A kit for detecting hepatocellular carcinoma related circular RNA and application thereof

Abstract

The application belongs to the technical field of nucleic acid molecule detection, and discloses a kit for detecting hepatocellular carcinoma related circular RNA and application thereof. The kit comprises a primer set for detecting circATP6V0A1, the circATP6V0A1 is numbered as hsa_circ_0008179, derived from an ATP6V0A1 gene, and formed by reverse splicing of the 16th exon and the 17th exon of the ATP6V0A1 gene. The primer set can amplify a nucleic acid fragment containing a reverse splicing site of the circATP6V0A1. The application also discloses application of the kit or the primer set in preparation of a hepatocellular carcinoma related circular RNA expression level detection product. The kit can be used for detecting an expression level of the circATP6V0A1 in an ex vivo sample.

Description

Technical Field

[0001] This invention relates to the field of nucleic acid molecular detection technology, specifically to a kit for detecting hepatocellular carcinoma-related circular RNA and its application. Background Technology

[0002] Hepatocellular carcinoma (HCC) is one of the most common types of primary liver cancer, and its development involves various molecular abnormalities. Current molecular detection research related to HCC mainly focuses on protein-coding genes, serum protein markers, and some non-coding RNA molecules. With the development of transcriptome sequencing and molecular detection technologies, the role of circular RNA in tumor development and tumor-related molecular detection is gradually gaining attention.

[0003] Circular RNAs (RNAs) are a class of covalently closed circular RNA molecules formed by backsplicing of precursor mRNA. Compared to linear RNAs, circular RNAs lack the traditional 5' cap and 3' poly(A) tail, and generally exhibit better stability. Some circular RNAs possess specific expression characteristics in tissue, cellular, or body fluid samples, thus serving as candidate molecules for tumor-related detection.

[0004] circATP6V0A1 is a circular RNA derived from the ATP6V0A1 gene, designated hsa_circ_0008179. Currently, there are few dedicated kits for detecting circATP6V0A1 expression levels, particularly lacking primer sets and corresponding detection systems that can target the circATP6V0A1 backsplicing site region. Therefore, it is necessary to provide a primer set and kit for detecting circATP6V0A1 expression levels, offering a technical means for detecting the expression levels of hepatocellular carcinoma-related circular RNAs. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a kit for detecting hepatocellular carcinoma-related circular RNA and its application. The kit can detect the expression level of circATP6V0A1 in in vitro samples, thereby providing a technical solution for the molecular detection of hepatocellular carcinoma-related circular RNA.

[0006] To address the aforementioned technical problems, this invention provides a kit for detecting hepatocellular carcinoma-related circular RNA, the kit comprising a primer set for detecting circATP6V0A1.

[0007] The circATP6V0A1 gene, designated hsa_circ_0008179, originates from the ATP6V0A1 gene and is formed by reverse splicing of exons 16 and 17 of the ATP6V0A1 gene.

[0008] In some embodiments, the cDNA nucleotide sequence corresponding to circATP6V0A1 is shown in SEQ ID NO:1.

[0009] In some embodiments, the primer set includes upstream and downstream primers for amplifying nucleic acid fragments containing the circATP6V0A1 backsplicing site.

[0010] In some embodiments, the nucleotide sequence of the upstream primer is shown in SEQ ID NO:2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:3.

[0011] In some specific embodiments, the sequence shown in SEQ ID NO:2 is: GTGTACCTTGGATGCTGCTG; The sequence shown in SEQ ID NO:3 is: ATGGATCAGAAGGCTTGGTG.

[0012] In some embodiments, the kit further includes one or more of the following: reverse transcription reagent, PCR amplification reagent, real-time PCR reagent, positive control, negative control, internal control detection system, reaction buffer, nuclease-free water, or RNA extraction reagent.

[0013] In some embodiments, the positive control may be a recombinant plasmid containing the circATP6V0A1 backsplicing site sequence, a synthetic nucleic acid fragment, or a validated positive cDNA sample; the negative control may be a template-free control, a reverse transcription-free control, or a negative sample that does not contain the circATP6V0A1 backsplicing site sequence.

[0014] In some embodiments, the kit is used to detect the expression level of circATP6V0A1 in in vitro samples.

[0015] In some embodiments, the ex vivo sample is selected from one or more of liver tissue samples, hepatocellular carcinoma tissue samples, adjacent normal tissue samples, or cell samples.

[0016] In other embodiments, the ex vivo sample may also be a serum sample, a plasma sample, or an exosome sample, and an RNA extraction method suitable for the corresponding sample type may be used for detection.

[0017] In some embodiments, the detection method for circATP6V0A1 is one or more of RT-qPCR, digital PCR, conventional PCR, fluorescent probe PCR, nucleic acid sequencing, or nucleic acid chip detection.

[0018] The present invention also provides a primer set for detecting circATP6V0A1, the primer set comprising the upstream primer shown in SEQ ID NO:2 and the downstream primer shown in SEQ ID NO:3, the primer set being used to amplify nucleic acid fragments containing the circATP6V0A1 reverse splice site.

[0019] The present invention also provides the application of the above-mentioned kit or primer set in the preparation of products for detecting the expression level of hepatocellular carcinoma-related circular RNA.

[0020] Compared with the prior art, the present invention has the following beneficial effects: 1. The primer set provided by this invention can amplify nucleic acid fragments containing the circATP6V0A1 backsplicing site, which is helpful in distinguishing circATP6V0A1 from its corresponding linear transcript; 2. The kit provided by this invention can be used to detect the expression level of circATP6V0A1 in in vitro samples, providing a technical means for detecting the expression level of hepatocellular carcinoma-related circular RNA; 3. The kit described in this invention has a simple composition, and the detection method can be combined with conventional nucleic acid detection platforms such as RT-qPCR, digital PCR, ordinary PCR, and nucleic acid sequencing, which has good experimental feasibility; 4. This invention can be used to prepare products for detecting the expression level of hepatocellular carcinoma-related circular RNA. Attached Figure Description

[0021] Figure 1 This is a schematic diagram of the structure and backsplicing site of circATP6V0A1. circATP6V0A1 originates from the ATP6V0A1 gene, numbered hsa_circ_0008179, and is formed by backsplicing of exons 16 and 17 of the ATP6V0A1 gene. The full length of circATP6V0A1 is 325 nt. The figure shows the exon composition of linear ATP6V0A1, the circular structure of circATP6V0A1, and its backsplicing site. Figure 2 The figure shows the amplification and sequencing verification results of the circATP6V0A1 reverse splice site. The figure shows the electrophoresis detection results of PCR amplification using gDNA and cDNA as templates, as well as the Sanger sequencing peak diagram of the circATP6V0A1 reverse splice site region, which is used to illustrate that the primer set can amplify nucleic acid fragments containing the circATP6V0A1 reverse splice site. Figure 3 The figure shows the expression detection and ROC curve analysis results of circATP6V0A1 in hepatocellular carcinoma tissue samples. Figure 3A represents the expression level detection results of circATP6V0A1 in adjacent normal tissue samples and hepatocellular carcinoma tissue samples, including 10 adjacent normal tissue samples and 20 hepatocellular carcinoma tissue samples. Figure 3 B represents the ROC curve analysis results of circATP6V0A1 expression level used to distinguish between adjacent normal tissue samples and hepatocellular carcinoma tissue samples, with an AUC of 0.820 and a 95% confidence interval of 0.666–0.974. Detailed Implementation

[0022] This invention provides a kit for detecting hepatocellular carcinoma-related circular RNA and its application. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired result. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to implement and apply the technology of this invention.

[0023] The test materials used in this invention are all commercially available products. The invention will be further illustrated below with reference to specific embodiments.

[0024] Example 1: Structure confirmation and primer design of circATP6V0A1

[0025] This example illustrates the structural features of circATP6V0A1 and the design of primers for detecting its reverse splice site.

[0026] circATP6V0A1, designated hsa_circ_0008179, originates from the ATP6V0A1 gene. circATP6V0A1 is formed by backsplicing exons 16 and 17 of the ATP6V0A1 gene, and its corresponding cDNA nucleotide sequence is shown in SEQ ID NO:1. The circular structure and backsplicing site region of circATP6V0A1 are shown below. Figure 1 As shown.

[0027] To detect circATP6V0A1, this invention designs a primer set for amplifying nucleic acid fragments containing the circATP6V0A1 backsplicing site. The primer set includes an upstream primer and a downstream primer, wherein: The upstream primer sequence is shown in SEQ ID NO:2: GTGTACCTTGGATGCTGCTG; The downstream primer sequence is shown in SEQ ID NO:3: ATGGATCAGAAGGCTTGGTG.

[0028] The primer set described above is used to amplify nucleic acid fragments containing the circATP6V0A1 backsplicing site, thereby enabling the detection of circATP6V0A1.

[0029] Example 2: Amplification and Validation of the circATP6V0A1 Backsplicing Site

[0030] This embodiment illustrates the amplification and verification of the circATP6V0A1 backsplicing site region using the primer set described in this invention.

[0031] Hepatocellular carcinoma cells or liver tissue samples were collected, and total RNA and genomic DNA were extracted, respectively. The extracted total RNA was reverse transcribed into cDNA. Using cDNA or genomic DNA as templates, PCR amplification was performed using the primer sets shown in SEQ ID NO:2 and SEQ ID NO:3.

[0032] A PCR amplification system may include a cDNA template or a genomic DNA template, upstream primers, downstream primers, PCR amplification enzymes, dNTPs, reaction buffer, and nuclease-free water. The amplification program includes pre-denaturation, cyclic denaturation, annealing, extension, and final extension steps. Specific reaction conditions can be adjusted according to the PCR amplification reagents and instruments used.

[0033] After PCR amplification, the amplification products were detected by agarose gel electrophoresis. The results are as follows: Figure 2 As shown, using the primer sets shown in SEQ ID NO:2 and SEQ ID NO:3, the target amplified product with the expected size can be obtained.

[0034] Furthermore, the PCR amplification products were validated using Sanger sequencing. The sequencing results showed that the amplification products contained the backsplicing site sequence of circATP6V0A1, and the backsplicing site region sequence was consistent with expectations. These results demonstrate that the primer sets shown in SEQ ID NO:2 and SEQ ID NO:3 can be used to amplify nucleic acid fragments containing the circATP6V0A1 backsplicing site, thereby enabling the detection of circATP6V0A1.

[0035] Example 3: Detection and discriminative ability analysis of circATP6V0A1 expression in hepatocellular carcinoma tissue samples.

[0036] This example illustrates the detection of circATP6V0A1 expression levels in hepatocellular carcinoma tissue samples and adjacent normal tissue samples.

[0037] Hepatocellular carcinoma tissue samples and adjacent normal tissue samples were collected, and total RNA was extracted from each. After RNA quality testing, the total RNA was reverse transcribed into cDNA. Using cDNA as a template, RT-qPCR was performed using the primer sets shown in SEQ ID NO:2 and SEQ ID NO:3 to obtain the expression level of circATP6V0A1. The detection results were normalized using an internal reference gene, and the expression level of circATP6V0A1 in different tissue samples was compared using a relative quantification method.

[0038] Ten samples of adjacent normal tissue and 20 samples of hepatocellular carcinoma tissue were examined. Results are as follows: Figure 3 As shown in Figure A, the expression level of circATP6V0A1 was increased in hepatocellular carcinoma tissue samples compared with adjacent normal tissue samples. Further ROC curve analysis was used to analyze the ability of circATP6V0A1 expression level to distinguish between hepatocellular carcinoma tissue samples and adjacent normal tissue samples, and the results are as follows. Figure 3 As shown in B, the AUC is 0.820, and the 95% confidence interval is 0.666–0.974.

[0039] The above results indicate that circATP6V0A1 expression differs between hepatocellular carcinoma tissue samples and adjacent normal tissue samples. The primer set described in this invention and the kit containing this primer set can be used to detect the expression level of circATP6V0A1 in ex vivo tissue samples.

[0040] Example 4: Composition of the circATP6V0A1 detection kit

[0041] This embodiment illustrates the composition of the circATP6V0A1 detection kit of the present invention.

[0042] The circATP6V0A1 detection kit includes a primer set for detecting circATP6V0A1, the primer set including the upstream primer shown in SEQ ID NO:2 and the downstream primer shown in SEQ ID NO:3.

[0043] In one specific embodiment, the kit comprises the following components: 1) Upstream primer for circATP6V0A1; 2) Downstream primer of circATP6V0A1; 3) Reverse transcription reaction reagents; 4) PCR amplification reaction reagents or real-time PCR amplification reaction reagents; 5) Internal reference detection system; 6) Positive control; 7) Negative control; 8) Nuclease-free water; 9) Reaction buffer.

[0044] In some embodiments, the kit may also include an RNA extraction reagent. This RNA extraction reagent can be used to extract total RNA from isolated liver tissue samples, hepatocellular carcinoma tissue samples, adjacent normal tissue samples, or cell samples.

[0045] In other embodiments, when the test sample is a serum sample, plasma sample, or exosome sample, RNA extraction can be performed using RNA extraction reagents suitable for body fluid samples or exosome RNA extraction reagents.

[0046] Example 5: Usage and Result Interpretation of the circATP6V0A1 Detection Kit

[0047] This embodiment illustrates the usage method and result interpretation method of the circATP6V0A1 detection kit described in this invention.

[0048] Total RNA was extracted from isolated liver tissue samples, hepatocellular carcinoma tissue samples, adjacent normal tissue samples, or cell samples. After determining the RNA concentration and purity, an appropriate amount of RNA was used for reverse transcription to obtain cDNA.

[0049] Using the obtained cDNA as a template, PCR or RT-qPCR amplification was performed using the primer sets shown in SEQ ID NO:2 and SEQ ID NO:3. These primer sets were used to amplify nucleic acid fragments containing the circATP6V0A1 backsplicing site, and therefore could be used to detect the expression level of circATP6V0A1.

[0050] In one embodiment, the RT-qPCR reaction system includes a cDNA template, an upstream primer of circATP6V0A1, a downstream primer of circATP6V0A1, a real-time PCR reaction solution, and nuclease-free water.

[0051] In one implementation, the RT-qPCR reaction procedure includes pre-denaturation, cyclic denaturation, annealing, and extension steps. Specific reaction conditions can be adjusted depending on the PCR amplification reagents and instruments used.

[0052] After the detection is completed, the expression level of circATP6V0A1 can be normalized using an internal reference gene. By comparing the relative expression levels of circATP6V0A1 in different in vitro samples, the expression status of circATP6V0A1 in the corresponding samples can be obtained.

[0053] The above are merely preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A kit for detecting hepatocellular carcinoma-associated circular RNA, characterized in that, The kit includes a primer set for detecting circATP6V0A1; the circATP6V0A1, numbered hsa_circ_0008179, is derived from the ATP6V0A1 gene and is formed by reverse splicing of exons 16 and 17 of the ATP6V0A1 gene.

2. The reagent kit according to claim 1, characterized in that, The cDNA nucleotide sequence corresponding to circATP6V0A1 is shown in SEQ ID NO:

1.

3. The kit according to claim 1 or 2, characterized in that, The primer set includes upstream and downstream primers for amplifying nucleic acid fragments containing the circATP6V0A1 backsplicing site.

4. The reagent kit according to claim 3, characterized in that, The nucleotide sequence of the upstream primer is shown in SEQ ID NO:2, which is GTGTACCTTGGATGCTGCTG; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:3, which is ATGGATCAGAAGGCTTGGTG.

5. The kit according to any one of claims 1 to 4, characterized in that, The kit also includes one or more of the following: reverse transcription reagent, PCR amplification reagent, real-time PCR reagent, positive control, negative control, internal control detection system, reaction buffer, nuclease-free water, or RNA extraction reagent.

6. The reagent kit according to claim 5, characterized in that, The positive control is selected from recombinant plasmids containing the circATP6V0A1 backsplicing site sequence, synthetic nucleic acid fragments, or validated positive cDNA samples; the negative control is selected from template-free controls, reverse transcription-free controls, or negative samples that do not contain the circATP6V0A1 backsplicing site sequence.

7. The kit according to any one of claims 1 to 6, characterized in that, The kit is used to detect the expression level of circATP6V0A1 in in vitro samples.

8. The reagent kit according to claim 7, characterized in that, The ex vivo sample is selected from one or more of the following: liver tissue sample, hepatocellular carcinoma tissue sample, adjacent normal tissue sample, cell sample, serum sample, plasma sample, or exosome sample.

9. A primer set for detecting circATP6V0A1, characterized in that, The primer set includes the upstream primer shown in SEQ ID NO:2 and the downstream primer shown in SEQ ID NO:3, and the primer set is used to amplify a nucleic acid fragment containing the circATP6V0A1 reverse splice site.

10. The use of the kit according to any one of claims 1 to 8 or the primer set according to claim 9 in the preparation of a product for detecting the expression level of hepatocellular carcinoma-related circular RNA.

Images