSA, NaCl 137 mM, KCl 2.7 mM, Na2HPO4 10 mM, KH2PO4 2 mM, and a 10% concentration of... 2 -10 7 10 μL of Listeria monocytogenes CFU / mL culture. Replace the bacterial solution in the immunization system with 0.01 M phosphate-buffered saline (PBS, pH 7.4) as a negative sample, otherwise follow the same procedure.

[0073] Immune response procedure: 37℃ for 30 minutes.

[0074] Add a dual proximity activation extension system to the solution after the immune response.

[0075] Dual proximity activation extended system (12 μL): Bst 2.0 DNA polymerase 1 U, Tris-HCl 41.7 mM, KCl 104 mM, (NH4)2SO4 20.8 mM, MgSO4 16.7 mM, dNTP mixture 417 μM. Any volume less than 12 μL in the reaction mixture was made up with DEPC H2O.

[0076] Extended reaction procedure with dual proximity activation: react at 37°C for 20 minutes.

[0077] 2.5 μL of the product from the double proximity activation extension reaction was added to a real-time quantitative LAMP system for detection.

[0078] The quantitative real-time LAMP system (22.5 μL) consisted of: Bst 2.0 DNA polymerase 8 U, Tris-HCl 22.2 mM, KCl 55.6 mM, (NH4)2SO4 11.1 mM, MgSO4 8.89 mM, dNTP mixture 222 μM, betaine 888.8 mM, outer primer F3 5 pmol, outer primer B3 5 pmol, inner primer FIP 40 pmol, inner primer BIP 40 pmol, loop primer LF 10 pmol, and fluorescent dye syto-9 50 pmol. Any volume less than 22.5 μL was made up with DEPC H2O.

[0079] LAMP reaction procedure: react at 65℃ for 40 minutes, and collect fluorescence signals in real time.

[0080] The results are as follows Figure 3As shown, when the amount of antibody-DNA conjugate is 1 ng, both the positive signal and the background signal are at a low level. When the amount of antibody-DNA conjugate was 100 ng, the positive signal was very high, but the background signal was also significantly increased, resulting in a significant decrease in detection sensitivity. When the antibody-DNA conjugate dosage was 10 ng, the positive signal increased significantly, while the background signal did not increase significantly, thus achieving higher detection sensitivity, detecting as low as 10 ng in a 10 μL sample. 3 Listeria monocytogenes CFU / mL.

[0081] In summary, 10 ng of antibody-DNA conjugate was determined to be the optimal amount for the dual proximity-activated immunolamp. This dosage effectively suppresses background interference while maintaining a strong positive signal, thereby achieving highly sensitive and specific detection.

[0082] Example 3 In this embodiment, Listeria monocytogenes suspension was detected using a dual proximity-activated immuno-LAMP system, a single proximity-activated immuno-PCR system, and a dual proximity-activated immuno-PCR system, respectively, to investigate the effect of the dual proximity-activated immuno-LAMP system on improving detection sensitivity.

[0083] (1) Dual proximity activation immune LAMP detection system The immunoreaction system for dual proximity-activated immunolamp (13 μL) consisted of two antibody-DNA conjugates (10 ng each), a starting chain of 500 fmol, 0.1% (w / v) BSA, NaCl 137 mM, KCl 2.7 mM, Na₂HPO₄ 10 mM, KH₂PO₄ 2 mM, and a 10% concentration of [unspecified compound]. 2 -10 7 10 μL of CFU / mL Listeria monocytogenes culture. Replace the bacterial solution in the immunization system with 0.01 M phosphate-buffered saline (PBS, pH 7.4) as a negative sample, otherwise follow the same procedure.

[0084] Immune response procedure: 37℃ for 30 minutes.

[0085] Add a dual proximity-activated immune LAMP extension system to the solution after the immune response.

[0086] The extension system for dual proximity activation (12 μL) consisted of: 1 U Bst 2.0 DNA polymerase, 41.7 mM Tris-HCl, 104 mM KCl, 20.8 mM (NH4)2SO4, 16.7 mM MgSO4, and 417 μM dNTP mixture. Any volume less than 12 μL was brought up with DEPC H2O.

[0087] Extended reaction procedure with dual proximity activation: react at 37°C for 20 minutes.

[0088] 2.5 μL of the product from the double proximity activation extension reaction was added to a real-time quantitative LAMP system for detection.

[0089] The quantitative real-time LAMP system (22.5 μL) consisted of: Bst 2.0 DNA polymerase 8 U, Tris-HCl 22.2 mM, KCl 55.6 mM, (NH4)2SO4 11.1 mM, MgSO4 8.89 mM, dNTP mixture 222 μM, betaine 888.8 mM, outer primer F3 5 pmol, outer primer B3 5 pmol, inner primer FIP 40 pmol, inner primer BIP 40 pmol, loop primer LF 10 pmol, and fluorescent dye syto-9 50 pmol. Any volume less than 22.5 μL was made up with DEPC H2O.

[0090] LAMP reaction procedure: react at 65℃ for 40 minutes, and collect fluorescence signal once per minute as one cycle.

[0091] (2) Single proximity activation immunoPCR detection system The immunoreaction system for single-neighbor activation immunoPCR (13 μL) consisted of two antibody-DNA conjugates (1 ng each), 0.1% (w / v) BSA, NaCl 137 mM, KCl 2.7 mM, Na₂HPO₄ 10 mM, KH₂PO₄ 2 mM, and a 10% concentration of [unclear - likely a specific concentration or concentration]. 2 -10 7 10 μL of Listeria monocytogenes CFU / mL culture. Replace the bacterial solution in the immunization system with 0.01 M phosphate-buffered saline (PBS, pH 7.4) as a negative sample, otherwise follow the same procedure.

[0092] Immune response procedure: 37℃ for 30 minutes.

[0093] Add a single-neighbor activation immunoPCR extension system to the solution after the immune reaction.

[0094] Extension system (12 μL) for single-neighbor activation immunoPCR: Bst 2.0 DNA polymerase 0.2 U, Tris-HCl 41.7 mM, KCl 104 mM, (NH4)2SO4 20.8 mM, MgSO4 16.7 mM, dNTP mixture 417 μM. Any volume less than 12 μL in the reaction system was brought to the nearest whole number using DEPC H2O.

[0095] Extended reaction procedure for single proximity activation: react at 37°C for 20 minutes.

[0096] Take 2.5 μL of the product from the double proximity activation extension reaction and add it to the real-time quantitative PCR system for detection.

[0097] The quantitative real-time PCR system (22.5 μL) consisted of: Tris-HCl 11.1 mM, KCl 55.6 mM, MgCl2 1.67 mM, Taq DNA polymerase 1 U, dNTP mixture 222 μM, forward primer 10 pmol, reverse primer 10 pmol, and syto-9 fluorescent dye 50 pmol. Any volume less than 22.5 μL was made up with DEPC H2O.

[0098] PCR reaction program: pre-denaturation at 95℃ for 10 minutes; then a two-temperature cycling program was used, with the following cycle: denaturation temperature at 95℃ for 30 seconds; annealing temperature at 60℃ for 1 minute; a total of 40 cycles were performed.

[0099] (3) Dual proximity activation immunoPCR detection system The immunoreaction system for dual proximity-activated immunoPCR (13 μL) consisted of two antibody-DNA conjugates (10 ng each), starting strand (500 fmol), 0.1% (w / v) BSA, NaCl (137 mM), KCl (2.7 mM), Na₂HPO₄ (10 mM), KH₂PO₄ (2 mM), and a 10% concentration of [unspecified compound]. 2 -10 7 10 μL of CFU / mL Listeria monocytogenes culture. Replace the bacterial solution in the immunization system with 0.01 M phosphate-buffered saline (PBS, pH 7.4) as a negative sample, otherwise follow the same procedure.

[0100] Immune response procedure: 37℃ for 30 minutes.

[0101] Add a single-neighbor activation immunoPCR extension system to the solution after the immune reaction.

[0102] Extension system (12 μL) for single-neighbor activation immunoPCR: 1 U Bst 2.0 DNA polymerase, 41.7 mM Tris-HCl, 104 mM KCl, 20.8 mM (NH4)2SO4, 16.7 mM MgSO4, and 417 μM dNTP mixture. Any volume less than 12 μL in the reaction system was brought to a final volume with DEPC H2O.

[0103] Extended reaction procedure for single proximity activation: react at 37°C for 20 minutes.

[0104] Take 2.5 μL of the product from the double proximity activation extension reaction and add it to the real-time quantitative PCR system for detection.

[0105] The quantitative real-time PCR system (22.5 μL) consisted of: Tris-HCl 11.1 mM, KCl 55.6 mM, MgCl2 1.67 mM, Taq DNA polymerase 1 U, dNTP mixture 222 μM, forward primer 10 pmol, reverse primer 10 pmol, and syto-9 fluorescent dye 50 pmol. Any volume less than 22.5 μL was made up with DEPC H2O.

[0106] PCR reaction program: pre-denaturation at 95℃ for 10 minutes; then a two-temperature cycling program was used, with the following cycle: denaturation temperature at 95℃ for 30 seconds; annealing temperature at 60℃ for 1 minute; a total of 40 cycles were performed.

[0107] The results are as follows Figure 4 As shown, dual-proximity activated immuno-LAMP has a detection sensitivity similar to dual-proximity activated immuno-PCR, detecting as low as 10 in 10 μL of sample. 3 Listeria monocytogenes at CFU / mL. However, double proximity activated immuno-LAMP, due to its use of LAMP technology for amplification under isothermal conditions, does not require additional temperature control and has a shorter detection time than double proximity immuno-PCR.

[0108] Furthermore, dual proximity activation immunoPCR exhibits lower detection background and higher detection sensitivity compared to single proximity activation immunoPCR, demonstrating that dual proximity activation immunoPCR can suppress background signals generated by the extension reaction of proximity activation to a greater extent than single proximity activation immunoPCR.

[0109] In summary, dual proximity activation of immune LAMP can maintain a strong positive signal while effectively suppressing background interference, achieving highly sensitive and specific detection. Furthermore, this method does not require temperature cycling equipment and has a short detection procedure, demonstrating promising prospects for field applications.

[0110] The above specific embodiments are used to explain and illustrate the present invention, but not to limit the present invention. Any modifications and changes made to the present invention within the spirit and scope of the claims shall fall within the protection scope of the present invention.

[0111] The above description is only a preferred embodiment of the present invention. Therefore, all equivalent changes or modifications made to the structure, features and principles described in the claims of this patent application are included in the scope of this patent application.

[0112] The gene sequence involved in this invention is as follows: SEQ ID No.1; Name: The first DNA sequence A1 conjugated to Listeria monocytogenes antibody DNA type: other DNA Biological origin: Artificial Sequence / synthetic construct TAAAACCTCCGCATTCCTGTGACTGCTGAGGTTGGATCAGGCTACTTCAAGATGACTGATGTGTCC SEQ ID No.2; Name: Second DNA sequence A2 conjugated to Listeria monocytogenes antibody DNA type: other DNA Biological origin: Artificial Sequence / synthetic construct TCAGTCACTTCGAGTGCTCGGCCCTCCACGGGAGTGATGACAAGCATCTTCTTCCTTGAATCTAG SEQ ID No. 3; Name: First Start Strand DNA Sequence A3 DNA type: other DNA Biological origin: Artificial Sequence / synthetic construct CTTCCTTCATCTGTGCATCAGACTTTCCATTGCGGATCTTGATTTTGCCCAAGGTGTCGCTGTCAAAGGACACATCAGTCATCTTGATCTAGATTG SEQ ID No.4; Name: LAMP primer sequence F3 DNA type: other DNA Biological origin: Artificial Sequence / synthetic construct AAAACCTCCGCATTCCTG SEQ ID No. 5; Name: LAMP primer sequence B3 DNA type: other DNA Biological origin: Artificial Sequence / synthetic construct CAGTCACTTCGAGTGCTC SEQ ID No. 6; Name: LAMP primer sequence FIP DNA type: other DNA Biological origin: Artificial Sequence / synthetic construct CCAAGGTGTCGCTGTCAAAGACTGCTGAGGTTGGATCA SEQ ID No.7; Name: LAMP primer sequence BIP DNA type: other DNA Biological origin: Artificial Sequence / synthetic construct CCGCAATGGAAAGTCTGATGCCACGGGAGTGATGACAAG SEQ ID No. 8; Name: LAMP primer sequence LF DNA type: other DNA Biological origin: Artificial Sequence / synthetic construct ACATCAGTCATCTTGAAGTAGCC SEQ ID No. 9; Name: Third DNA sequence AA1 conjugated to Listeria monocytogenes antibody DNA type: other DNA Biological origin: Artificial Sequence / synthetic construct TCGCATCTGCTGTTCAGTCTCACGCTTATCACCTCAGTTATTAATCTACCGATCCAG SEQ ID No. 10; Name: Fourth DNA sequence AA2 conjugated to Listeria monocytogenes antibody DNA type: other DNA Biological origin: Artificial Sequence / synthetic construct TCTGACCGGCTGAAAGCATCACTACTTACCTACCTCTGTCACTGGATC SEQ ID No. 11; Name: Fifth DNA sequence conjugated to Listeria monocytogenes antibody AAA1 DNA type: other DNA Biological origin: Artificial Sequence / synthetic construct TGAGCGAATACTGACCGGCTGAAAGCATCACTACTGACCGACTTATAGGATGAACTG SEQ ID No. 12; Name: The sixth DNA sequence conjugated to Listeria monocytogenes antibody AAA2 DNA type: other DNA Biological origin: Artificial Sequence / synthetic construct TACATGTCGCATCTGCTGTTCAGTCTCACGTATCACCTCAGTTATTAATCTATCGATCCAG SEQ ID No. 13; Name: Second start strand DNA sequence AAA3 DNA type: other DNA Biological origin: Artificial Sequence / synthetic construct CAGTTATGTCTCGCTCAGTTCATCCTATAAGTCGGCCTCTGTCACTGGATCTCCTACT SEQ ID No. 14; Name: PCR primer sequence F for template strand DNA type: other DNA Biological origin: Artificial Sequence / synthetic construct CTGACCGGCTGAAAGCATC SEQ ID No. 15; Name: PCR primer sequence F for template strand DNA type: other DNA Biological origin: Artificial Sequence / synthetic construct ATCTGCTGTTCAGTCTCACG.

Claims

1. A method for ultrasensitive detection of proteins using dual proximity activation immuno-LAMP, characterized in that: The method includes the following steps: (1) The protein sample to be tested is added to an immune reaction system containing the initiating chain and then placed under specific temperature conditions to simultaneously carry out the immune reaction and the complementary pairing reaction of the DNA chain. (2) Add the double proximity activated extension system to the solution after the reaction in step (1), and then react it under specific temperature conditions; (3) Take the solution after the reaction in step (2) and add it to the fluorescence quantitative LAMP system. Then, place it under specific temperature conditions for reaction and finally collect the fluorescence signal. The target protein to be detected is determined by the time Tt when the threshold is reached.

2. The method for ultrasensitive detection of proteins using dual proximity activation immuno-LAMP according to claim 1, characterized in that: In step (1), the immune reaction system containing the initiating chain includes two antibody-DNA conjugates that can bind to different sites of the target protein and an initiating chain that is partially complementary to the DNA chain in one of the conjugates; the immune reaction system is placed at a constant temperature of 37°C and the reaction time is 30 minutes. The antibody-DNA conjugates include, but are not limited to: antibody-DNA conjugates prepared by copper-free click chemistry, antibody-DNA conjugates prepared by the streptavidin-biotin system, antibody-DNA conjugates prepared by sodium 4-(N-maleimidemethyl)cyclohexane-1-carboxylic acid sulfonyl succinimide ester (sulfon-SMCC), and antibody-DNA conjugates prepared by disuccinimide octanoate (DSS).

3. The method for ultrasensitive detection of proteins using dual proximity activation immuno-LAMP according to claim 1, characterized in that: The immune response system comprises: 1-100 ng each of two antibody-DNA conjugates, 50-5000 fmol of starting chain, 0.1% w / v BSA, 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 2 mM KH2PO4.

4. The method for ultrasensitive detection of proteins using dual proximity activation immuno-LAMP according to claim 1, characterized in that: In step (2), the dual proximity activation extension system contains Bst 2.0 DNA polymerase and four dNTPs. The dual proximity activation extension system is reacted for 20 minutes under a constant temperature condition in the range of 25-45℃. The concentration of Bst 2.0 DNA polymerase in the double proximity activation extension system was 0.077 U / μL. The four dNTPs were dATP, dTTP, dCTP and dGTP, and the molar concentration of each of the four dNTPs in the double proximity activation extension system was 417 μM.

5. The method for ultrasensitive detection of proteins using dual proximity activation immuno-LAMP according to claim 1, characterized in that: The dual proximity activation extension system comprises: 0.2–5 U Bst2.0 DNA polymerase, 41.7 mM Tris-HCl, 104 mM KCl, 20.8 mM (NH4)2SO4, 16.7 mM MgSO4, and 417 μM of a mixed dNTP component.

6. The method for ultrasensitive detection of proteins using dual proximity activation immuno-LAMP according to claim 1, characterized in that: In step (3), the quantitative real-time LAMP system includes Bst 2.0 DNA polymerase, LAMP primers, four dNTPs and the fluorescent dye syto-9; the LAMP amplification system is reacted at a constant temperature in the range of 61-69℃ for 40 minutes. The molar concentration of Bst DNA polymerase in the quantitative real-time LAMP system was 0.356 U / μL. The four dNTPs were dATP, dTTP, dCTP and dGTP, and the molar concentration of each of the four dNTPs in the quantitative real-time LAMP system was 222 μM.

7. The method for ultrasensitive detection of proteins using dual proximity activation immuno-LAMP according to claim 1, characterized in that: The LAMP amplification system comprises: Bst 2.0 DNA polymerase 4-16 U, Tris-HCl 22.2 mM, KCl 55.6 mM, (NH4)2SO4 11.1 mM, MgSO4 8.89 mM, dNTP mixture 222 mM, betaine 888.8 mM, outer primer F3 1-10 nmol, outer primer B3 1-10 pmol, inner primer FIP 10-100 pmol, inner primer BIP 10-100 pmol, loop primer LF 5-50 pmol, and fluorescent dye syto-9 10-100 pmol. The outer primer F3, outer primer B3, inner primer FIP, inner primer BIP, and loop primer LF are SEQ ID No. 5 to SEQ ID No. 9, respectively.

8. The method for ultrasensitive detection of proteins using dual proximity activation immuno-LAMP according to claim 1, characterized in that: In step (3), the time required for the fluorescence value to reach the fluorescence threshold automatically determined by the quantitative PCR instrument is used as the evaluation parameter for the following judgment: The obtained Tt value is substituted into the preset standard curve to calculate the content of the target protein in the sample to be tested; the standard curve is pre-established by target protein standards with known concentration gradients through the same detection process.

Images