Molecular marker closely linked to tomato brown rugose fruit virus disease resistance gene tbr3 and application thereof

Abstract

The application discloses a tomato gene resistant to tomato brown rugose fruit virus disease TBR3 The application provides a material for detecting specific DNA fragments in a tomato genome for identifying or assisting in identifying tomato resistance to tomato brown rugose fruit virus. The specific DNA fragments are DNA fragment A (319 bp target fragment shown in SEQ ID No. 3) or DNA fragment B (139 bp target fragment shown in SEQ ID No. 4). The application realizes early and accurate identification of the resistance of tomatoes to tomato brown rugose fruit virus disease, and has the advantages of convenience, high efficiency, accuracy, good repeatability and high specificity. The application can be used for tomato molecular marker assisted breeding.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a gene related to resistance to tomato brown wrinkle fruit virus disease. TBR3 Tightly linked molecular markers and their applications. Background Technology

[0002] tomato( Solanum lycopersicum L. Tomatoes are one of the world's most important vegetables, but they are susceptible to various viral diseases throughout their growth cycle. Tomato mosaic virus (ToMV) was once a major disease affecting tomatoes; breeders have addressed this by introducing disease-resistant genes from Peruvian tomatoes. Tm-1,Tm2 2 ， The occurrence and spread of Tomato Brown Ruffle Fruit Virus (ToBRFV) were controlled. However, mutations in the motility protein of Tomato Brown Ruffle Fruit Virus (ToBRFV) caused traditional resistance genes to lose their effectiveness (Hak H, Spiegelman Z. 2021. The Tomato brown rugose fruit virus movement protein overcomes Tm-2(2)resistance in tomato while attenuating viral transport. MOLECULAR PLANT- MICROBE INTERACTIONS Tomato brown rugose fruit virus (ToBRFV) spreads extremely rapidly, causing brown necrotic spots on the fruit, severely impacting tomato quality and yield. ToBRFV can infect multiple tomato varieties, often leading to total crop failure. Most mainstream cultivated varieties on the market are susceptible to ToBRFV, seriously threatening the sustainable development of the global tomato industry (Zhang, S., Griffiths, J., Marchand, G., Bernards, M., Wang, A. 2022. Tomato brown rugose fruit virus: An emerging and rapidly spreading plant RNA virus that threatens tomato production worldwide). Mol Plant Pathol 23: 1262–1138.). In 2016, Salem et al. first reported on this in Jordan (Salem N, Mansour A, Ciuffo M, Falk BW, Turina M. 2016. A new tobamovirus infecting tomato crops in Jordan). ARCHIVES OF VIROLOGY161(2): 503-506.) ToBRFV was discovered on greenhouse tomato plants. It was introduced to China in 2019 (Yan ZY, Ma HY, Han SL, Geng C, Tian YP, Li XD. 2019. First report of Tomato brown rugose fruit virus Infecting tomatoes in China. PLANT DISEASE 103(11): 2973-2973.), On September 2, 2024, it was decided to add the Tomato Brown Wrinkle Fruit Virus to the "National List of Quarantine Pests of Agricultural Plants". The main symptoms of this virus on tomatoes are mosaic leaves with dark green protrusions, wrinkled and narrow leaves, yellowing and even necrosis of leaf veins, yellow or brown patches on the fruit, uneven coloring and mottling of the fruit, and in severe cases, necrosis of the fruit stalk (Luria N, Smith E, Reingold V, Bekelman I, Lapidot M, Levin I, Elad N, Tam Y, Sela N, Abu-Ras A, et al. 2017. A New Israeli tobamovirus isolate infects tomato plants harboring Tm-22 resistance genes). PLoS One 12(1): e0170429.) The main mode of transmission is mechanical transmission. Discovering resistance genes and cultivating resistant varieties through backcross breeding and marker-assisted selection are the most economical and efficient methods for disease control. Currently, researchers have constructed an F2 population by crossing the disease-resistant material VC554 with the susceptible material MM. Through high-throughput sequencing and bioinformatics analysis, they discovered a recessive single-gene-controlled resistance gene on chromosome 11. On chromosome 2... Tm-1 The locus in the gene region interacts with a locus (BstNI_8.89QTL) found on chromosome 11 to regulate tomato resistance to ToBRFV (Zinger A, Lapidot M, Harel A, Doron-Faigenboim A, Gelbart D, Levin I. 2021. Identification and mapping of tomatogenome loci controlling tolerance and resistance to ToBRFV). Tomato brown rugose fruit virus . Plants (Basel) 10(1).), but no resistance genes have been reported.

[0003] Developing effective, easy-to-operate, and practical molecular markers for the gene of resistance to tomato brown wrinkled fruit virus (TWRV) is of great significance for breeding superior tomato varieties resistant to TWRV and effectively controlling the damage caused by TWRV. It is also an important innovation in breeding methods and technology. Summary of the Invention

[0004] The purpose of this invention is to provide a gene for resistance to tomato brown wrinkle fruit virus disease in tomatoes. TBR3 Tightly linked molecular markers and their applications.

[0005] In a first aspect, the present invention claims protection for the use of a substance for detecting specific DNA fragments in the tomato genome in any of the following: (A1) To identify or assist in the identification of tomato resistance to Tomato Brown Wrinkle Virus; (A2) Prepare products for identifying or assisting in the identification of tomato resistance to tomato brown wrinkle virus; (A3) Compare the resistance of the tested tomatoes to the tomato brown wrinkle virus; (A4) Prepare a product for comparing the resistance of the tested tomatoes to Tomato Brown Wrinkle Virus; (A5) Breed tomato varieties with relatively high resistance to tomato brown wrinkled fruit virus; (A6) Prepare products for breeding tomato varieties with relatively high resistance to tomato brown wrinkle virus; (A7) Screen out tomatoes with relatively low resistance to Tomato Brown Wrinkle Virus; (A8) Prepare a product for screening and eliminating tomatoes with relatively low resistance to Tomato Brown Wrinkle Virus; (A9) Tomato breeding; The specific DNA fragment is located within the physical region of chr2:23 Mb-33 Mb in the tomato genome and is associated with the tomato brown wrinkle fruit virus resistance gene. TBR3 The tightly linked molecular marker may be DNA fragment A or DNA fragment B; the nucleotide sequence of DNA fragment A (disease-resistant specific fragment) is SEQ ID No. 3; the nucleotide sequence of DNA fragment B (disease-susceptible specific fragment) is SEQ ID No. 4.

[0006] The substance may be a primer pair or a reagent or kit containing the primer pair. Furthermore, the primer pair consists of an upstream primer and a downstream primer; the upstream primer can be designed based on the upstream sequence of the specific DNA fragment on the tomato genome; the downstream primer can be designed based on the downstream sequence of the specific DNA fragment on the tomato genome.

[0007] In one embodiment of the present invention, the upstream primer is the DNA molecule shown in SEQ ID No. 1; and the downstream primer is the DNA molecule shown in SEQ ID No. 2.

[0008] In (A9), the purpose of the breeding is to obtain tomato varieties with relatively high resistance to Tomato Brown Wrinkle Virus. The same applies below.

[0009] Secondly, the present invention claims protection for primer pairs used to identify or assist in the identification of tomato resistance to tomato brown wrinkle virus.

[0010] The primer pair claimed in this invention for identifying or assisting in the identification of tomato resistance to tomato brown wrinkle virus consists of an upstream primer and a downstream primer; the upstream primer is the DNA molecule shown in SEQ ID No. 1; and the downstream primer is the DNA molecule shown in SEQ ID No. 2.

[0011] Thirdly, the present invention claims protection for reagents or kits containing the primer pairs described in the second aspect above.

[0012] Fourthly, this invention claims protection for a DNA molecule.

[0013] The DNA molecule claimed in this invention is located within the physical region of chr2:23 Mb-33 Mb in the tomato genome and is a resistance gene against tomato brown wrinkle fruit virus disease. TBR3 The tightly linked molecular marker may be DNA fragment A or DNA fragment B; the nucleotide sequence of DNA fragment A (disease-resistant specific fragment) is SEQ ID No. 3; the nucleotide sequence of DNA fragment B (disease-susceptible specific fragment) is SEQ ID No. 4.

[0014] Fifthly, the present invention claims protection for the use of the DNA molecule described in the fourth aspect above in any of the following: (A1) To identify or assist in the identification of tomato resistance to Tomato Brown Wrinkle Virus; (A2) Prepare products for identifying or assisting in the identification of tomato resistance to tomato brown wrinkle virus; (A3) Compare the resistance of the tested tomatoes to the tomato brown wrinkle virus; (A4) Prepare a product for comparing the resistance of the tested tomatoes to Tomato Brown Wrinkle Virus; (A5) Breed tomato varieties with relatively high resistance to tomato brown wrinkled fruit virus; (A6) Prepare products for breeding tomato varieties with relatively high resistance to tomato brown wrinkle virus; (A7) Screen out tomatoes with relatively low resistance to Tomato Brown Wrinkle Virus; (A8) Prepare a product for screening and eliminating tomatoes with relatively low resistance to Tomato Brown Wrinkle Virus; (A9) Tomato breeding.

[0015] Sixthly, the present invention claims protection for any of the following methods: Method I: A method for comparing the resistance of test tomatoes to Tomato Brown Curl Virus, comprising the following steps: detecting whether a specific DNA fragment on the genome of the test tomato is DNA fragment A or DNA fragment B (homozygous), and then determining the resistance of the test tomato to Tomato Brown Curl Virus as follows: The resistance of the tested tomato to Tomato with DNA fragment A as the specific DNA fragment is higher or candidate higher than that of the tested tomato with DNA fragment B as the specific DNA fragment. The specific DNA fragment is either DNA fragment A or DNA fragment B; The nucleotide sequence of DNA fragment A (disease-resistant specific fragment) is SEQ ID No. 3; the nucleotide sequence of DNA fragment B (disease-susceptible specific fragment) is SEQ ID No. 4.

[0016] Method II: A method for breeding tomato varieties with relatively high resistance to tomato brown wrinkle virus, comprising the following steps: detecting whether a specific DNA fragment on the genome of the tomato to be tested is DNA fragment A or DNA fragment B (homozygous); selecting the tomato to be tested with the specific DNA fragment being DNA fragment A as the parent for breeding; and selecting tomatoes with the specific DNA fragment being DNA fragment A in each generation of breeding to finally obtain tomato varieties with relatively high resistance to tomato brown wrinkle virus. The specific DNA fragment is either DNA fragment A or DNA fragment B; The nucleotide sequence of DNA fragment A (disease-resistant specific fragment) is SEQ ID No. 3; the nucleotide sequence of DNA fragment B (disease-susceptible specific fragment) is SEQ ID No. 4.

[0017] Method III: A method for screening and removing tomatoes with relatively low resistance to Tomato Brown Wrinkle Virus, comprising the following steps: detecting whether a specific DNA fragment on the genome of the tomato to be tested is DNA fragment A or DNA fragment B (homozygous), and screening out and removing the tomato to be tested whose specific DNA fragment is DNA fragment B; The specific DNA fragment is either DNA fragment A or DNA fragment B; The nucleotide sequence of DNA fragment A (disease-resistant specific fragment) is SEQ ID No. 3; the nucleotide sequence of DNA fragment B (disease-susceptible specific fragment) is SEQ ID No. 4.

[0018] Furthermore, the detection of whether the specific DNA fragment on the tomato genome to be tested is DNA fragment A or DNA fragment B can be performed according to a method including any of the following steps: (B1) Direct sequencing method; (B2) Using the genome of the tomato to be tested as a template, perform PCR amplification using the primer pair described in the second aspect above, and determine whether the specific DNA fragment on the genome of the tomato to be tested is DNA fragment A or DNA fragment B based on the amplification results.

[0019] This invention also claims protection for any of the following methods: Method I': A method for comparing the resistance of a tomato to brown wrinkled fruit virus, comprising the following steps: using the genome of the tomato to be tested as a template, performing PCR amplification using the primer pair described in the second aspect above, and determining the resistance of the tomato to brown wrinkled fruit virus according to the amplification results as follows: the resistance of the tomato to brown wrinkled fruit virus obtained by amplifying only a 319bp target fragment is higher or candidate higher than the resistance of the tomato to brown wrinkled fruit virus obtained by amplifying only a 139bp target fragment; Method II': A method for breeding tomato varieties with relatively high resistance to tomato brown wrinkle virus, comprising the following steps: using the genome of the tomato to be tested as a template, performing PCR amplification with the primer pair described in the second aspect above, selecting the tomato to be tested that amplifies only a 319bp target fragment as a parent for breeding, and selecting tomatoes that amplify only a 319bp target fragment in each generation of breeding, and finally obtaining tomato varieties with relatively high resistance to tomato brown wrinkle virus; Method III': A method for screening and removing tomatoes with relatively low resistance to Tomato Brown Wrinkle Virus, comprising the following steps: using the genome of the tomato to be tested as a template, performing PCR amplification with the primer pair described in the second aspect above, and screening out and removing the tomato to be tested that only yields a 139bp target fragment.

[0020] Furthermore, the nucleotide sequence of the 319bp target fragment is SEQ ID No. 3; the nucleotide sequence of the 139bp target fragment is SEQ ID No. 4.

[0021] In one embodiment of the invention, the tomato is selected from a hybrid offspring of tomato TG016, tomato TG132, or both. Hybridization may include backcrossing and / or self-pollination.

[0022] This invention is the first to screen and identify an InDel molecular marker closely linked to resistance to tomato brown wrinkle fruit virus from chromosome 2 of tomato. The InDel molecular marker of this invention can accurately identify the resistance and susceptibility traits of tomatoes to tomato brown wrinkle fruit virus at an early stage. It has the advantages of being simple, fast, efficient, accurate, reproducible, and specific, and can be used for molecular marker-assisted breeding of tomatoes. Attached Figure Description

[0023] Figure 1 The sequence alignment results are for the 319bp disease-resistant specific fragment (SEQ ID No. 3) and the 139bp disease-susceptible specific fragment (SEQ ID No. 4).

[0024] Figure 2 This is an electrophoresis pattern of the PCR amplification products of the disease-resistant introgression line L2 and the susceptible tomato TG132. In the figure, the amplification band of the disease-resistant introgression line L2 is A, with a product size of 319 bp; the amplification band of the susceptible tomato TG132 is B, with a product size of 139 bp; M is the marker. The marker bands from bottom to top are 250 bp and 500 bp, respectively.

[0025] Figure 3 This is an electrophoretic pattern of PCR amplification products from some individual plants in the F2 population, which was created by crossing the disease-resistant introgression line L2 with the susceptible tomato TG132. In the figure, A represents the amplification band of the homozygous L2 genotype, B represents the amplification band of the homozygous TG132 genotype, H represents the amplification band of the heterozygous genotype, and M is the marker. The marker bands from bottom to top are 250 bp and 500 bp, respectively.

[0026] Figure 4 The statistical analysis results show the relative ToBRFV load of homozygous L2 and homozygous TG132 genotypes in the F2 population. In the figure, A represents F2 individual plants with the L2 genotype, and B represents F2 individual plants with the TG132 genotype. Different lowercase letters indicate significant differences (P<0.05). Detailed Implementation

[0027] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0028] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0029] Both tomatoes TG016 and TG132 were purchased from Shandong Huaxian Agricultural Technology Co., Ltd.

[0030] The resistance and susceptibility of tomato varieties TG016 and TG132 to ToBRFV were assessed as follows: Viral load was measured in materials three weeks after ToBRFV inoculation. TG016 showed no detectable ToBRFV virus, indicating it is a resistant variety. TG132 showed detectable virus presence, indicating it is a susceptible variety (see [link to relevant documentation]). Figure 4 ).

[0031] The method for obtaining the disease-resistant introgression line L2 is as follows: TG016 and TG132 are crossed to obtain F1. TG132 is used as the recurrent parent for continuous backcrossing. In each generation, molecular markers are used for marker-assisted selection to select plants with the TG016 background type in the target region. After eight generations of backcrossing, except for the target segment which has the genetic background of TG016, the genetic background of all other segments originates from the recurrent parent TG132. Then, one more generation of self-crossing is performed to obtain the introgression line L2.

[0032] Select the marker sequence (5'-3') used for filtering: SSR586-F:TCCATCTAAGGCTTTGCCG; SSR586-R: ACAAAGGAAGTGGGAGAGCA.

[0033] CT140-F: CCTTCCAAAGCCAACATCTT; CT140-R:ACACAAGAGCATTTTAAGTTGGT.

[0034] Example 1: Resistance gene for tomato brown wrinkled fruit virus disease TBR3 Creation of linked molecular markers 1. Screening for disease-resistant introgression lines Seventy introgression lines of ToBRFV-resistant tomato TG016 and susceptible tomato TG132 were inoculated with ToBRFV, and RNA was extracted three weeks later. Viral load was quantitatively determined using RT-qPCR, with three biological replicates for each material.

[0035] Internal reference primer F: 5'-TTGCTGACCGTATGAGCAAG-3'; Internal reference primer R: 5'-GGACAATGGATGGACCAGAC-3'.

[0036] qPCRToBRFV: 5'-AAATCAGGCGAACCCG-3'; qPCRToBRFV: 5'-GCAGAGGACCATTGTAAACC-3'.

[0037] ΔCt = Ct target gene - Ct internal reference gene.

[0038] ΔCt = ΔCt experimental group - ΔCt control group.

[0039] (1) Calculate the expression level ΔCt of the target gene relative to the internal reference gene for each sample; (2) Calculate the mean ΔCt in the control group, and then subtract the mean ΔCt of the control group from each ΔCt in the treatment group to obtain ΔCt (expression level of the experimental group relative to the control). (3) Using formula 2 -ΔΔCt Calculate the expression level of each sample in the experimental group relative to the control group. Then calculate the average value of the experimental group.

[0040] Using the infected tomato TG132 as a control, the viral load of TG132 was recorded as 1, and a viral load below 0.2 was considered a resistant introgression line. The resistant introgression line L2 was screened out, with a relative viral load of 0.21.

[0041] 2. TBR3 position Based on the physical map of the disease-resistant introgression line L2, using Heinz 1706 SL4.0 as the reference genome, the mapping interval was determined to be chr2: 23 Mb-33 Mb. That is, the only difference between the disease-resistant introgression line L2 and the susceptible tomato TG132 is that the fragment between chr2: 23 Mb-33 Mb has been replaced with the corresponding fragment from the disease-resistant tomato TG016.

[0042] 3. Resistance gene for tomato brown wrinkled fruit virus disease TBR3 Development and Synthesis of Linked Molecular Markers The physical region of chr2 (23 Mb-33 Mb) was searched using the online primer design software Primer3 (https: / / primer3.ut.ee / ). Forward amplification primer F and reverse amplification primer R were designed. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and their nucleotide sequences are as follows: Upstream primer F: 5'-ACGGCTCACTTGCATAGCA-3' (SEQ ID No. 1); Downstream primer R: 5'-TCCATGGGTCGTTTTCCCT-3' (SEQ ID No. 2).

[0043] When the genome of the disease-resistant tomato TG016 or the disease-resistant introgression line L2 is used as a template, this primer pair can amplify a 319bp disease-resistant specific fragment (SEQ ID No. 3).

[0044] When the genome of the susceptible tomato TG132 is used as a template, this primer pair can amplify a 139bp susceptible-specific fragment (SEQ ID No. 4).

[0045] The sequence alignment results of the 319bp disease resistance-specific fragment (SEQ ID No. 3) and the 139bp disease susceptibility-specific fragment (SEQ ID No. 4) are as follows: Figure 1 As shown.

[0046] Using this primer pair to target the resistance gene against tomato brown wrinkled fruit virus disease. TBR3 The specific steps for detecting linked molecular markers are as follows: a. Extraction of whole-genome DNA from tomatoes using the CTAB method.

[0047] b. PCR amplification: The PCR reaction system consists of 10 μL of 2×Taq Mix; 1 μL each of primers F and R; 20-100 ng of DNA template; and ddH2O to make up to 20 μL.

[0048] PCR amplification program: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 50℃ annealing for 30 s, 72℃ extension for 20 s, 35 cycles; 72℃ extension for 10 min.

[0049] c. Electrophoresis detection: PCR products were detected by 2% agarose gel electrophoresis, yielding a 319bp resistance-specific band and / or a 139bp susceptibility-specific band, which was used to analyze the resistance of tomato plants to ToBRFV. Samples showing only the 319bp specific fragment (SEQ ID No. 3) were homozygous resistant; samples showing only the 139bp specific fragment (SEQ ID No. 4) were homozygous susceptible; and samples showing both the 319bp and 139bp specific fragments (SEQ ID No. 3 and SEQ ID No. 4) were heterozygous resistant.

[0050] Example 2: Molecular markers for resistance to tomato brown wrinkled fruit virus disease TBR3 Application 1. 160 plants from the F2 population, a cross between the disease-resistant introgression line L2 and the susceptible tomato TG132, were used to extract their whole-genome DNA using the CTAB method: a. Freeze tomato leaves in liquid nitrogen, grind them, take 0.5 g of the sample into a 2 mL centrifuge tube, add 0.7 mL of preheated CTAB, incubate in a 65℃ water bath for 30 min, inverting the tube once every 15 min; b. Add 0.7 mL of chloroform:isoamyl alcohol mixture (volume ratio 24:1), invert to mix, and centrifuge at 12000 rpm for 15 min; c. Take the supernatant, add an equal volume of isopropanol, mix by inversion, and let stand at -20℃ for 30 min; d. Centrifuge at 12000 rpm for 10 min, discard the supernatant, and wash twice with 70% alcohol; e. Dry, dissolve in 50 μL ddH2O, and store at -20℃ for later use.

[0051] 2. PCR amplification: The PCR reaction system consisted of 10 μL of 2×Taq Mix, 1 μL each of primers F and R, 20-100 ng of DNA template, and ddH2O to a final volume of 20 μL.

[0052] 3. PCR amplification procedure: Pre-denaturation at 94℃ for 5 min; 94℃ denaturation for 30 s, 50℃ annealing for 30 s, 72℃ extension for 20 s, 35 cycles; Extend at 72℃ for 10 minutes.

[0053] 4. Agarose gel electrophoresis PCR products were detected by 2% agarose gel electrophoresis. The electrophoretic patterns of PCR amplification products of the disease-resistant introgression line L2 and the susceptible tomato TG132 are shown below. Figure 2 As shown, the electrophoretic patterns of PCR amplification products in some F2 single plants are as follows: Figure 3 As shown.

[0054] 5. Results Analysis The genotype of the tomato sample to be tested is determined based on the molecular weight of the PCR amplification product: if the PCR amplification product of the tomato sample to be tested has only one 319bp band, then the tomato sample to be tested is homozygous L2 genotype; if the PCR amplification product of the tomato sample to be tested has only one 139bp band, then the tomato sample to be tested is homozygous TG132 genotype; if the PCR amplification product of the tomato sample to be tested has both one 319bp band and one 139bp band, then the tomato sample to be tested is heterozygous genotype.

[0055] Among the F2 strains, 41 were homozygous for the L2 genotype. Sequencing of the PCR products showed that all of them had the sequence SEQ ID No. 3. The ToBRFV viral load of the 41 homozygous L2 genotype F2 strains was 0.227 ± 0.0162.

[0056] Among the F2 strains, 47 were homozygous for the TG132 genotype. Sequencing of the PCR products showed that all of them had the sequence SEQ ID No. 4. The ToBRFV viral load of the 47 homozygous TG132 genotype F2 strains was 1.05 ± 0.0243.

[0057] Furthermore, a T-test was performed on the ToBRFV viral load in the two groups ( Figure 4 The results showed that the ToBRFV virus load in homozygous L2 genotype F2 plants was significantly lower than that in homozygous TG132 genotype F2 plants, indicating that the molecular marker for resistance to tomato brown wrinkle fruit virus developed in this invention is effective. TBR3 It is associated with tomato resistance to ToBRFV and has important breeding application value.

[0058] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. Application of substances that detect specific DNA fragments in the tomato genome in any of the following: (A1) To identify or assist in the identification of tomato resistance to Tomato Brown Wrinkle Virus; (A2) Prepare products for identifying or assisting in the identification of tomato resistance to tomato brown wrinkle virus; (A3) Compare the resistance of the tested tomatoes to the tomato brown wrinkle virus; (A4) Prepare a product for comparing the resistance of the tested tomatoes to Tomato Brown Wrinkle Virus; (A5) Breed tomato varieties with relatively high resistance to tomato brown wrinkled fruit virus; (A6) Prepare products for breeding tomato varieties with relatively high resistance to tomato brown wrinkle virus; (A7) Screen out tomatoes with relatively low resistance to Tomato Brown Wrinkle Virus; (A8) Prepare a product for screening and eliminating tomatoes with relatively low resistance to Tomato Brown Wrinkle Virus; (A9) Tomato breeding; The specific DNA fragment is either DNA fragment A or DNA fragment B; The nucleotide sequence of DNA fragment A is SEQ ID No. 3; the nucleotide sequence of DNA fragment B is SEQ ID No.

4.

2. The application according to claim 1, characterized in that: The substance is a primer pair or a reagent or kit containing the primer pair; The primer pair consists of an upstream primer and a downstream primer; the upstream primer is designed based on the upstream sequence of the specific DNA fragment on the tomato genome; and the downstream primer is designed based on the downstream sequence of the specific DNA fragment on the tomato genome.

3. The application according to claim 2, characterized in that: The upstream primer is the DNA molecule shown in SEQ ID No. 1; the downstream primer is the DNA molecule shown in SEQ ID No.

2.

4. Primer pairs used for identifying or assisting in the identification of tomato resistance to tomato brown wrinkle virus, characterized in that: The primer pair consists of an upstream primer and a downstream primer; the upstream primer is the DNA molecule shown in SEQ ID No. 1; and the downstream primer is the DNA molecule shown in SEQ ID No.

2.

5. A reagent or kit containing the primer pair as described in claim 4.

6. A DNA molecule whose nucleotide sequence is SEQ ID No. 3 or SEQ ID No.

4.

7. The use of the DNA molecule of claim 6 in any of the following: (A1) To identify or assist in the identification of tomato resistance to Tomato Brown Wrinkle Virus; (A2) Prepare products for identifying or assisting in the identification of tomato resistance to tomato brown wrinkle virus; (A3) Compare the resistance of the tested tomatoes to the tomato brown wrinkle virus; (A4) Prepare a product for comparing the resistance of the tested tomatoes to Tomato Brown Wrinkle Virus; (A5) Breed tomato varieties with relatively high resistance to tomato brown wrinkled fruit virus; (A6) Prepare products for breeding tomato varieties with relatively high resistance to tomato brown wrinkle virus; (A7) Screen out tomatoes with relatively low resistance to Tomato Brown Wrinkle Virus; (A8) Prepare a product for screening and eliminating tomatoes with relatively low resistance to Tomato Brown Wrinkle Virus; (A9) Tomato breeding.

8. Any of the following methods: Method I: A method for comparing the resistance of test tomatoes to Tomato Brown Wrinkle Virus, comprising the following steps: detecting whether a specific DNA fragment on the genome of the test tomato is DNA fragment A or DNA fragment B, and then determining the resistance of the test tomato to Tomato Brown Wrinkle Virus as follows: The resistance of the tested tomato to Tomato with DNA fragment A as the specific DNA fragment is higher or candidate higher than that of the tested tomato with DNA fragment B as the specific DNA fragment. Method II: A method for breeding tomato varieties with relatively high resistance to tomato brown wrinkle virus, comprising the following steps: detecting whether a specific DNA fragment on the genome of the tomato to be tested is DNA fragment A or DNA fragment B; selecting the tomato to be tested with the specific DNA fragment being DNA fragment A as the parent for breeding; and selecting tomatoes with the specific DNA fragment being DNA fragment A in each generation of breeding to finally obtain tomato varieties with relatively high resistance to tomato brown wrinkle virus. Method III: A method for screening and removing tomatoes with relatively low resistance to Tomato Brown Wrinkle Virus, comprising the following steps: detecting whether a specific DNA fragment on the genome of the tomato to be tested is DNA fragment A or DNA fragment B, and screening out and removing the tomato to be tested if the specific DNA fragment is DNA fragment B; In the method, the specific DNA fragment is either DNA fragment A or DNA fragment B; The nucleotide sequence of DNA fragment A is SEQ ID No. 3; the nucleotide sequence of DNA fragment B is SEQ ID No.

4.

9. The method according to claim 8, characterized in that: The determination of whether the specific DNA fragment on the tomato genome to be tested is DNA fragment A or DNA fragment B is performed according to a method including any of the following steps: (B1) Direct sequencing method; (B2) Using the genome of the tomato to be tested as a template, perform PCR amplification using the primer pair described in claim 4, and determine whether the specific DNA fragment on the genome of the tomato to be tested is DNA fragment A or DNA fragment B based on the amplification results.

10. Any of the following methods: Method I': A method for comparing the resistance of a tomato to brown wrinkled fruit virus, comprising the following steps: using the genome of the tomato to be tested as a template, performing PCR amplification with the primer pair described in claim 4, and determining the resistance of the tomato to brown wrinkled fruit virus according to the amplification results as follows: the resistance of the tomato to brown wrinkled fruit virus obtained by amplifying only a 319bp target fragment is higher or a candidate higher than the resistance of the tomato to brown wrinkled fruit virus obtained by amplifying only a 139bp target fragment; Method II': A method for breeding tomato varieties with relatively high resistance to tomato brown wrinkle virus, comprising the following steps: using the genome of the tomato to be tested as a template, performing PCR amplification with the primer pair described in claim 4, selecting the tomato to be tested that amplifies only a 319bp target fragment as a parent for breeding, and selecting tomatoes that amplify only a 319bp target fragment in each generation of breeding, and finally obtaining tomato varieties with relatively high resistance to tomato brown wrinkle virus; Method III': A method for screening and removing tomatoes with relatively low resistance to Tomato Brown Wrinkle Virus, comprising the following steps: using the genome of the tomato to be tested as a template, performing PCR amplification with the primer pair described in claim 4, and screening out and removing the tomato to be tested that only yields a 139bp target fragment.

Images