Use of a substance for detecting ddx24 in the preparation of a tongue squamous cell carcinoma detection product

CN122833167APending Publication Date: 2026-09-29SHANGHAI FIRST PEOPLES HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202611059619.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-07-16
Publication Date
2026-09-29

AI Technical Summary

Technical Problem

[0004]本发明的目的是解决TSCC发病的原因尚不明确的问题,提供一种用于检测DDX24的物质在制备舌鳞癌检测产品中的应用

Benefits of technology

本发明首次证明DDX24表达随舌鳞癌恶性程度的增加而增加,干扰DDX24表达后抑制了舌鳞癌细胞的增殖,DDX24可作为一种有效的标志物用于诊断、检测舌鳞癌,对于舌鳞癌的研究、治疗具有重要的意义。同时也为开发高效的治疗舌鳞癌相关药物奠定实验基础并提供新的视野,具有良好的实际应用价值。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122833167A_ABST
    Figure CN122833167A_ABST
Patent Text Reader

Abstract

This invention discloses the application of a substance for detecting DDX24 in the preparation of a tongue squamous cell carcinoma detection product. The substance for detecting DDX24 includes a substance for detecting the expression level of the DDX24 gene or DDX24 protein. This invention demonstrates for the first time that DDX24 expression increases with the malignancy of tongue squamous cell carcinoma, and that interfering with DDX24 expression inhibits the proliferation of tongue squamous cell carcinoma cells. DDX24 can serve as an effective biomarker for the diagnosis and detection of tongue squamous cell carcinoma, which is of great significance for the research and treatment of tongue squamous cell carcinoma. It also lays an experimental foundation and provides new insights for the development of highly effective drugs for the treatment of tongue squamous cell carcinoma, and has good practical application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of pharmacomedicine and molecular biology, specifically to the application of a substance used to detect DDX24 in the preparation of a tongue squamous cell carcinoma detection product. Background Technology

[0002] Tongue squamous cell carcinoma (TSCC) is one of the most common malignant tumors of the oral and maxillofacial region. Due to the rich blood supply and frequent movement of the tongue, it is highly occult, has a high rate of early lymph node metastasis, and postoperative recurrence. Although researchers have successively discovered that several oncogenes are involved in the occurrence and development of TSCC, the cause of TSCC remains unclear to date.

[0003] The DDX24 gene is located on region 32 of the long arm of chromosome 14 and is widely distributed in various tissues of the human body. Previously, DDX24 was considered a member of the DEAD-box family, the largest member of the non-circular superfamily of 2-helicases, possessing ATP-dependent RNA helicase activity and RNA-dependent ATPase activity, participating in translation initiation and post-translational modifications to regulate cellular physiological activities. However, to date, there have been no reports of its use in detecting the pathogenesis of tongue squamous cell carcinoma. Summary of the Invention

[0004] The purpose of this invention is to address the problem that the cause of TSCC is still unclear, and to provide an application of a substance for detecting DDX24 in the preparation of a tongue squamous cell carcinoma detection product.

[0005] Optionally, the substance for detecting DDX24 includes a substance for detecting the expression level of the DDX24 gene or DDX24 protein, wherein the substance for detecting the expression level of the DDX24 gene includes primers for amplifying the DDX24 gene used in real-time quantitative PCR, with sequences as shown in SEQ ID NO. 1 and SEQ ID NO. 2.

[0006] Optionally, the product may include a product capable of detecting the expression level of the DDX24 gene or DDX24 protein.

[0007] The present invention also provides the use of substances that inhibit DDX24 expression in the preparation of products for treating tongue squamous cell carcinoma, wherein the substances that inhibit DDX24 expression include at least one of RNA interference molecules targeting DDX24, antisense oligonucleotides, and small molecule inhibitors.

[0008] Optionally, the RNA interference molecule targeting DDX24 is shRNA, and its targeting sequence is shown in SEQ ID NO. 3, SEQ ID NO. 4 and / or SEQ ID NO. 5.

[0009] Optionally, the product for treating tongue squamous cell carcinoma may include at least one of the following functions: inhibiting the proliferation of tongue squamous cell carcinoma cells, inhibiting the malignant invasion of tongue squamous cell carcinoma cells, and reducing the promoting effect of lactic acid on the proliferation of tongue squamous cell carcinoma.

[0010] The present invention also provides the application of lactolyzed DDX24 protein as a target in the preparation of tongue squamous cell carcinoma detection products, wherein the lactolyzed site is lysine 835 of the DDX24 protein.

[0011] Compared with the prior art, the beneficial effects of the present invention are: This invention is the first to demonstrate that DDX24 expression increases with the malignancy of tongue squamous cell carcinoma, and that interfering with DDX24 expression inhibits the proliferation of tongue squamous cell carcinoma cells. DDX24 can serve as an effective biomarker for the diagnosis and detection of tongue squamous cell carcinoma, which is of great significance for the research and treatment of this cancer. It also lays an experimental foundation and provides new insights for the development of highly effective drugs for the treatment of tongue squamous cell carcinoma, possessing good practical application value. Attached Figure Description

[0012] Figure 1 In tongue squamous cell carcinoma, lactic acid promotes L-lactation of DDX24 K835; A represents the difference in DDX24 expression in tongue squamous cell carcinoma and its paired adjacent tissues and at different stages, characterized by tissue chip analysis (n=35; Wilcoxon paired signed-rank test or one-way ANOVA); scale: 400µm; Figure B shows the effect of gradient concentrations of LA on the viability of Cal27 and SCC4 cells (n=5). C represents the effect of gradient concentrations of LA on DDX24 expression (n=3); D is the result of the effect of gradient concentration of LA on L-lactation of DDX24 (n=3) (one / two-way ANOVA); E is a schematic diagram of the post-translational modifications of the DDX24 amino acid residues; F shows the effect of the K835 mutation on DDX24 expression. G is the result of the effect of K835 mutation on L-lactation of DDX24 (n=3; t test).

[0013] Figure 2 The malignant phenotype of TSCC induced by DDX24 knockdown limiting lactate (LA) is shown in the figure. In the figure, the Con group is the group of normally cultured Cal27 cells, the LA group is the group of Cal27 cells cultured with 20 mM LA added to the culture medium, and the LA+sh-DDX24 group is the group of Cal27 cells with DDX24 knockdown cultured with 20 mM LA added to the culture medium. Figure A shows the effect of 20 mM LA and DDX24 knockdown on Cal27 cell viability (12-72h). Figure B shows the effect of 20 mM LA and DDX24 knockdown on the cell cycle of Cal27 cells (48h). The effect of 20 mM LA and DDX24 knockdown on the number of invasive Cal27 cells (48h). The effect of D=20 mM LA and DDX24 knockdown on the wound healing rate of Cal27 cells (12h and 48h, n=5, one / two-way ANOVA). E represents representative gel blot images of DDX24 and EMT-related proteins (N-cadherin, E-cadherin, ZO-1) and their differences in the Con, LA, and LA+sh-DDX24 groups (n=3; one-way ANOVA or H test). F shows representative gel blot images of glycolysis-related proteins (HK2, PKM2, LDHA) and their differences in the Con, LA, and LA+sh-DDX24 groups (n=3; one-way ANOVA or H test). G represents the differences in ECAR and PER in Cal27 cells from the Con, LA, and LA+sh-DDX24 groups, characterized by the Seahorse assay (n=4; one / two-way ANOVA).

[0014] Figure 3 The malignant phenotype of TSCC induced by DDX24 knockdown and lactate (LA) restriction is shown in the figure. In the figure, the Con group is the group of normally cultured SCC4 cells, the LA group is the group of SCC4 cells cultured with 20 mM LA in the culture medium, and the LA+sh-DDX24 group is the group of SCC4 cells with DDX24 knockdown cultured with 20 mM LA in the culture medium. Figure A shows the effect of 20 mM LA and DDX24 knockdown on SCC4 cell viability (12-72h). Figure B shows the effect of 20 mM LA and DDX24 knockdown on the SCC4 cell cycle (48h). The effect of C=20 mM LA and DDX24 knockdown on the number of SCC4 invasive cells (48h). The effect of D=20 mM LA and DDX24 knockdown on the wound healing rate of SCC4 cells (12h and 48h, n=5, one / two-way ANOVA). E represents representative gel blot images of DDX24 and EMT-related proteins (N-cadherin, E-cadherin, ZO-1) and their differences in the Con, LA, and LA+sh-DDX24 groups (n=3; one-way ANOVA or H test). F shows representative gel blot images of glycolysis-related proteins (HK2, PKM2, LDHA) and their differences in the Con, LA, and LA+sh-DDX24 groups (n=3; one-way ANOVA or H test).

[0015] Figure 4 The result of adding TSCC load to DDX24; A shows representative images of Cal27-related subcutaneous tumor models and tumors; B represents the volume and mass difference analysis of the subcutaneous tumor model related to Cal27 (n=5; t test or two-way ANOVA). C represents representative IHC staining images of DDX24, Ki-67, HK2, PKM2, and LDHA (n=5). Scale: 150 µm.

[0016] Figure 5 The result of adding TSCC load to DDX24; A shows representative images of SCC4-related subcutaneous tumor models and tumors; B represents the volume and mass difference analysis of SCC4-related subcutaneous tumor models (n=5; t test or two-way ANOVA). C represents representative IHC staining images of DDX24, Ki-67, HK2, PKM2, and LDHA (n=5). Scale: 150 µm. Detailed Implementation

[0017] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0018] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the exemplary embodiments according to this application. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof. Experimental methods in the following specific embodiments, unless specific conditions are specified, are generally performed according to conventional methods and conditions in molecular biology within the art, which are fully explained in the literature. See, for example, the techniques and conditions described in *Molecular Cloning: A Laboratory Manual* by Sambrook et al., or according to the conditions recommended by the manufacturer.

[0019] This invention unexpectedly revealed that DDX24 expression in tongue squamous cell carcinoma is significantly higher than in normal tissue, suggesting that DDX24 plays a role in the progression of human tongue squamous cell carcinoma. Furthermore, interfering with DDX24 expression inhibited the proliferation of tongue squamous cell carcinoma cells. Therefore, DDX24 can serve as a novel diagnostic and detection biomarker for tongue squamous cell carcinoma, which is of significant importance for the research and treatment of this disease.

[0020] In view of this, in one specific embodiment of the present invention, the use of a substance for detecting DDX24 in the preparation of a tongue squamous cell carcinoma detection product is provided.

[0021] In another specific embodiment of the present invention, the substances for detecting DDX24 include, but are not limited to, substances used for detecting the expression level of DDX24 by RT-PCR, real-time quantitative PCR, in situ hybridization, gene chip and gene sequencing.

[0022] In another specific embodiment of the present invention, the product includes, but is not limited to, primers, probes, chips, nucleic acid membrane strips, preparations or kits for detecting the expression level of DDX24 in the sample to be tested.

[0023] The following examples further illustrate the present invention, but do not constitute a limitation thereof. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the invention.

[0024] Example I. Materials and Methods 1. Experimental Materials 1.1 Genetic Information 1.2 Cell Information CAL27 cells were purchased from Wuhan Procell Biotechnology Co., Ltd., and SCC4 cells, 293T cells, and Stbl3 cells were purchased from Beijing BNCC Biotechnology Co., Ltd.

[0025] 2. Experimental Methods 2.1 Tissue chip analysis TSCC tissue chips were purchased from Servicebio (#GDP1002, China). TSCC tissue chips and 5µm thick tumor tissue sections underwent antigen retrieval (25 min), endogenous peroxidase blockade (30 min), circling, and blocking (60 min) sequentially using 1×Tris-EDTA antigen retrieval solution (#G1218, Servicebio), 3% hydrogen peroxide, PAP Pen (#G6100), and 5% goat serum (#G1208). After antibody conjugation, tissue chips and sections were sequentially developed, counterstained, mounted, and scanned using DAB (#G1212), hematoxylin (#G1004), neutral resin (#WG10004160, Servicebio), and a digital slide scanning system (WINMEDIC, China). The antibody sources for the target protein are shown in Table 2. 2.2 CCK8 proliferation analysis TSCC cells digested by trypsin (8×10) 3 TSCC cells / wells were seeded in 96-well plates and cultured for 12, 24, 48, and 72 hours, respectively. Following the CCK8 Kit instructions (#CK04, DOJINDO, Japan), the optical density of TSCC cells at 450 nm at each time point was measured using a Microplate reader (#SpectraMax 190, MolecularDevices, US).

[0026] 2.3 Western Blotting Analysis TSCC cells underwent protein extraction and concentration determination using RIPA lysis buffer (#PR20035, Proteintech, China) and a spectrophotometer (#GENESYS 40 / 50 Vis / UV-Vis, Thermo, US). After SDS-PAGE electrophoresis, samples were transferred to PVDF membranes at 200 mA and then blocked with skimmed milk powder for 1 h. Following antibody incubation, the PVDF membranes were developed using ECL Substrate (#32209, Thermo), followed by exposure and image acquisition using a chemiluminescence analyzer (#Luminoskan Ascent, Thermo).

[0027] 2.4 Co-IP Analysis Cal27 cells were randomly divided into Input, IgG, and IB samples, and then lysed for 30 min using Co-IP lysis buffer (#PR20037, Proteintech) to extract proteins. IgG and IB samples were incubated sequentially with 2 µL of IP-grade rabbit anti-DDX24pAb (#15769-1-AP, Proteintech), rabbit anti-Pan-Kla mAb (#PTM-1401, PTMBio, China), and rabbit anti-IgG (#30000-0-AP, Proteintech), and 20 µL of protein A / G beads (#PR40025, Proteintech). As previously described, the expression of DDX24 and Pan-Kla was detected by Western blotting.

[0028] 2.5 Mass Spectrometry Analysis Cal27 cells were used to extract proteins using a lysis buffer containing a protease inhibitor cocktail, TSA, NAM, and urea. For L-Lactylation proteomics, an additional 50 mM nicotinamide (#383619, Sigma, US) was added to the lysis buffer. After BCA quantification, equal volumes of protein were digested and desalted sequentially using trypsin (V5117, Promega, US) and a Strata X SPE column (#KS0-9529; Phenomenex, US). L-Lactylation proteomics samples were affinity enriched using anti-L-Lactyllysine conjugated agarose beads (#PTM-1404, PTMBio) followed by desalting using C18 ZipTips (#Z720038, Sigma). Samples were analyzed by timsTOF HT / Pro mass spectrometer (Bruker, USA). The raw data were based on human reference protein sequences from the UniProt database, obtained through a database search using Spectronaut software (v.18; Biognosys, US).

[0029] 2.6 Construction of DDX24 K835 Lactation-Deficient Cell Line 2.6.1 Constructing a plasmid with the DDX24 K835 mutation: Two pairs of amplification primers were designed based on the DDX24 CDS sequence to amplify two target fragments containing the K835R mutation site (fragment 1: 2543 bp; fragment 2: 114 bp).

[0030] SEQ ID NO. 17: Forward primer for fragment 1: GCCGCGAATTCGAAGTATACCTCGAGGCCACCATGAAGTTGAAGGACACAAAAT SEQ ID NO. 18: Fragment 1 reverse primer: CTTCTGCCTGGAGAGACAGCTCAAAGCAGACTCG SEQ ID NO. 19: Fragment 2 forward primer: GCTGTCTCTCCAGGCAGAAGAAGAAGAAGACAAAGAAGCCGA SEQ ID NO. 20: Fragment 2 reverse primer: CACCGTCATGGTCTTTGTAGTCGGATCCATTTGCACTTGTACTTGGCTGTGGCT Simultaneously, the vector PGMLV-CMV-MCS-3×Flag-PGK-Puro was linearized by double digestion using XhoI and BamHI restriction sites. Two DDX24 mutant fragments were obtained by PCR amplification. Using a seamless cloning method, the two fragments were ligated into the linearized vector in one step to obtain the lentiviral plasmid PGMLV-DDX24-K835R-3×Flag, which lacks the DDX24 K835R (lysine→arginine) lactation modification deletion.

[0031] 2.6.2 Construction of DDX24 K835 cell line lacking lactation site Seed 293T cells in 10cm culture dishes and wait for cell confluence to reach 70-80%. Dissolve the target plasmid (PGMLV-DDX24-K835R-3×Flag): packaging plasmid pMD2.G (VSV-G shell) and psPAX2 (packaging backbone) in 1.5ml of opti-mem medium at a ratio of 4:1:3. Separately, dissolve 72μl of PEI reagent in 1.5ml of opti-mem medium. After standing for 5 min, mix the two solutions and let stand for 15 min before adding them to the 293T cells. After 48 hours, the viral supernatant was collected, filtered through a 0.22 μm filter, and added to Cal27 cells. After 12-16 hours, the culture medium was replaced with fresh medium. After 48 hours of culture, puromycin (Solepro, P8230) was added to screen for stable expression cell lines. The lactation modification level of DDX24 K835 was detected by Western blotting.

[0032] 2.7 Construction of DDX24 overexpressing cells Homologous recombination technology was used to insert the coding region (CDS) of the human DDX24 gene into the lentiviral expression vector PGMLV-CMV-MCS-EF1-mScarlet-T2A-Puro. After linearization by double digestion with BamHI and XhoI, the vector was ligated with the PCR amplification product containing the homologous arm at the end of the vector. Positive clones were screened after transformation, and clones that were verified by sequencing were the successfully constructed overexpression lentiviral plasmids.

[0033] 2.7.1 Primer Design SEQ ID NO. 21: Overexpression of DDX24-F: GCGAATTCGAAGTATACCTCGAGGCCACCATGAAGTTGAAGGACACAAAATCA SEQ ID NO. 22: Overexpression of DDX24-R: CGATCCTTGGATCCTCATTAATTTGCACTTGTACTTGGCTGT 2.7.2 Double Enzyme Digestion and Recovery of the Vector Take 1 µg of freshly extracted plasmid and double-digest it with the corresponding restriction endonuclease. The digestion system is as follows: 1 µg vector, 5 µL green buffer, 2 µL XhoI, 2 µL BamHI, and bring the volume to 50 µL with ddH2O. Digest at 37℃ for approximately 3 hours. After digestion, perform agarose gel electrophoresis on the digested products. After electrophoresis, perform gel recovery: Under UV light, cut off the gel strip containing the target fragment, weigh the total weight using a balance, and subtract the weight of the empty tube to calculate the gel weight. Calculate the gel volume based on 100 mg equaling 100 µL, and add one gel volume of Binging Solution. Place the tube in a 65℃ water bath to completely dissolve the gel, shaking the EP tube occasionally to accelerate dissolution. Transfer all the liquid to a filter column and centrifuge at 13000 rpm for 30 seconds. This process can be repeated once to improve recovery efficiency. After discarding the liquid in the tube, add 500 µL of WASolution to the column and centrifuge at 13000 rpm for 30 seconds. Discard the liquid in the tube again, add another 500 µL of Wash Solution, and centrifuge at 13000 rpm for 30 seconds. This process can be repeated once. Then, centrifuge for 3 minutes to remove any residual liquid. Place the filter column in a new 1.5 mL EP tube and allow it to air dry at room temperature. Finally, add 35 µL of ddH2O to the column, let it stand for 5 minutes, and centrifuge at 13000 rpm for 1.5 minutes. To improve the recovery rate, the dissolved DNA can be added back to the column and centrifuged for one minute. Discard the column; the recovered vector fragment is now available. Determine its concentration.

[0034] 2.7.3 Amplification of the target fragment The synthesized primers were diluted to a final concentration of 10 µmol / L. PCR amplification was performed using the diluted primers and the template provided by the customer. The PCR system was as follows: 10 ng template, 2 µL Primer-F, 2 µL Primer-R, 25 µL PCR mix, and ddH2O to a final volume of 50 µL. The above materials were added to thin-walled tubes, mixed thoroughly, and then placed in a PCR instrument. Appropriate annealing and extension temperatures were set according to the primer characteristics, and PCR amplification began. After PCR, agarose gel electrophoresis was performed to verify the amplified products, and the target gene was recovered using the same method as above.

[0035] 2.7.4 Conjugation of the carrier and the target fragment A seamless cloning method was used to ligate the target fragment and the vector. First, the concentrations of the recovered vector and target fragment were determined. This was based on the Hieff Clone method. TMThe optimal amount of cloning vector used in the recombinant reaction system is 0.03 pmol, and the optimal molar ratio of cloning vector to insert fragment is 1:2, meaning the optimal amount of insert fragment is 0.06 pmol. The DNA mass corresponding to these molar amounts can be calculated using the following formulas: the optimal amount of cloning vector equals 0.02 multiplied by the number of base pairs in the cloning vector, in ng; the optimal amount of insert fragment equals 0.04 multiplied by the number of base pairs in the insert fragment, in ng. The ligation system is as follows: ddH2O to a final volume of 20 µL, 5×CE Buffer 4 µL, linearized cloning vector 50–200 ng, insert fragment amplification product 20–200 ng, and Exnase 2 µL. After mixing the above components thoroughly, ligation is performed at 50 °C for 20 minutes.

[0036] 2.7.5 Conversion After thawing competent cells on ice, add 10 µL of ligation product to the competent cells and incubate on ice for 30 minutes. Then, heat shock in a 42°C water bath for 90 seconds, followed by immediate incubation on ice for 2–3 minutes. Add 500 µL of antibiotic-free SOC medium and incubate at 37°C with shaking at 225 rpm for 45 minutes to reactivate the cells. After reactivation, centrifuge at 3000 rpm for 2 minutes, discard 900 µL of supernatant, and disperse the bacterial culture at the bottom of the tube by pipetting. Add the culture to a culture plate containing the appropriate antibiotic (such as ampicillin or kanamycin), spread evenly using a sterile spreader (ensuring the spreader is not too hot to avoid killing the cells), and incubate inverted at 37°C overnight. The next day, pick single colonies for further identification.

[0037] DDX24 overexpression vector was obtained. The DDX24 overexpression vector was then packaged and titrated with lentivirus. The lentivirus-packaged vector was transfected into CAL27 cells. After 72 hours, single clones were sorted from the polyclonal cell pool using flow cytometry based on parameters such as cell size, complexity of intracellular contents, and the fluorescent dyes present in the cells. These single clones were then verified by real-time quantitative PCR.

[0038] 2.8 Construction of DDX24 knockdown cells One negative control and three shRNA oligos were designed and synthesized. These were then paired via annealing to generate double-stranded shRNA oligos. The double-stranded shRNA oligos were inserted into the pGMLV-SC5RNAi vector to construct the shRNA recombinant plasmid. This plasmid was transformed into competent Stbl3 cells, and a single colony was picked for culture. The plasmid was extracted, and positive results were confirmed by sequencing. The specific steps are as follows: 2.8.1 shRNA Target Sequence SEQ ID NO. 3: DDX24 shRNA-1 target sequence: GCTGGATATTCCTAAA GTCCA SEQ ID NO. 4: DDX24 shRNA-2 targeting sequence: GCATGCCTGTATGCACC AGAA SEQ ID NO. 5: DDX24 shRNA-3 target sequence: GCTCAGAAACCTGG AGCAGTT SEQ ID NO. 6: NC shRNA targeting sequence: TTCTCCGAACGTGTCACGT 2.8.2 shRNA primer design Based on the DDX24 gene sequence, one negative control and three shRNA oligostrahlungs were designed and synthesized. The oligo sequences are (5' to 3' of the oligostrahlung DNA sequence): SEQ ID NO.7: Primer-NC-T:GATCTGTTCTCCGAACGTGTCACGTTT CAAGAGAACGTGACACGTTCGGAGAATTTTTTC SEQ ID NO.8: Primer-NC-B: AATTGAAAAAATTCTCCGAA CGTGTCACGTTCTCTTGAAACGTGACACGTTCGGAGAACA SEQ ID NO.9: Primer-T1:GATCCGCTGGATATTCCTAAAGTCC ACTCGAGTGGACTTTAGGAATATCCAGCTTTTTT SEQ ID NO.10: Primer-B1: AATTAAAAAAGCTGGATATTCCTAAA GTCCACTCGAGTGGACTTTAGGAATATCCAGCG SEQ ID NO.11: Primer-T2:GATCCGCATGCCTGTATGCACCAGAA CTCGAGTTCTGGTGCATACAGGCATGCTTTTTT SEQ ID NO.12: Primer-B2: AATTAAAAAAGCATGCCTGTATGCACC AGAACTCGAGTTCTGGTGCATACAGGCATGCG SEQ ID NO.13: Primer-T3:GATCCGCTCAGAAACCTGGAGCAGTT CTCGAGAACTGCTCCAGGTTTTGAGCTTTTTT SEQ ID NO.14: Primer-B3: AATTAAAAAAGCTCAGAAAACCTGG AGCAGTTCTCGAGAACTGCTCCAGGTTTCTGAGCG 2.8.3 Annealing of shRNA Dilute the primers with sterile TE buffer to a final concentration of 100 µmol. Mix 10 µl of each of the forward and reverse primers, pipette to mix thoroughly, and transfer to a PCR tube for annealing. The annealing program is: 95℃ for 30 s, 72℃ for 2 min, 37℃ for 2 min, and 25℃ for 2 min. After annealing, place on ice for 5 minutes before direct ligation or freeze at -20℃.

[0039] 2.8.4 Enzyme digestion and recovery of shRNA vector The enzyme digestion system was as follows: shRNA vector 5 μg, 10×Buffer 5 μl, BamHI 2 μl, EcoRI 2 μl, and ddH2O to a final volume of 50 μl. Digestion was performed at 37℃ for approximately 30 min. During this time, a 0.8% agarose gel was prepared, and nucleic acid electrophoresis was performed after digestion. After electrophoresis, the gel strip containing the target fragment was cut off. The total weight of the gel was calculated by weighing the gel and subtracting the weight of the empty tube. The gel volume was calculated based on approximately 100 mg to 100 μl, and one gel volume of Binging Solution was added. The gel was then placed in a 65℃ water bath to completely dissolve the gel. The EP tube was gently shaken during this process to accelerate gel dissolution. All the liquid was transferred to a filter column and centrifuged at 13000 rpm for 30 s (this step can be repeated once). The liquid in the tube was then discarded, and 500 μL of WASolution was added to the column. The column was then centrifuged at 13000 rpm for 30 s. Discard the liquid in the tube, then add 500 μL of Wash Solution to the column and centrifuge at 13000 rpm for 30 seconds (this can be repeated once). Then centrifuge for 3 minutes. Place the filter column in a new 1.5 mL EP tube and allow it to air dry at room temperature. Finally, add 35 μL of ddH2O to the column, let it stand for 5 minutes, and then centrifuge at 13000 rpm for 1.5 minutes. To improve the recovery rate, add the dissolved DNA back into the column and centrifuge for one minute. Discard the column; this is the recovered vector fragment. Determine its concentration.

[0040] The recovered vectors were then ligated with the shRNAs (sh-NC, sh-DDX24) from step 2.8.2 and transformed into competent cells. Positive clones were identified by sequencing to obtain the DDX24 knockdown vector. The DDX24 knockdown vector was then packaged and titrated with lentivirus. The lentivirus-packaged vectors were transfected into CAL27 cells. After 72 hours, single clones were sorted from the polyclonal cell pool using flow cytometry based on parameters such as cell size, complexity of intracellular contents, and fluorescent dyes present in the cells. These single clones were then verified by reverse transcription-real-time quantitative PCR.

[0041] 2.8.5 Reverse transcription-real-time quantitative PCR (RT-qPCR) The target gene mRNA sequence for the corresponding species was found on PubMed, and primers were designed using the CDS sequence. Primers were designed using BeaconDesigner 7.90, and the primer sequences are as follows (Note: F represents the forward primer; R represents the reverse primer). SEQ ID NO.1:DDX24-F:AATGGAAGGAAGTGAAGA SEQ ID NO.2:DDX24-R:CAACTGGTAATCTGTCAAT SEQ ID NO.15:GAPDH-F:TTGCCCTCCAACGACCACTTT SEQ ID NO.16: GAPDH-R: TGGTCCAGGGGTCTTACTCC Total RNA extraction: Wash cells twice with PBS, remove the PBS completely, add 500 μL of TRIZOL lysis buffer to each tube of cells, mix well by pipetting, transfer to 1.5 ml EP tubes, and continue lysis for 15 min in an ice bath.

[0042] Add 100 μl of chloroform, shake vigorously for 10-15 s, denature at 4°C in the dark for 15 min, centrifuge at 12000 r / min at 4°C for 15 min in a frozen centrifuge. The liquid in the tube will separate into three layers. Take the supernatant from the top layer. Transfer the supernatant to a new EP tube, add an equal volume of isopropanol, shake for 10-15 s, let stand at -20°C for 30 min, centrifuge at 12000 r / min at 4°C for 8 min (a transparent gelatinous precipitate will be visible at the bottom of the tube), and then discard the supernatant.

[0043] Add 0.5 ml of pre-cooled 75% ethanol (prepared with DEPC-treated water) to wash the RNA. Gently vortex a few times, then centrifuge at 12000 rpm for 5 min at 4°C and discard the supernatant. After discarding the supernatant, keep the EP tube opening downwards and blot the ethanol from the tube opening as dry as possible on filter paper.

[0044] Add 20 µl of DEPC-treated water to dissolve the RNA. After repeated pipetting, take 1 µl to measure the RNA concentration. Calculate the required total RNA volume for RT: Based on the assumption that 2 µg of total RNA sample is needed to synthesize 20 µl of cDNA, calculate the required total RNA volume using the following formula: The total RNA volume required for reverse transcription = 2 µg / measured RNA concentration.

[0045] RNA reverse transcription to synthesize the first strand of cDNA: Synthesize the first strand of cDNA according to the FastKing RT Kit (With gDNase) FastKing cDNA First Strand Synthesis Kit instructions. Add the following reactants to the PCR tube in the following order (operate on ice): the calculated volume of RNA sample above, 2 µL of 5×gDNA Buffer, and 10 µL of RNase-Free ddH2O. Gently vortex, centrifuge for 3-5 s to mix the reactants, and incubate at 42°C for 3 min.

[0046] The following reactants were added to an ice bath: 2 µl of 10×King RT Buffer, 1 µl of Fastking RT Enzyme Mix, 2 µl of FQ-RT Primer Mix, and 5 µl of RNase-Free ddH2O, for a final reaction volume of 20 µl. The mixture was incubated at 42 °C for 15 min, heated at 95 °C for 3 min to terminate the reaction, and then cooled in an ice bath to obtain the first strand of reverse-transcribed cDNA.

[0047] Q-PCR amplification of the target gene: Add the following reagents to each well of a 96-well PCR plate in the following order: 5 µl of 2×Universal SYBR qPCR Master Mix, 0.25 µl of upstream primer, 0.25 µl of downstream primer, 1.0 µl of cDNA template, and 3.5 µl of Nuclease-Free Water to a final reaction volume of 10 µl.

[0048] Place the sample in an ABI 7500 Real-Time PCR System and set the PCR cycling conditions: 95 ℃ for 10 min, (95 ℃ for 15 s, 60 ℃ for 30 s) for 40-45 cycles. Perform melting curve analysis: 95 ℃ for 15 s, 60 ℃ for 30 s, 95 ℃ for 15 s. After the reaction is complete, collect the data and perform Ct value analysis.

[0049] 2.9 Cell cycle analysis For cell cycle analysis, TSCC cells (1×10⁻⁶) 5 Cells / wells were seeded in 6-well plates and cultured for 48 h. Following the instructions of the cell cycle assay kit (#C001-500, 7seaBiotech, China), 0.5 mL of propionyl iodide staining solution was added to the 70% ethanol-fixed TSCC cells, and the cells were incubated in the dark for 30 min. Subsequently, red fluorescence at an excitation wavelength of 488 nm was detected using a flow cytometry system (#NovoCyteAdvanteon VBR, Agilent, US).

[0050] 2.10 Wound healing and cell invasion analysis For wound healing experiments, 100 µL of TSCC cells (2.5 × 10⁻⁶) were used. 4 (cells / ml) were seeded into a Culture-Insert (#80242, Ibidi, Germany), and the insert was removed when the confluence reached 95%, followed by culturing for 12 and 24 hours.

[0051] For Transwell assays, 100 µL of TSCC cells (1 × 10⁻⁶) were used. 5 Cells / ml were seeded into Transwell chambers (Corning) lined with Matrigel (#346234, Corning, US) and cultured for 48 h. Transwell chambers were then sequentially added to wells containing 1 mL of 4% polymethyl methacrylate fixative and 500 µL of crystal violet staining solution, and fixed for 30 min and stained for 15 min at room temperature. Cells were observed and images were collected using an inverted microscope (#ix73, Olympus, Japan).

[0052] 2.11 Cellular Glycolysis Rate Assay (ECAR) Cal27 cells were seeded in Seahorse XF24 culture plates, and glycolytic changes were measured using the Seahorse XF Glycolytic Rate Assay kit (#103344-100, Agilent). Following the kit instructions, Seahorse assay solution was added to the XF24 culture plates containing Cal27 cells, followed by adding 56 µL of Rot / AA (0.5 µmol / L) to well A and 62 µL of 2-DG (50 nmol / L) to wells B. The glycolytic rate of Cal27 cells in each group was analyzed using a Seahorse XF24 analyzer and Wave Desktop software (Agilent).

[0053] 2.12 In vivo experimental analysis Eighty female Balb / c-nu mice (18-22g) were obtained from Spfbiotech (China). According to the grouping information, 0.2 mL of Cal27 single-cell suspension transfected with the corresponding lentivirus (4 × 10⁻⁶ cells) was injected subcutaneously into the axillary tissue of each mouse. 5 To develop a subcutaneous tumor model, tumor volume was measured using calipers and mouse weight was recorded after tumor formation. Mice in each group were euthanized 27 and 30 days after modeling with 0.5% pentobarbital (0.1 mL / 10 g), and tumor weight was recorded. This study followed the ARRIVE guidelines (Animal Studies: Guidelines for Reporting In Vivo Experiments).

[0054] II. Results 1. Tissue microarray analysis To investigate the tumor functional significance of DDX24 in tongue squamous cell carcinoma, immunohistochemical analysis was first performed on the tongue cancer tissue microarray (purchased from Zhongke Guanghua, HN070Oc01). The microarray information is shown in Table 3. The results showed that, compared with normal tissue, the expression of DDX24 was significantly upregulated in tongue squamous cell carcinoma tissue, and increased with increasing stage. Figure 1 As shown in A, this indicates that the substance used to detect DDX24 can be used to prepare diagnostic and detection products for tongue squamous cell carcinoma.

[0055] 2. Increased lactate (LA) concentration, CCK8 proliferation, Western blotting, and Co-IP analysis. The changes in the proliferation capacity of CAL27 and SCC4 cells were detected after increasing the concentration of lactate (LA) in the culture medium. Figure 1 As shown in BD, LA concentration increased TSCC cell activity, DDX24 protein level and L-lactation level in a dependent manner.

[0056] 3. Mass spectrometry analysis like Figure 1 As shown in Figure E, mass spectrometry analysis revealed that DDX24 underwent lactation at residue K835.

[0057] 4. Analysis of Lactation Deletion in DDX24 K835 We mutated the K835 residue of DDX24 in CAL27 cells to an arginine (R) residue that mimics the delactated state, and compared the effects of the mutant on DDX24 expression and L-lactation levels. Figure 1 As shown in F and G, the expression of DDX24 and its L-lactation level decreased after the DDX24K835R mutation.

[0058] 5. DDX24 knockdown of CCK8 proliferation and cell cycle analysis like Figure 2 AD and Figure 3 As shown in the AD, lactate (LA) effectively increased the activity, S phase ratio, number of invasive cells, and wound healing rate of Cal27 and SCC4 cells, while DDX24 knockdown effectively limited the oncogenic effect of LA, indicating that DDX24 and LA accelerated the progression of tongue squamous cell carcinoma.

[0059] 6. DDX24 Knockout Western Blotting Analysis like Figure 2 EF and Figure 3 As shown in the EF diagram, lactate (LA) significantly upregulated the levels of DDX24, N-cadherin, HK2, PKM2, and LDHA in Cal27 and SCC4 cells, and downregulated E-cadherin and ZO-1. These LA-mediated changes in these proteins were rescued by DDX24 knockdown.

[0060] N-cadherin is a neurocadherin, a classic calcium-dependent cell adhesion molecule belonging to the cadherin superfamily, and is usually highly expressed during tumor progression.

[0061] HK2 is hexokinase 2, the first rate-limiting enzyme in the glycolysis pathway and a core regulatory molecule for tumor metabolic reprogramming. It is usually highly expressed during tumor progression.

[0062] PKM2, or pyruvate kinase M2, is the last rate-limiting enzyme in the glycolysis pathway and one of the most characteristic molecules in tumor metabolic reprogramming. It is usually highly expressed during tumor progression.

[0063] LDHA, or lactate dehydrogenase A, is a key terminal enzyme in the glycolysis pathway and a core executor of tumor aerobic glycolysis (Warburg effect). It is usually highly expressed during tumor progression.

[0064] E-cadherin, also known as CDH1, is the most studied member of the classic cadherin family and a core molecule of epithelial cell adhesion junctions. It is usually expressed at low levels during tumor progression.

[0065] ZO-1, or small band closure protein-1, is encoded by the TJP1 gene. It is the first cytoplasmic scaffold protein in tight junctions to be cloned and identified, and is also an important member of the MAGUK protein family. It is usually expressed at low levels during tumor progression.

[0066] 7. Extracellular flow analysis like Figure 2 As shown in Figure G, extracellular flux analysis revealed that lactate (LA) effectively increased the extracellular acidification rate (ECAR) and proton efflux rate (PER) of Cal27 cells, indicating that TSCC cells were undergoing rapid glycolysis and secreting large amounts of lactate. However, these LA-mediated changes in glycolysis were rescued by DDX24 knockdown.

[0067] 8. In vivo experimental analysis like Figure 4 AB and Figure 5 As shown in Figure AB, a subcutaneous tumor model was constructed in nude mice using Cal27 and SCC4 cells. In vivo experimental results showed that DDX24 overexpression effectively increased the volume and weight of tumors in the subcutaneous tumor model, while DDX24 knockdown exhibited the opposite regulatory pattern. Furthermore, as... Figure 4 C and Figure 5 As shown in Figure C, DDX24 overexpression significantly increased the number of Ki-67+ cells and the expression of DDX24, HK2, PKM2, and LDHA in tumor tissue, while DDX24 knockdown decreased these expression levels. This suggests that substances that inhibit DDX24 expression could be used to prepare products for the treatment of tongue squamous cell carcinoma.

[0068] Ki-67 is a nuclear protein that is widely used as a cell proliferation marker in tumor pathology diagnosis and is expressed in proliferating cells.

[0069] HK2 is hexokinase 2, the first rate-limiting enzyme in the glycolysis pathway and a core regulatory molecule for tumor metabolic reprogramming. It is usually highly expressed during tumor progression.

[0070] PKM2, or pyruvate kinase M2, is the last rate-limiting enzyme in the glycolysis pathway and one of the most characteristic molecules in tumor metabolic reprogramming. It is usually highly expressed during tumor progression.

[0071] LDHA, or lactate dehydrogenase A, is a key terminal enzyme in the glycolysis pathway and a core executor of tumor aerobic glycolysis (Warburg effect). It is usually highly expressed during tumor progression.

[0072] This indicates that DDX24 and its L-lactation promote the TSCC process and glycolysis.

[0073] In summary, this invention discloses the application of a substance for detecting DDX24 in the preparation of a tongue squamous cell carcinoma detection product. The substance for detecting DDX24 includes a substance for detecting the expression level of the DDX24 gene or DDX24 protein. This invention demonstrates for the first time that DDX24 expression increases with the malignancy of tongue squamous cell carcinoma, and that interfering with DDX24 expression inhibits the proliferation of tongue squamous cell carcinoma cells. DDX24 can serve as an effective biomarker for the diagnosis and detection of tongue squamous cell carcinoma, which is of great significance for the research and treatment of tongue squamous cell carcinoma. It also lays an experimental foundation and provides new insights for the development of highly effective drugs for the treatment of tongue squamous cell carcinoma, possessing good practical application value.

[0074] Although the present invention has been described in detail through the preferred embodiments above, it should be understood that the above description should not be considered as a limitation of the present invention. Various modifications and substitutions to the present invention will be apparent to those skilled in the art after reading the above description. Therefore, the scope of protection of the present invention should be defined by the appended claims.

Claims

1. Application of substances used to detect DDX24 in the preparation of tongue squamous cell carcinoma detection products.

2. The application as described in claim 1, characterized in that, The substances used to detect DDX24 include substances used to detect the expression level of the DDX24 gene or DDX24 protein.

3. The application as described in claim 2, characterized in that, The substance used to detect the expression level of the DDX24 gene includes primers for amplifying the DDX24 gene used in real-time quantitative PCR, with sequences shown in SEQ ID NO. 1 and SEQ ID NO.

2.

4. The application as described in claim 1, characterized in that, The products include those capable of detecting the expression levels of the DDX24 gene or DDX24 protein.

5. Application of substances that inhibit DDX24 expression in the preparation of products for the treatment of tongue squamous cell carcinoma.

6. The application as described in claim 5, characterized in that, The substances that inhibit DDX24 expression include at least one of the following: RNA interference molecules targeting DDX24, antisense oligonucleotides, and small molecule inhibitors.

7. The application as described in claim 6, characterized in that, The RNA interference molecule targeting DDX24 is shRNA, and its targeting sequence is shown in SEQ ID NO. 3, SEQ ID NO. 4 and / or SEQ ID NO.

5.

8. The application as described in claim 5, characterized in that, The product for treating tongue squamous cell carcinoma has at least one of the following functions: inhibiting the proliferation of tongue squamous cell carcinoma cells, inhibiting the malignant invasion of tongue squamous cell carcinoma cells, inhibiting the growth of tongue squamous cell carcinoma, and reducing the promoting effect of lactic acid on the proliferation of tongue squamous cell carcinoma.

9. Application of lactation-modified DDX24 protein as a target in the preparation of tongue squamous cell carcinoma detection products.

10. The application as described in claim 9, characterized in that, The lactation modification site is lysine 835 of the DDX24 protein.