SNP molecular marker related to body weight trait of snakehead and application thereof

Abstract

The application discloses a SNP molecular marker related to the body weight trait of Channa argus and application thereof. The SNP molecular marker is located at 1329732 of the NC_090203.1 sequence of the No. 7 chromosome of the male Channa argus genome GCF_033026475.1, corresponds to the 101th position of the sequence shown in SEQ ID NO: 1, and the site is a T>A single nucleotide polymorphism site. A pair of specific primers is designed for the SNP site, and a method for genotype detection is established by taking the Channa argus genome DNA as a template, through PCR amplification and sequencing analysis. Correlation analysis shows that the T allele is a dominant allele, and the body weight of the individual with the T / T genotype is significantly higher than that of the individual with the T / A genotype. The individual with the T / T genotype is selected for breeding by detecting the genotype, and the individual with the T / A genotype is eliminated, so that the dominant allele T can be gradually enriched in the population, and the application is suitable for large-scale popularization and application in the Channa argus breeding production.

Description

Technical Field

[0001] This application relates to the fields of aquatic animal genetics and breeding and molecular biology, specifically to a single nucleotide polymorphism molecular marker that is significantly associated with the weight trait of snakehead fish, its detection primers and kits, and the application of the marker in molecular marker-assisted selection breeding of snakehead fish. Background Technology

[0002] Snakehead fish (Channa argus), commonly known as blackfish or snakehead, is an important and high-quality freshwater aquaculture fish in my country. It is characterized by rapid growth, good meat quality, tolerance to low oxygen levels, and strong stress resistance, and its aquaculture scale has been expanding year by year. Growth rate (with harvest weight as the most direct indicator) is the most important economic trait in snakehead farming, directly determining feed conversion efficiency and market cycle, and is the primary goal of breeding.

[0003] Currently, genetic improvement of snakehead fish still mainly relies on phenotype-based population selection (mixed selection), which has the following shortcomings:

[0004] (1) Growth traits such as body weight are quantitative traits, with moderate heritability and are easily affected by the environment. Selection based solely on phenotype has limited accuracy.

[0005] (2) Growth traits can only be accurately measured when the animals are raised to harvest size, resulting in a long generation cycle and low breeding efficiency;

[0006] (3) Lack of molecular markers that are directly related to growth and can be used in seedlings or early stages.

[0007] Genome-wide association analysis (GWAS) combined with high-density SNP microarrays is an effective method for elucidating the genetic basis of economic traits in aquatic organisms and identifying functional molecular markers. However, there are currently very few reports on functional molecular markers for the body weight trait in snakehead, and no association-validated SNP markers can be directly used for marker-assisted selection (MAS) of growth traits in snakehead. Therefore, developing molecular markers significantly associated with snakehead body weight is of great significance for improving its breeding efficiency. Summary of the Invention

[0008] In view of this, the purpose of this application is to provide a SNP molecular marker related to the body weight trait of snakehead fish and its application. This application used a 50K SNP chip to genotype 205 snakehead fish, combined with individual harvest weight, and performed a genome-wide association analysis using a linear mixture model (GEMMA). Annotation was performed using a reference genome (chromosome-level assembly, 24 chromosomes), revealing a polymorphic site on snakehead chromosome 7 that was significantly associated with body weight across the entire genome. Based on this, this application designed a pair of specific primers for this SNP site and established a method for genotype detection using snakehead genomic DNA as a template, through PCR amplification and sequencing analysis. The genotype of the SNP site was determined based on the sequencing results. The key SNP marker resources and detection method provided in this application are suitable for evaluating growth traits, identifying germplasm, or using molecular marker-assisted selection breeding in snakehead fish.

[0009] To achieve the above objectives, this application provides the following technical solution:

[0010] In a first aspect, this application provides a primer pair for detecting SNP molecular markers associated with the weight trait of snakehead fish. The SNP molecular marker is located at position 1329732 of the sequence NC_090203.1 on chromosome 7 of the male snakehead fish genome GCF_033026475.1, corresponding to position 101 of the sequence shown in SEQ ID NO:1. This position is a T>A single nucleotide polymorphism site. The primer pair is used to amplify nucleotide fragments containing the SNP molecular marker located in the snakehead fish genome.

[0011] The aforementioned SNP polymorphic site is located on chromosome 7 of the snakehead fish, specifically within the intron region of the snakehead fish type II collagen α-1 chain gene (COL2A1). This polymorphic site exhibits two genotypes: T / T (homozygous) and T / A (heterozygous). The T / T genotype is the dominant genotype, with individuals carrying it having significantly higher body weights than those carrying the T / A genotype.

[0012] It should be understood that, based on the aforementioned chromosome 7 sequence, any upstream and downstream nucleotide sequences covering the SNP site are considered equivalent variants of the marker and can be used to construct detection systems. All primer pairs and detection kits designed for amplification or genotyping targeting the above-mentioned marker sequences should fall within the scope of protection of this application.

[0013] In some preferred embodiments, the primer pair comprises:

[0014] Upstream primer F: 5′-AGCGTCTGTCACTGCAATGCAAAG-3′ (SEQ ID NO:2);

[0015] Downstream primer R: 5′-GTCTGAAAACAACTATTCAGAAAA-3′ (SEQ ID NO:3).

[0016] The primer pairs shown in SEQ ID NO:2 and SEQ ID NO:3 above are used to amplify the molecular marker sequences shown in SEQ ID NO:4 and SEQ ID NO:5.

[0017] Secondly, this application provides a kit comprising the primer pairs described in the first aspect.

[0018] In some embodiments, the kit further includes DNA extraction reagents, PCR reaction premix, and DNA purification reagents.

[0019] Thirdly, this application provides a method for detecting SNP molecular markers related to the weight trait of snakehead fish, comprising the following steps:

[0020] S1. Extract genomic DNA from the snakehead fish to be tested;

[0021] S2. Using the genomic DNA obtained in step S1 as a template, perform PCR amplification using the primer pair described in the first aspect to obtain the amplification product;

[0022] S3. Sequencing analysis is performed on the amplification product obtained in step S2 to determine the genotype at position 101 of the sequence shown in SEQ ID NO:1, wherein the genotype is T / T or T / A.

[0023] In some embodiments, in step (2), the PCR amplification reaction system, with a total volume of 50 μL, includes: 25 μL of 2×PCR Mix, 1.5 μL each of upstream and downstream primers, 2 μL of DNA template, and 20 μL of ddH2O.

[0024] In some embodiments, the PCR amplification procedure in step (2) is as follows: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 59 °C for 30 s, extension at 72 °C for 45 s, 34 cycles; extension at 72 °C for 10 min; cooling to 4 °C.

[0025] In addition to the PCR amplification followed by sequencing method mentioned above, at least one of the following methods can be used to detect the genotype of the above SNP loci: KASP, ARMS-PCR, TaqMan probes, or SNP chips.

[0026] Fourthly, this application provides a method for breeding snakehead fish, comprising the following steps:

[0027] S1. Extract genomic DNA from the snakehead fish to be tested;

[0028] S2. Using the genomic DNA obtained in step S1 as a template, perform PCR amplification using the primer pair described in the first aspect to obtain the amplification product;

[0029] S3. Sequencing analysis is performed on the amplification products obtained in step S2 to determine the genotype of the SNP locus; the genotype is T / T or T / A.

[0030] S4. Based on the sequencing results of step S3, select individuals with the T / T genotype for snakehead breeding and eliminate individuals with the T / A genotype.

[0031] Fifthly, this application provides the application of the primer pair described in the first aspect or the kit described in the second aspect in the screening of growth traits and / or breeding of snakehead fish, wherein the growth trait is body weight.

[0032] Compared with the prior art, this application has at least the following beneficial effects:

[0033] 1. This application provides, for the first time, a functional molecular marker, validated by genome-wide association analysis, that is significantly associated with body weight in the snakehead fish at a genome-wide level. This marker is located within the functionally defined type II collagen gene (COL2A1). Association analysis confirmed that individuals with the T / T genotype had a significantly higher average body weight than those with the T / A genotype. This was further validated in another independent population, where individuals with the T / T genotype had a significantly higher average body weight than those with the T / A genotype, with a difference exceeding 29%, highly consistent with the population where the marker was first identified, further confirming the effectiveness and robustness of the marker.

[0034] 2. The molecular markers provided in this application can be used to screen growth potential in seedlings or early stages of aquaculture without raising them to harvest size, thereby shortening the generation selection cycle, improving the breeding efficiency of snakehead fish, and reducing breeding costs.

[0035] 3. The detection method provided in this application is simple and low-cost, and can be implemented in various ways such as PCR post-sequencing, KASP, ARMS-PCR or SNP chip, which is convenient for large-scale application in breeding production. Attached Figure Description

[0036] Figure 1 The results of the genome-wide association analysis provided in Example 1 of this application are shown in (a) and (b) respectively.

[0037] Figure 2 Box plot of body weight of individuals with different genotypes in an independent validation population for the SNP molecular marker provided in Example 1 of this application. Detailed Implementation

[0038] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application.

[0039] The materials used in the following embodiments are not limited to those listed below, and other similar materials may be used instead. Unless otherwise specified, the instruments shall be used under conventional conditions or as recommended by the manufacturer. Those skilled in the art should have relevant knowledge of the use of conventional materials and instruments.

[0040] In this application, unless the context clearly indicates otherwise, the terms “including,” “comprising,” “containing,” “having,” etc., shall be understood as open-ended and mean “including but not limited to.”

[0041] To better understand this teaching and without limiting its scope, all figures and other numerical values ​​used in the specification and claims to express quantities, percentages, or proportions should, in all cases, be understood to be modified by the term "about." Therefore, unless otherwise stated, the numerical parameters set forth in the following specification and appended claims are approximate values ​​that may be adjusted according to the desired performance. At a minimum, each numerical parameter should be interpreted based on the reported significant figures and by applying common rounding techniques.

[0042] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter of this application pertains.

[0043] Example 1: Obtaining SNP molecular markers related to the weight trait of snakehead fish

[0044] This embodiment illustrates the process of discovering and identifying SNP molecular markers that are significantly associated with the weight trait of snakehead fish.

[0045] 1.1 Experimental population and phenotypic determination

[0046] The experimental population consisted of 205 snakehead fish (Channaargus) from the breeding and aquaculture population of Qingyuan Zhuoyue Aquatic Products Co., Ltd., with complete harvest weight records for each fish. The weight ranged from 591 to 1283 g, with an average weight of 830.3 ± 138.4 g (mean ± standard deviation). Fin tissue (or dorsal muscle tissue) was harvested from each fish and stored in anhydrous ethanol at –20°C for subsequent genomic DNA extraction.

[0047] 1.2 Genotyping and Data Quality Control

[0048] Genomic DNA was extracted from the fin tissues described above. After passing quality inspection, the tissues were sent to CAGT Company for whole-genome genotyping using the snakehead 50K SNP chip.

[0049] Genotypic data were obtained using the chromosome-level reference genome of *Channa argus*, GCF_033026475.1 (24 chromosomes in total). Quality control screening was performed using PLINK software (v1.9) with the following criteria: locus detection rate ≥ 0.90, minimum allele frequency ≥ 0.05, and only autosomal SNPs were retained. After quality control, a total of 47,123 valid SNPs were retained for association analysis.

[0050] 1.3 Genome-wide association analysis

[0051] Using individual harvest weight as the phenotype, genome-wide association analysis was performed using a univariate linear mixture model in GEMMA software (v0.98.5). A centered kinship matrix (K-matrix) constructed from all valid SNPs was used to correct for population structure and inter-individual kinship, and the Wald test was used to calculate association significance. The genome expansion factor λ was also considered. GC =1.083, indicating that the group stratification control is good.

[0052] The significance threshold for the entire genome was determined using Bonferroni correction: 0.05 / 47,123 = 1.06 × 10⁻⁶. -6 The results showed that a SNP locus significantly associated with body weight was detected at positions 1,329,732 on chromosome 7 of the snakehead (Syngonium spp. reference genome GCF_033026475.1). Wald test p wald =1.18×10 -7 .

[0053] The results of the genome-wide association analysis are as follows: Figure 1 As shown. Figure 1 The middle (a) is the Manhattan plot, with the horizontal axis representing the 24 chromosomes (Chr1–Chr24) of the snakehead. It shows that the locus 1,329,732 on chromosome 7 exceeds the Bonferroni genome-wide significance threshold, indicating that this locus is significantly associated with the weight trait at the genome-wide level.

[0054] 1.4 Marker annotation and genotype-phenotype association

[0055] The SNP site is located in the intron region of the type II collagen α-1 chain gene (COL2A1, corresponding gene model Chr07.g07382, NCBI alignment result is collagen alpha-1(II) chain, zgc:113232), and is a T / A single nucleotide polymorphism (T>A base substitution). Its flanking sequence is shown in SEQ ID NO:1 (position 101 is the polymorphic site).

[0056] SEQ ID NO:1 (201 bp, the 101st position is a polymorphic site, indicated by square brackets):

[0057] AGCGTCTGTCACTGCAATGCAAAGTGAAACATTACAGAACATTTATCACTAGAGAATAAATTATTTAAGAAAAATGAAACAAAGTTAAGTTCTGTGTTCA [T / A] AATTGCTGTTACCACAAAAGACCAGATCGTTTTCTGAATAGTTGTTTTCAGACTGGGGTTATTGTTTTATTTTTATTGTTATGGTTTTATTGTTTTATT

[0058] Based on the genotyping results, the 205 individuals were grouped according to their genotype at that locus for comparison of body weight. The results are shown in Table 1:

[0059] Table 1. Genotype Grouping Results

[0060] T / A 145 808.2±119.7 T / T 60 1047.2±135.9

[0061] Only two genotypes, T / T and T / A, were detected in this applicant population. Individuals with the T / T genotype had a significantly higher average weight (approximately 1047 g) than those with the T / A genotype (approximately 808 g), a difference of approximately 239 g (approximately 30%); Welch t-test showed t = –11.85, p = 1.1 × 10⁻⁶. -20 .

[0062] 1.5 Independent Group Validation

[0063] To further verify the robustness of the marker, another independent breeding population of 200 snakehead fish (100 T / A and 100 T / T genotypes) was selected for verification. Figure 2Box plots were created to show the body weight of individuals with different genotypes in an independent validation population (n=200, 100 T / A and 100 T / T individuals). The x-axis represents genotype (T / A, T / T, and their respective sample size), and the y-axis represents body weight (g). The boxes represent the median and interquartile range, the scatter plots represent individual individuals, and the yellow diamonds represent the mean of each genotype. The results show that individuals with the T / T genotype had significantly higher body weight than individuals with the T / A genotype. Statistical results are shown in Table 2.

[0064] Table 2. Genotype grouping results of independent populations

[0065] T / A 100 813.4±126.9 T / T 100 1050.1±150.2

[0066] As shown in Table 2, the average weight of T / T individuals was significantly higher than that of T / A individuals, with a difference of approximately 236.7 g (about 29%). Welch's t-test yielded t=12.04 and p=3.0×10⁻⁶. -25 This is highly consistent with the findings of the group.

[0067] 1.6 Body weight distribution of individuals with different genotypes

[0068] The weight distribution of individuals with different genotypes in the discovery population and the independent validation population is as follows: Figure 2 As shown. Figure 2 Boxplots were used to visualize body weight in an independent validation population (n=200, 100 individuals each for T / A and T / T genotypes). The x-axis represents genotype (T / A, T / T, and their respective sample size), and the y-axis represents body weight (in g). The boxes represent the median and interquartile range (IQR), with data distributions within 1.5 times the IQR shown above and below each box. The scatter plots represent individual body weight values, and the yellow diamonds represent the mean for each genotype. Results showed that the median, mean, and range of body weight in individuals with the T / T genotype were significantly higher than those with the T / A genotype, and the differences between the two groups were statistically significant (Welch t-test, ***p < 0.001).

[0069] The above results collectively indicate that the T allele is the dominant allele for increased body weight, and this SNP molecular marker can be stably used for marker-assisted selection of growth traits in snakehead.

[0070] Example 2: PCR-sequencing detection method for SNP molecular markers

[0071] This embodiment illustrates the specific method for genotyping this SNP site using PCR amplification combined with Sanger sequencing technology.

[0072] 2.1 Genomic DNA Extraction

[0073] Approximately 20–50 mg of fin tissue from the snakehead fish was collected, and genomic DNA was extracted using a DNA extraction kit. The DNA concentration and purity (OD) were determined using a NanoDrop spectrophotometer. 260 / OD 280 =1.8–2.0), and DNA integrity was detected by 1% agarose gel electrophoresis. After passing quality control, the DNA was diluted to 50 ng / μL for later use.

[0074] 2.2 PCR amplification

[0075] Based on the flanking sequence shown in SEQ ID NO:1, the following specific PCR primer pair was designed:

[0076] Upstream primer F: 5′–AGCGTCTGTCACTGCAATGCAAAG–3′ (SEQ ID NO:2);

[0077] Downstream primer R: 5′–GTCTGAAAACAACTATTCAGAAAA–3′ (SEQ ID NO:3);

[0078] Using snakehead genomic DNA as a template, PCR amplification with the above primer pair yielded a DNA fragment of approximately 155 bp. This fragment contains a T / A polymorphic site at position 101 of SEQ ID NO:1, and its sequence is shown below (the underlined T or A indicates the polymorphic site):

[0079] T genotype amplification fragment (SEQ ID NO:4):

[0080] AGCGTCTGTCACTGCAATGCAAAG TGAAACATTCAGAACATTTATCACTAGAGAATAAATTATTTAAGAAAAATGAAACAAAGTTAAGTTCTGTGTTCA T AATTGCTGTTACCACAAAAGACCAGATCG TTTTCTGAATAGTTG TTTTCAGAC

[0081] Genotype A amplified fragment (SEQ ID NO:5):

[0082] AGCGTCTGTCACTGCAATGCAAAG TGAAACATTCAGAACATTTATCACTAGAGAATAAATTATTTAAGAAAAATGAAACAAAGTTAAGTTCTGTGTTCA A AATTGCTGTTACCACAAAAGACCAGATCG TTTTCTGAATAGTTG TTTTCAGAC

[0083] The PCR reaction system (total volume 50 μL) is as follows:

[0084] 2× PCR Master Mix (containing Taq enzyme, dNTPs, Mg) 2+ 25 μL of primer; 1.5 μL each of forward and reverse primer F (10 μmol / L); 2 μL of template DNA (50 ng / μL); and ddH2O to bring the total volume to 50 μL.

[0085] The PCR amplification procedure is as follows:

[0086] Pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 s, annealing at 59 ℃ for 30 s, extension at 72 ℃ for 45 s, 34 cycles; extension at 72 ℃ for 10 min; cooling to 4 ℃.

[0087] Take 5 μL of PCR product and perform 2% agarose gel electrophoresis at 120 V for 30 min. Observe under a gel imaging system whether a single specific amplification band appears at about 155 bp.

[0088] 2.3 PCR product purification and sequencing

[0089] After the PCR products that have passed quality inspection are purified, they are sent to a sequencing company for sequencing.

[0090] 2.4 Genotype Interpretation

[0091] The sequence obtained from sequencing is compared with SEQ ID NO:1, and the 101st nucleotide is read: if the sequencing peak is a single T peak, the individual's genotype is T / T homozygous; if the sequencing peak is a T / A double peak (overlapping peak), the individual's genotype is T / A heterozygous.

[0092] In addition to the PCR-sequencing method described above, those skilled in the art can also use other SNP genotyping techniques known in the art to detect the genotype of the polymorphic site at position 101 of SEQ ID NO:1.

[0093] For example, KASP (Kompetitive Allele-Specific PCR) technology can be used, with allele-specific primers and universal reverse primers designed according to SEQ ID NO:1, and the T / T or T / A genotype can be determined by the endpoint fluorescence signal; ARMS-PCR (Amplification Restriction Mutation System PCR) can be used, with specific primers designed for the T and A alleles respectively, and the genotype can be determined by conventional agarose gel electrophoresis; TaqMan probe method can also be used to design allele-specific MGB probes for real-time fluorescence PCR typing, or high-throughput platforms such as SNP chips, liquid / solid phase chips, and mass spectrometry can be used directly for large-scale genotyping. The specific primer sequences, probe sequences, and reaction conditions of the above methods can be determined by those skilled in the art based on the conventional design principles of each technology platform after obtaining the sequence information shown in SEQ ID NO:1, without requiring any creative effort.

[0094] Example 3: Molecular marker-assisted breeding method

[0095] This embodiment illustrates the specific application method of using the SNP molecular markers described in this application for marker-assisted selection (MAS) of snakehead fish to breed individuals with superior growth traits.

[0096] 3.1 Genotyping of the individual to be tested

[0097] For individuals in the selected snakehead seedlings or reserve parent population, the genotype of the polymorphic site at position 101 of SEQ ID NO:1 was detected according to the method described in Example 2, and the genotype of each individual to be tested was determined to be T / T or T / A.

[0098] 3.2 Selection of individuals with dominant genotypes

[0099] According to the association verification results of Example 1, the average weight of individuals with the T / T genotype was significantly higher than that of individuals with the T / A genotype (the population difference was found to be approximately 239 g, or about 30%; the independent verification population difference was approximately 236.7 g, or about 29%), indicating that the T allele is a favorable allele for increased weight.

[0100] Therefore, homozygous individuals carrying the T allele (T / T genotype) are selected as seedlings or reserve parents, while individuals with the T / A genotype are eliminated.

[0101] 3.3 Formation of the breeding population

[0102] Selected individuals with the T / T genotype were used to form a breeding population. Spawning, fertilization, and hatching were performed using conventional artificial breeding methods for snakehead fish to obtain offspring. Since both parents with the T / T genotype were homozygous for the favorable alleles, the offspring all exhibited the T / T genotype at that locus, resulting in a gradual increase in the average weight of the offspring population across generations.

[0103] Through continuous selection across multiple generations, the frequency of the T allele in the cultured population can be gradually increased, thereby achieving genetic improvement of the growth traits of snakehead fish.

[0104] The method described in this application can complete the early screening of individual growth potential in snakehead seedlings without raising them to harvest size, effectively shortening the generation selection cycle, reducing breeding costs, and improving breeding efficiency.

[0105] Based on the results of the above embodiments, this application also provides a kit product for detecting SNP molecular markers (Chr07:1,329,732, COL2A1 introns) related to the weight trait of snakehead fish. The kit includes the aforementioned primer pairs (SEQ ID NO:2, 3), and may also include DNA extraction reagents, PCR reaction premix, DNA purification reagents, etc. Using this kit product, the genotype of this SNP locus can be identified in snakehead fish samples using the method of Example 2.

[0106] The present application has been described in detail above. Specific examples have been used to illustrate the principles and implementation methods of the present application. The descriptions of the embodiments above are only for the purpose of helping to understand the present application and its core ideas. It should be noted that those skilled in the art can make several improvements and modifications to the present application without departing from the principles of the present application, and these improvements and modifications also fall within the protection scope of the claims of the present application.

Claims

1. A primer pair for detecting SNP molecular markers associated with the weight trait of snakehead fish, characterized in that, The SNP molecular marker is located at position 1329732 of chromosome 7, NC_090203.1, of the male snakehead genome GCF_033026475.1, corresponding to position 101 of the sequence shown in SEQ ID NO:

1. This position is a T>A single nucleotide polymorphism site. The primer pair is used to amplify the nucleotide fragment containing the SNP molecular marker located in the snakehead genome.

2. The primer pair according to claim 1, characterized in that, The primer pair includes: Upstream primer F: Nucleotide sequence as shown in SEQ ID NO:2; Downstream primer R: Nucleotide sequence shown in SEQ ID NO:

3.

3. A reagent kit, characterized in that, The kit contains the primer pair as described in claim 1 or 2.

4. The reagent kit according to claim 3, characterized in that, The kit also includes DNA extraction reagents, PCR reaction premix, and DNA purification reagents.

5. A method for detecting SNP molecular markers related to the weight trait of snakehead fish, characterized in that, Includes the following steps: S1. Extract genomic DNA from the snakehead fish to be tested; S2. Using the genomic DNA obtained in step S1 as a template, perform PCR amplification using the primer pair described in claim 1 or 2 to obtain the amplification product; S3. Sequencing analysis is performed on the amplification product obtained in step S2 to determine the genotype at position 101 of the sequence shown in SEQ ID NO:1, wherein the genotype is T / T or T / A.

6. The method according to claim 5, characterized in that, In step (2), the PCR amplification reaction system, with a total volume of 50 μL, includes: 25 μL of 2×PCR Mix, 1.5 μL each of upstream and downstream primers, 2 μL of DNA template, and 20 μL of ddH2O.

7. The method according to claim 5, characterized in that, In step (2), the PCR amplification program is as follows: 94 °C pre-denaturation for 5 min; 94 °C denaturation for 30 s, 59 °C annealing for 30 s, 72 °C extension for 45 s, 34 cycles; 72 °C extension for 10 min; cooling to 4 °C.

8. The method according to claim 5, characterized in that, The genotype at position 101 of the sequence shown in SEQ ID NO:1 can also be detected by at least one of the following methods: KASP, ARMS-PCR, TaqMan probes, or SNP chips.

9. A method for breeding snakehead fish, characterized in that, Includes the following steps: S1. Extract genomic DNA from the snakehead fish to be tested; S2. Using the genomic DNA obtained in step S1 as a template, perform PCR amplification using the primer pair described in claim 1 or 2 to obtain the amplification product; S3. Sequencing analysis is performed on the amplification products obtained in step S2 to determine the genotype of the SNP locus; the genotype is T / T or T / A. S4. Based on the sequencing results of step S3, select individuals with the T / T genotype for snakehead breeding and eliminate individuals with the T / A genotype.

10. The application of the primer pair according to claim 1 or 2 or the kit according to claim 2 or 3 in the screening of growth traits and / or breeding of snakehead fish, characterized in that, The growth trait referred to is body weight.

Images