In situ hybridization detection probes and methods of making the same

Abstract

The application discloses an in-situ hybridization detection probe and a preparation method thereof. The detection probe comprises, from 5' to 3', sequence 5, sequence 1, sequence A, sequence 3, sequence B which is complementary to sequence A, and sequence 2 which is complementary to sequence 1. The sequence 5 is used for recognizing and combining with a target nucleic acid. The length of the sequence A is greater than or equal to 20 bp, and the sequence A and the sequence B are modified with a nucleic acid marker. The in-situ hybridization detection probe prepared by the application can improve the detection signal intensity on the basis of ensuring the detection specificity, greatly improves the detection sensitivity, and is more feasible in preparation.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, and more specifically, this invention relates to an in situ hybridization detection probe and its preparation method. Background Technology

[0002] Nucleic acid quantitative detection plays a crucial role in gene diagnosis (including gene expression detection and genotyping). Currently, there are numerous gene detection technologies available, including high-throughput sequencing, qPCR, gene chips, and in situ hybridization (RNA-FISH or DNA-FISH). Among these, in situ hybridization has garnered significant attention due to its ability to provide localization information, effectively detect large-scale structural variations, and screen for abnormal cells from tens of thousands to hundreds of thousands of cells in a single test.

[0003] Currently, in situ hybridization detection probes are mainly prepared using methods such as oligonucleotide synthesis and BAC cloning templates. Probes prepared by oligonucleotide synthesis have limited sequence and fluorophore quantities, resulting in low detection sensitivity. They cannot detect low-abundance genes in RNA-FISH experiments and cannot identify short sequence structural abnormalities in DNA-FISH experiments. Probes prepared using BAC cloning templates (100-200 kb in length) with gap translation have a sufficient number of probe sequences, but because the gaps are randomly formed, the sequence types and lengths vary significantly in each experiment, failing to guarantee specificity. Probes prepared by this method can only distinguish deletion repeats of 100-200 kb in length; for fragments in the 1-100 kb range, deletion repeat rearrangement is limited by signal intensity and cannot meet the requirements. Furthermore, the excessive length of BAC cloning templates (100-200 kb) makes obtaining this template extremely difficult, greatly limiting the feasibility of preparing such probes. Summary of the Invention

[0004] Therefore, the purpose of this invention is to provide a method for preparing an in situ hybridization detection probe that simultaneously takes into account sensitivity, specificity, and cost.

[0005] The technical solutions for achieving the above-mentioned objectives include the following.

[0006] In a first aspect, the present invention provides an in situ hybridization detection probe. From 5' to 3', it includes: sequence 5, sequence 1, sequence A, sequence 3, sequence B which is complementary to sequence A, and sequence 2 which is complementary to sequence 1; Sequence 5 is used to identify and bind to the target nucleic acid; The length of sequence A is ≥20 bp, and both sequence A and sequence B are modified with nucleic acid markers.

[0007] A second aspect of the present invention provides a method for preparing the above-mentioned in situ hybridization detection probe, comprising the following steps: S1. The positive strand of fragment 1 and the positive strand of fragment 2 are synthesized and amplified by PCR to obtain fragment 1 and fragment 2; The justice chain of segment 1, from the 5' end to the 3' end, includes: sequence 5, sequence 1, sequence A, and sequence 3; the justice chain of segment 2, from the 5' end to the 3' end, includes: sequence 3, sequence B, and sequence 2. S2. Fragment 1 and fragment 2 described in step S1 are denatured and annealed, and then PCR amplified using dUTP modified with nucleic acid markers to obtain fragment 3 modified with nucleic acid markers. S3. The fragment 3 described in step S2 is denatured and annealed to obtain the in situ hybridization detection probe.

[0008] The inventors of this invention designed a specific sequence based on the target nucleic acid and added two reverse complementary nucleic acid sequences. These two nucleic acid sequences provide more sites for modifying nucleotide markers. The in situ hybridization detection probe prepared thereby can improve the detection signal intensity while ensuring detection specificity, thus greatly improving the detection sensitivity.

[0009] In addition, the present invention can simultaneously prepare multiple detection probes, and using multiple detection probes to detect target nucleic acids can further improve the detection signal intensity and realize the detection of ultra-low abundance genes.

[0010] Furthermore, the in situ hybridization detection probe of the present invention can detect the deletion or duplication of fragments with a length of 1 to 100 kb, and the probe preparation is more feasible. Attached Figure Description

[0011] Figure 1 This is a schematic diagram illustrating the principle of the in situ hybridization detection probe preparation method in this invention.

[0012] Figure 2 This is a comparison diagram of in situ hybridization detection using oligonucleotide probe (A) and probe (B) prepared in Example 1 in this invention. Detailed Implementation

[0013] To facilitate understanding of the present invention, a more complete description will be provided below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0014] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention. The term "and / or" as used in this invention includes any and all combinations of one or more of the associated listed items.

[0015] Unless otherwise specified, experimental methods in the following examples are generally performed under standard conditions or as recommended by the manufacturer. All commonly used chemical reagents used in the examples are commercially available products.

[0016] In some embodiments of the present invention, an in situ hybridization detection probe is disclosed, which includes, from 5' to 3', sequence 5, sequence 1, sequence A, sequence 3, sequence B complementary to sequence A, and sequence 2 complementary to sequence 1. Sequence 5 is used to identify and bind to the target nucleic acid; The length of sequence A is ≥20 bp, and both sequence A and sequence B are modified with nucleic acid markers.

[0017] In one embodiment, the length of sequence A is 100~5000 bp.

[0018] In one embodiment, the nucleic acid marker is biotin, digoxigenin, fluorescein, or amino.

[0019] In one embodiment, the nucleic acid marker is a fluorescein.

[0020] In other embodiments of the present invention, a method for preparing the above-mentioned in situ hybridization detection probe is disclosed, comprising the following steps: S1. The positive strand of fragment 1 and the positive strand of fragment 2 were synthesized and obtained by PCR to obtain fragment 1 and fragment 2; The justice chain of segment 1, from the 5' end to the 3' end, includes: sequence 5, sequence 1, sequence A, and sequence 3; the justice chain of segment 2, from the 5' end to the 3' end, includes: sequence 3, sequence B, and sequence 2. S2. Fragment 1 and fragment 2 described in step S1 are denatured and annealed, and then PCR amplified using dUTP modified with nucleic acid markers to obtain fragment 3 modified with nucleic acid markers. S3. The fragment 3 described in step S2 is denatured and annealed to obtain the in situ hybridization detection probe.

[0021] In one embodiment, the nucleotide sequence of the positive strand of fragment 1 in step S1 is shown in SEQ ID NO:1, and the nucleotide sequence of the positive strand of fragment 2 is shown in SEQ ID NO:2.

[0022] In one embodiment, in step S3, the PCR amplification reaction system includes: an upstream primer designed according to sequence 5, a downstream primer designed according to sequence 2, and dUTP labeled with a nucleic acid marker.

[0023] In one embodiment, in step S3, the sequence of the upstream primer is shown in SEQ ID NO:7, and the sequence of the downstream primer is shown in SEQ ID NO:8.

[0024] In one embodiment, the nucleic acid marker is biotin, digoxigenin, fluorescein, or amino.

[0025] In one embodiment, the nucleic acid marker is a fluorescein.

[0026] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0027] Example 1: Preparation of in situ hybridization detection probe This embodiment provides a method for preparing an in situ hybridization detection probe. Please refer to [link / reference]. Figure 1 Specifically, it includes the following steps: S1. PCR amplification yields fragment 1 and fragment 2. (1) The positive strand of synthetic fragment 1, the sequence of which is shown in SEQ ID NO:1, includes the following from the 5' end to the 3' end: sequence 5 (underlined part, used to recognize and bind to the target nucleic acid, in this embodiment, the target nucleic acid is U6 RNA), sequence 1 (represented by lowercase letters), sequence A (GST gene sequence, double-underlined part), and sequence 3 (represented by lowercase letters).

[0028] SEQ ID NO:1 TATCGTTCCAATTTTAGTATATGTGCTGCCGAAGC atctctagaggatccccgggtac Sequence 5 Sequence 1 CGAGCTCGAATTCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCAC ACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTG CGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGG CGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGG TATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAA GGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCA Sequence A tcacaaaaatcgacgctcaagtc Sequence 3 (2) The positive chain of the synthetic fragment 2, the sequence is shown in SEQ ID NO:2, from the 5' end to the 3' end, including: sequence 3 (represented by lowercase letters), sequence B (complementary to sequence A, double-underlined part), and sequence 2 (complementary to sequence 1, represented by lowercase letters).

[0029] SEQ ID NO:2 tcacaaaaatcgacgctcaagtc Sequence 3 TGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTT TGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTG AGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATAC GCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGC AGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCG TATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGAATTCGAGCTCG Sequence B gtacccggggatcctctagagat Sequence 2 (3) The positive strands of fragment 1 and fragment 2 were amplified by PCR to obtain fragment 1 (double strand) and fragment 2 (double strand). The antisense strand of fragment 1 consists of: sequence 4 (complementary to sequence 3), sequence B (complementary to sequence A), sequence 2 (complementary to sequence 1), and sequence 6 (complementary to sequence 5); the antisense strand of fragment 2 consists of: sequence 1 (complementary to sequence 2), sequence A (complementary to sequence B), and sequence 4 (complementary to sequence 3).

[0030] The PCR amplification reaction system was as follows: 2 μL upstream primer, 2 μL downstream primer, 25 μL PCR mix, 1 μL Fluorescein-12-dUTP (R010, Thermo Fisher Scientific), 1 μL template, and finally ddH2O to a final volume of 50 μL. The primers for amplifying fragment 1 included SEQ ID NO:3 and SEQ ID NO:4, and the primers for amplifying fragment 2 included SEQ ID NO:5 and SEQ ID NO:6.

[0031] SEQ ID NO:3: tatcgttccaattttagtatatgtgctgccgaagc atctctagaggatccccgggtac SEQ ID NO:4: gacttgagcgtcgatttttgtga SEQ ID NO:5:tcacaaaaatcgacgctcaagtc SEQ ID NO:6:atctctagaggatccccgggtac The PCR amplification reaction program was: 95℃ for 5 min; 95℃ for 5 min, 60℃ for 20 s, 72℃ for 3 min, for 30 cycles.

[0032] S2, denaturation, annealing, PCR amplification, to obtain fragment 3 After denaturation and annealing, the sense strand of fragment 1 and the antisense strand of fragment 2 are paired with complementary bases at their ends, sequence 3 and sequence 4. Then, DNA polymerase and fluorescein-labeled dUTP are used for PCR amplification to obtain fragment 3, which is modified with fluorescein and is a full-length sequence.

[0033] Reaction system: 100 ng each of fragment 1 and fragment 2, 1 μL of 10 μM upstream primer (TATCGTTCCAATTTTAGTATATGTGCTGCCGAAGC, SEQ ID NO:7), 1 μL of 10 μM downstream primer (atctctagaggatccccgggtac, SEQ ID NO:8), 0.3 μL of Fluorescein-12-dUTP (R010, Thermo Fisher Scientific), 10 μL of 2×PCR mix, and ddH2O to bring the volume to 20 μL.

[0034] The reaction program was as follows: 95℃ for 5 min; 95℃ for 10 s, 60℃ for 20 s, 72℃ for 45 s, for 45 cycles.

[0035] S3, denaturation, annealing, to obtain probe 1 and probe 2. Fragment 3 was denatured and annealed to obtain probe 1 and probe 2. Among them, Probe 1 consists of the following sequences in sequence: Sequence 5 (single-stranded structure), Sequence 1, Sequence A, Sequence 3 (stem-loop structure), Sequence B, and Sequence 2; Sequences A and B are complementary, Sequences 1 and 2 are complementary, Sequence 3 is suspended as a stem-loop, and Sequence 5 is used for downstream hybridization detection; Probe 2 consists of the following sequences: Sequence 1, Sequence A, Sequence 4 (stem-loop structure), Sequence B, Sequence 2, and Sequence 6 (single-stranded structure). Sequences A and B are complementary, Sequences 1 and 2 are complementary, and Sequence 4 is suspended as a stem-loop. Since Sequence 6 does not bind to the target nucleic acid, it is not used for downstream hybridization detection.

[0036] Example 2 uses the probe prepared in Example 1 to perform in situ hybridization detection of the target nucleic acid. Using probe 1 prepared in Example 1, U6 RNA in situ hybridization was performed, with an oligonucleotide probe (sequence 5 only, labeled with one fluorophore) as a control. The results are as follows: Figure 2 As shown in A and B in the diagram.

[0037] from Figure 2As can be seen, the probe 1 prepared in this invention extends a sequence of about 1000 bp (including sequence 1, sequence A, sequence 3, sequence B and sequence 2) on the basis of sequence 5 used to recognize and bind target nucleic acids. Therefore, the amount of fluorescein labeled on probe 1 is greatly increased, which makes its detection signal significantly improved compared with oligonucleotide probes (the detection signal is improved by 100 times based on a labeling efficiency of 2%).

[0038] Furthermore, the present invention can further amplify the detection signal by adjusting the total length of Sequence 1, Sequence A, Sequence 3, Sequence B and Sequence 2, thereby enabling the detection of ultra-low abundance genes.

[0039] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0040] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. An in situ hybridization detection probe, characterized in that, From 5' to 3', it includes: sequence 5, sequence 1, sequence A, sequence 3, sequence B which is complementary to sequence A, and sequence 2 which is complementary to sequence 1; Sequence 5 is used to identify and bind to the target nucleic acid; The length of sequence A is ≥20 bp, and both sequence A and sequence B are modified with nucleic acid markers.

2. The in situ hybridization detection probe according to claim 1, characterized in that, The length of sequence A is 100~5000 bp.

3. The in situ hybridization detection probe according to claim 1, characterized in that, The nucleic acid marker is biotin, digoxigenin, fluorescein, or amino acid.

4. The in situ hybridization detection probe according to claim 3, characterized in that, The nucleic acid marker is fluorescein.

5. A method for preparing the in situ hybridization detection probe according to any one of claims 1 to 4, characterized in that, Includes the following steps: S1. The positive strand of fragment 1 and the positive strand of fragment 2 are synthesized and amplified by PCR to obtain double-stranded fragments 1 and 2. The justice chain of segment 1, from the 5' end to the 3' end, includes: sequence 5, sequence 1, sequence A, and sequence 3; the justice chain of segment 2, from the 5' end to the 3' end, includes: sequence 3, sequence B, and sequence 2. S2. Fragment 1 and fragment 2 described in step S1 are denatured and annealed, and then PCR amplified using dUTP modified with nucleic acid markers to obtain fragment 3 modified with nucleic acid markers. S3. The fragment 3 described in step S2 is denatured and annealed to obtain the in situ hybridization detection probe.

6. The method for preparing the in situ hybridization detection probe according to claim 5, characterized in that, The nucleotide sequence of the positive strand of fragment 1 in step S1 is shown in SEQ ID NO:1, and the nucleotide sequence of the positive strand of fragment 2 is shown in SEQ ID NO:

2.

7. The method for preparing the in situ hybridization detection probe according to claim 5, characterized in that, In step S3, the PCR amplification reaction system includes: an upstream primer designed according to sequence 5, a downstream primer designed according to sequence 2, and dUTP labeled with a nucleic acid marker.

8. The method for preparing the in situ hybridization detection probe according to claim 7, characterized in that, In step S3, the sequence of the upstream primer is shown in SEQ ID NO:7, and the sequence of the downstream primer is shown in SEQ ID NO:

8.

9. The method for preparing the in situ hybridization detection probe according to claim 5, characterized in that, The nucleic acid marker is biotin, digoxigenin, fluorescein, or amino acid.

10. The method for preparing the in situ hybridization detection probe according to claim 9, characterized in that, The nucleic acid marker is fluorescein.

Images