Common wheat snp site marker and its application in detection of lycopene content in wheat kernel

Abstract

This invention discloses a common wheat SNP locus marker and its application in the detection of lycopene content in wheat grains. This invention provides the application of substances that detect the Ta-7A-SNP locus haplotype in the wheat genome in the identification or auxiliary identification of lycopene content in wheat grains. This invention utilizes molecular marker methods to identify a Ta-7A-SNP locus on wheat chromosome 7A. Based on this SNP locus, a molecular marker was developed. Marker / trait association analysis in 245 Chinese wheat germplasms revealed a highly significant correlation between the SNP locus and lycopene content in wheat grains. P <0.01). Furthermore, this marker exhibits good repeatability and low cost, facilitating the screening of wheat lines or varieties with high lycopene content in their grains, which is of great significance for breeding new wheat varieties with high lycopene content.

Description

Technical Field

[0001] This invention belongs to the fields of molecular detection technology and crop genetics and breeding, and specifically relates to the SNP site markers of common wheat and their application in the detection of lycopene content in wheat grains. Background Technology

[0002] Lycopene is a fat-soluble carotenoid that accounts for approximately 50% of the total carotenoids in the human body. It possesses powerful antioxidant and free radical scavenging abilities, exhibiting beneficial effects in delaying aging, inhibiting tumors, preventing cardiovascular and cerebrovascular diseases, and enhancing human immunity (Mueller et al. 2016; Liang et al. 2019). Epidemiological surveys have found that individuals deficient in lycopene have a higher risk of acute myocardial infarction and stroke (Karppi et al. 2012). Humans and animals lack the necessary lycopene synthesis pathway and must rely on external intake. Lycopene is primarily found in red, yellow, or orange vegetables and fruits (Liang et al. 2019). Due to economic constraints, dietary habits, and dietary structures, especially in underdeveloped areas where people consume few vegetables and fruits in addition to staple foods, lycopene intake is often insufficient. Therefore, increasing the lycopene content of staple crops is an economical and effective way to supplement lycopene intake.

[0003] Wheat is a widely cultivated staple food crop globally. In recent years, improving the nutritional and health qualities of wheat has become an important research direction and breeding goal worldwide (Ashokkumar et al. 2020; Colasunno et al. 2019; Zhang et al. 2016). Considering the indispensable role of lycopene in human nutrition and the importance of wheat in providing dietary calories, increasing the lycopene content of wheat grains through biofortification holds promise for supplementing lycopene through daily diet. Identifying lycopene-related genes or QTLs in wheat grains and developing tightly linked molecular markers for assisted selection can significantly improve breeding selection efficiency and provide molecular-assisted selection methods for breeding wheat varieties with high lycopene content and excellent quality.

[0004] Currently, there are no reports on the genetic loci related to lycopene content in wheat. Therefore, in-depth exploration of functional markers that can be used for lycopene detection in wheat, and the use of these markers to screen wheat varieties with high lycopene content, is of great significance for accelerating the improvement and breeding of wheat varieties with high lycopene content. Summary of the Invention

[0005] To address the aforementioned problems, the present invention aims to propose a SNP locus related to lycopene content in wheat grains and its application, thereby enabling genotyping of the Ta-7A-SNP locus that regulates lycopene content in wheat grains and predicting whether lycopene content in wheat grains will increase.

[0006] In a first aspect, the present invention provides the application of a substance for detecting the Ta-7A-SNP haplotype of the SNP site in the wheat genome in any of the following: 1) To identify or assist in the identification of lycopene content in wheat grains; 2) Screening or assisting in screening wheat with high lycopene content in the grains; 3) Select wheat varieties with high lycopene content in their grains; The SNP site Ta-7A-SNP is the 66th position of SEQ ID NO: 1.

[0007] In the application described above, the SNP site Ta-7A-SNP has a haplotype of CC, GG, or GC.

[0008] In the application described above, the substance used to detect the Ta-7A-SNP haplotype at the SNP site in the wheat genome is either A1 or A2. A1) Primer set; A2) PCR reagents or kits containing the complete set of primers described above; The primer set includes primer 1, primer 2 and primer 3; The nucleotide sequence of primer 1 includes the sequence shown in positions 22-42 of SEQ ID NO: 2; The nucleotide sequence of primer 2 includes the sequence shown in positions 22-42 of SEQ ID NO: 3; The nucleotide sequence of primer 3 is SEQ ID NO: 4.

[0009] In the application described above, the nucleotide sequence of primer 1 is SEQ ID NO: 2; The nucleotide sequence of primer 2 is SEQ ID NO: 3.

[0010] Secondly, the present invention provides any of the following substances: The primer set described in the first aspect; Alternatively, PCR reagents or kits containing the primer set described in the first aspect.

[0011] The PCR reagents mentioned above include primers 1, 2, 3 and HiGeno 2X Probe Mix (Beijing Jiacheng Biotechnology Co., Ltd., AQP-002L). In an embodiment of the present invention, the final concentration of primer 1 in the PCR reagent is 0.168 μM, the final concentration of primer 2 in the PCR reagent is 0.168 μM, and the final concentration of primer 3 in the PCR reagent is 0.42 μM.

[0012] Thirdly, the present invention provides the use of the primer kits described in the first aspect, and the PCR reagents or kits described in the second aspect, in any of the following: 1) To identify or assist in the identification of lycopene content in wheat grains; 2) Screening or assisting in screening wheat with high lycopene content in the grains; 3) Select wheat varieties with high lycopene content in their grains.

[0013] Fourthly, the present invention provides a method for identifying or assisting in the identification of lycopene content in wheat grains, comprising the following steps: detecting whether the SNP site Ta-7A-SNP haplotype in the wheat genome is CC or GG, and the lycopene content of the wheat grains to be tested with the haplotype CC at the Ta-7A-SNP site is greater than or candidate greater than that of the wheat grains to be tested with the haplotype GG at the Ta-7A-SNP site.

[0014] Fifthly, the present invention provides a method for breeding wheat with high lycopene content in grains, comprising the following steps: detecting whether the SNP site Ta-7A-SNP haplotype in the wheat genome is CC or GG, selecting wheat with the Ta-7A-SNP site haplotype CC for breeding, and obtaining the target wheat.

[0015] The method described above, which detects whether the SNP site Ta-7A-SNP haplotype in the wheat genome is CC or GG, includes the following steps: using the wheat genome to be tested as a template, performing a KASP reaction with the PCR reagent described in the second aspect to obtain the haplotype.

[0016] The KASP reaction procedure described above is as follows: Pre-denaturation at 95℃ for 10 min; denaturation at 95℃ for 20 s; annealing and extension at 61℃ for 40 s, 10 cycles, with a decrease of 0.6℃ per cycle; denaturation at 95℃ for 20 s, annealing and extension at 55℃ for 40 s, 32 cycles; 37℃ for 1 min, 37℃ for 1 s (scan fluorescence values ​​for genotyping).

[0017] In the above text, the amplification products were detected using a Bio-RAD CFX96 real-time PCR instrument, and the KASP reaction was used to obtain the haplotypes. Genotyping was then performed based on the fluorescence data. If the fluorescence signal of the amplified product aggregates in a sample close to the X-axis, it is a FAM fluorescent tag sequence, then the haplotype of the wheat Ta-7A-SNP site to be tested is GG homozygous. If the fluorescence signal of the amplified product aggregates in a sample close to the Y-axis, it is a sample linked to a HEX fluorescent tag sequence, then the haplotype of the wheat Ta-7A-SNP site to be tested is CC homozygous.

[0018] This invention utilizes molecular markers to identify a SNP site, Ta-7A-SNP, on wheat chromosome 7A. Based on this SNP site, a molecular marker was developed. Marker / trait association analysis in Chinese wheat microcore germplasm revealed a highly significant correlation between the SNP site and lycopene content in wheat grains. P The value was <0.01), and its application was further verified during the breeding process. Furthermore, this marker is a KASP marker, exhibiting good reproducibility and low cost, showing promising application prospects in molecular marker-assisted selection and molecular design breeding for increasing lycopene content in wheat grains. Attached Figure Description

[0019] Figure 1 HPLC peak chromatograms and standard curves for standards of different concentrations.

[0020] Figure 2 Comparison of lycopene content of Ta-7A-SNP marker in 245 Chinese wheat germplasms (A) and DH population (B) under different environments. Detailed Implementation

[0021] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0022] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0023] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0024] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0025] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0026] The wheat varieties used in these examples were all obtained from the China Crop Germplasm Information Network (CCERS), and the unified numbers in Table 1 are the network's internal numbers. The website address is: https: / / www.cgris.net / home.

[0027] Example 1: Discovery of Ta-7A-SNP sites and acquisition of KASP marker-specific primers I. Discovery of Ta-7A-SNP sites 1. Detection of lycopene content in seeds Using 245 Chinese wheat germplasm accessions shown in Table 1 as materials, they were planted at the Chinese Academy of Agricultural Sciences experimental base in Xinxiang City, Henan Province (35°18'N, 113°54'E) in 2017-2018, and at the Hancun experimental base of the Wheat Research Institute in Linfen City, Shanxi Province (36°2'W, 111°18'E) in 2018-2019. The Xinxiang City test materials were planted under irrigated (18XXW) conditions, while the Linfen City test materials were planted under both irrigated (19LFW) and rain-fed (19LFR) conditions.

[0028] The lycopene content of 245 wheat samples was further determined by high-performance liquid chromatography (HPLC) (Li et al. 2022). Specifically, 1.0 g of whole wheat flour was added to 6 mL of extraction solution (BHT dissolved in an organic solvent, with a BHT mass percentage (g:mL) of 0.1%; the organic solvent was a mixture of acetone and methanol at a volume ratio of 7:3). The solution was vortexed vigorously for 45 s and then placed in a constant-temperature shaker at 80 rpm and 35 ℃ in the dark for 1 h. After shaking, the solution was centrifuged at 10828 g and 4 ℃ for 10 min using a high-speed low-temperature centrifuge, and the supernatant was collected. This extraction was repeated twice. The supernatant was dried using a nitrogen dryer at 35 ℃. The remaining residue was mixed with 3 mL of diethyl ether and 3 mL of organic solution 2 (a mixture of 50% KOH aqueous solution and ethanol at a volume ratio of 1:9, g / mL), and shaken at room temperature in the dark for 2 h to obtain a solution. 3 mL of the solution was taken, and 3 mL of a solution of diethyl ether and n-hexane at a volume ratio of 1:1 and 3 mL of water were added. The mixture was centrifuged at 7000 g and 4 °C for 10 min. The aqueous phase containing KOH was removed using a syringe, and the mixture was dried under nitrogen at 35 °C. The resulting solid was reconstituted with 0.5 mL of a methanol / acetonitrile / n-hexane (7:2:1, v / v / v) solution containing 0.1% (g / mL) BHT. After complete dissolution, the mixture was centrifuged at 13000 g and 4 °C for 5 min. The supernatant was filtered through a 0.22 μm organic filter membrane into a brown centrifuge tube and stored at -20 °C.

[0029] An Agilent 1260 high-performance liquid chromatograph was used, with a Poroshell 120 EC-C18 analytical column (4.6 × 150 mm, 4 μm particle size). The mobile phase consisted of acetonitrile (A), methanol (B), and n-hexane (C). The mobile phase was filtered through a 0.22 μm organic filter and then degassed by sonication for 20 min. Gradient elution was performed for 30 min at a flow rate of 1.0 mL / min. -1 The detection wavelength was 450 nm, and the temperatures of the injector and column oven were maintained at 4℃ and 25℃, respectively. The initial elution conditions were 76% mobile phase A, 21.5% mobile phase B, and 2.5% mobile phase C. The proportion of mobile phase A decreased from 76% to 70% within 20-22 min, and that of mobile phase B decreased from 21.5% to 20% within the same timeframe. Within 28-30 min, phase A increased to 76%, and phase B increased to 21.5%. Lycopene standard (Sigma-Aldrich (Shanghai) Trading Co., Ltd., 75051-10MG) was used to determine the elution conditions and retention time. Figure 1 A) Lycopene in the sample was identified by retention time, peak area was obtained by automatic integration, and quantification was performed using the external standard method. Figure 1 B). Each sample was measured three times, and the average value was taken.

[0030] 2. Genome-wide association analysis and discovery of significant association markers Ta-7A-SNPs SNP genotyping was performed on 245 wheat varieties using the wheat 90K SNP chip, revealing 24,747 SNP markers that differed among the 245 varieties. Genome-wide association analysis (GWAS) was conducted using a mixed linear model based on TASSEL 5.0, incorporating high-quality SNP markers, population structure, and phylogenetic relationships, with threshold values... P <0.001 or log10( P When the concentration of lycopene is greater than 3, it is found that the SNP site Ta-7A-SNP is significantly associated with the lycopene content of seeds.

[0031] The Ta-7A-SNP site haplotype is CC, GG, or GC.

[0032] Wheat varieties with the haplotype CC at the Ta-7A-SNP site have higher lycopene content in their grains than wheat varieties with the haplotype GG at the Ta-7A-SNP site (e.g., Figure 2 As shown, 18XXW represents irrigation in Xinxiang in 2018; 19LFW represents irrigation in Linfen in 2019; 19LFR represents rain-fed agriculture in Linfen in 2019; 19YD represents planting in Yaodu District, Linfen City in 2019; 20YD represents planting in Yaodu District, Linfen City in 2020; 20HC represents planting in Hancun Base, Linfen City in 2020; and BLUP represents the best linear unbiased prediction.

[0033] The Ta-7A-SNP site is located on chromosome 7A of the wheat genome, and it is nucleotide s at position 66 of SEQ ID NO: 1, where s is G or C.

[0034] II. Development of KASP-labeled primers for detecting Ta-7A-SNP sites Based on the design rules of KASP primers, KASP primers for amplifying the Ta-7A-SNP site were designed.

[0035] As a primer for detecting Ta-7A-SNP, it consists of 3 primer sequences (sequences as shown in SEQ ID NO: 2-4), as follows: Primer 1 KASP-7A-SNP-FAM: GAAGGTGACCAAGTTCATGCTtcaatcgaggcgttggaccgG (SEQ ID NO: 2) Primer 2 KASP-7A-SNP-HEX: GAAGGTCGGAGTCAACGGATTtcaatcgaggcgttggaccgC (SEQ ID NO: 3) Primer 3 KASP-7A-SNP-R: atggcgtccacatatggtgttct (SEQ ID NO: 4) Among them, GAAGGTGACCAAGTTCATGCT is the FAM fluorescent tag sequence carried at the 5' end of primer 1 KASP-7A-SNP-FAM, and GAAGGTCGGAGTCAACGGATT is the HEX fluorescent tag sequence carried at the 5' end of primer 2 KASP-7A-SNP-HEX.

[0036] Scatter plots based on KASP markers showed clusters of different germplasms along the X-(FAM) and Y-(HEX) axes. Genotypes were determined by detecting the fluorescence signal of the amplification products. The amplification products of primers 1 and 3 only showed the color of the FAM fluorescent tag, with strong FAM signals concentrated in the lower right corner of the scatter plot, indicating that the haplotype of the tested wheat Ta-7A-SNP site was GG homozygous. The amplification products of primers 2 and 3 only showed the color of the HEX fluorescent tag, with strong HEX signals concentrated in the upper left corner of the scatter plot, indicating that the haplotype of the tested wheat Ta-7A-SNP site was CC homozygous.

[0037] III. Establishment of a method for detecting the haplotype of Ta-7A-SNP loci 1. Extracting wheat genomic DNA for testing 2. Using the extracted DNA as a template, PCR amplification was performed using the KASP primers shown in SEQ ID NO: 2-4; The amplification process is as follows: (1) Preparation of KASP primer working solution The three primers were diluted to 100 μM, and then mixed in the following ratios: 12 μL of primer 1 KASP-7A-SNP-FAM, 12 μL of primer 2 KASP-7A-SNP-HEX, 30 μL of primer 3 KASP-7A-SNP-R, and 46 μL of ddH2O to prepare the KASP-7A-SNP Assay Mix working solution.

[0038] (2) KASP reaction system and procedure The 10 μL reaction system for the 96-well plate consisted of: 5 μL HiGeno 2X Probe Mix (Beijing Jiacheng Biotechnology Co., Ltd., AQP-002L), 1.2 μL DNA template (approximately 50 ng), 0.14 μL KASP-7A-SNP Assay Mix working solution, and 3.8 μL ddH2O.

[0039] The concentrations of primer 1 KASP-7A-SNP-FAM, primer 2 KASP-7A-SNP-HEX, and primer 3 KASP-7A-SNP-R in the reaction system were 0.168 μM and 0.42 μM respectively.

[0040] The KASP reaction procedure is as follows: Pre-denaturation at 95℃ for 10 min; denaturation at 95℃ for 20 s; annealing and extension at 61℃ for 40 s, 10 cycles, each cycle decreasing by 0.6℃; denaturation at 95℃ for 20 s, annealing and extension at 55℃ for 40 s, 32 cycles; 37℃ for 1 min, 37℃ for 1 s (scan fluorescence values ​​for genotyping).

[0041] 3. The amplification products were detected using a Bio-RAD CFX96 real-time PCR instrument, and genotyping was performed based on the fluorescence data.

[0042] If the fluorescence signal of the amplification product is FAM fluorescence signal, then the base of the wheat Ta-7A-SNP site to be tested is G, and the haplotype is GG; if the fluorescence signal of the amplification product is HEX fluorescence signal, then the base of the wheat Ta-7A-SNP site to be tested is C, and the haplotype is CC.

[0043] The lycopene content in wheat grains with the Ta-7A-SNP site haplotype CC was higher than that in wheat grains with the site haplotype GG.

[0044] Since wheat is a self-pollinating crop with a low proportion of heterozygous sites in its genome, this experiment will not study the heterozygous genotype of the Ta-7A-SNP site.

[0045] Therefore, allele-specific KASP genotyping of wheat samples can be performed using forward primer 1 (SEQ ID NO: 2) with a FAM sequence tag, forward primer 2 (SEQ ID NO: 3) with a HEX sequence tag, and reverse primer 3 (SEQ ID NO: 4) with KASP-7A-SNP-R (SEQ ID NO: 4). The lycopene content in the grains of the wheat samples was determined by whether the haplotype at the Ta-7A-SNP site was CC or GG. Wheat with the CC haplotype had a higher lycopene content in its grains than wheat with the GG haplotype. The CC haplotype indicates a high-lycopene-content line, demonstrating that this marker can assist in the selection of wheat grain lycopene content, providing a molecular-assisted selection method for breeding wheat varieties with high lycopene content.

[0046] Example 2: Application of Ta-7A-SNP locus in detecting lycopene content in wheat grains from natural populations Taking the 245 wheat samples in Table 1 as an example, the lycopene content in the grains was detected according to method 1 of Example 1.

[0047] Haplotype detection of the Ta-7A-SNP locus was performed on these 245 wheat samples using the method shown in Example 1, and KASP reaction and data analysis were conducted using a Bio-RAD CFX96 real-time PCR instrument. Genotypes aggregated near the X-axis with FAM fluorescent tag sequences indicated a GG homozygous haplotype at the corresponding Ta-7A-SNP locus; genotypes aggregated near the Y-axis with HEX fluorescent tag sequences indicated a CC homozygous haplotype at the corresponding Ta-7A-SNP locus.

[0048] The results are shown in Table 1.

[0049] Table 1 shows the lycopene content and Ta-7A-SNP site haplotypes of 245 wheat germplasms.

[0050] Of the 245 wheat materials, 234 had the haplotype GG at the Ta-7A-SNP site, 9 had the haplotype CC at the Ta-7A-SNP site, and 2 had the haplotype GC at the Ta-7A-SNP52 site (discarded).

[0051] Statistical analysis was performed on the lycopene content and the haplotype of the Ta-7A-SNP site in 245 wheat grain samples.

[0052] The results are as follows Figure 2 As shown in Figure A, the mean lycopene content under the three environments of 18XXW, 19LFW, and 19LFR is as follows: the mean lycopene content of wheat grains with the Ta-7A-SNP site type CC is 0.371 µg / g; the mean lycopene content of wheat grains with the Ta-7A-SNP site type GG is 0.217 µg / g; the lycopene content of wheat grains with the Ta-7A-SNP site type CC is significantly higher than that of wheat grains with the Ta-7A-SNP site type GG. P <0.01).

[0053] Therefore, it can be determined or used as a supplementary indicator that wheat materials with the CC haplotype at the Ta-7A-SNP site are wheat with high lycopene content.

[0054] Example 3: Functional verification of the Ta-7A-SNP locus in a genetic population Ta-7A-SNP in Jinchun No. 7 (Wang Y, Qiao L, Yang CK, Li XH, Zhao JJ, Wu BB, Zheng XW, Li PB and Zheng J. Identification of genetic loci for flag-leaf-related traits in wheat( Triticum aestivum There are differences between L.) and their effects on grainyield. Front. Plant Sci. 2022, 13:990287) and Jinmai 919 (Zheng Jun et al. 2020). DH populations (180 lines) constructed using these two parents were planted at the Wheat Research Institute of Yaodu District, Linfen City, Shanxi Province in 2019–2020 (19YD) and 2020–2021 (20YD), and at the Hancun Experimental Base of Linfen City, Shanxi Province in 2020–2021 (20HC).

[0055] The lycopene content in the seeds of the DH population was detected using the method described in Example 1-1.

[0056] Genotyping of the population was performed using the method described in Example 1, Part 3, with KASP-Ta-7A-SNP markers. PCR reactions and data analysis were conducted using a Bio-RAD CFX96 real-time PCR instrument.

[0057] The results are as follows Figure 2 As shown in B, the average lycopene content of wheat grains in the Ta-7A-SNP haplotype CC was 0.422 μg / g; the average lycopene content of wheat grains in the Ta-7A-SNP haplotype GG was 0.330 μg / g; the Ta-7A-SNP haplotype CC lines were all significantly higher than the Ta-7A-SNP haplotype GG lines. P <0.01).

[0058] Example 4: Application of the Ta-7A-SNP site in detecting lycopene content in wheat grains of progeny materials Jinmai 919 and DH118 (Wang Y, Qiao L, Yang CK, Li XH, Zhao JJ, Wu BB, Zheng XW, Li PB and Zheng J. Identification of genetic loci for flag-leaf-related traits in wheat( Triticum aestivum L.) and their effects on grainyield. Front. Plant Sci. 2022, 13:990287) The F1 generation after hybridization was then self-crossed to obtain the F4 generation; The lycopene content in the seeds of 78 F4 generation strains was detected using the method described in Example 1-1.

[0059] The 78 lines of the F4 generation were genotyped using the KASP-Ta-7A-SNP marker according to the method in Example 1. The PCR reaction and genotyping were performed using a Bio-RAD CFX96 real-time PCR instrument.

[0060] The results are as follows: Among the 78 F4 generations, 27 lines had the haplotype CC at the Ta-7A-SNP site, 43 lines had the haplotype GG at the Ta-7A-SNP site, and 8 lines had the haplotype CG at the Ta-7A-SNP site (discarded). The average lycopene content of wheat grains tested with the Ta-7A-SNP haplotype CC was 0.407 μg / g; the average lycopene content of wheat grains tested with the Ta-7A-SNP haplotype GG was 0.278 μg / g. The lines with the Ta-7A-SNP haplotype CC were all significantly higher than those with the Ta-7A-SNP haplotype GG. P <0.01).

[0061] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. Detection of substances with the Ta-7A-SNP haplotype at the SNP site in the wheat genome in any of the following applications: 1) To identify or assist in the identification of lycopene content in wheat grains; 2) Screening or assisting in screening wheat with high lycopene content in the grains; 3) Select wheat varieties with high lycopene content in their grains; The SNP site Ta-7A-SNP is the 66th position of SEQ ID NO:

1.

2. The application according to claim 1, characterized in that: The SNP site Ta-7A-SNP has a haplotype of GG, CC, or GC.

3. The application according to claim 1 or 2, characterized in that: The substance used to detect the Ta-7A-SNP haplotype at the SNP site in the wheat genome is either A1 or A2. A1) Primer set; A2) PCR reagents or kits containing the complete set of primers described above; The primer set includes primer 1, primer 2 and primer 3; The nucleotide sequence of primer 1 includes the sequence shown in positions 22-42 of SEQ ID NO: 2; The nucleotide sequence of primer 2 includes the sequence shown in positions 22-42 of SEQ ID NO: 3; The nucleotide sequence of primer 3 is SEQ ID NO:

4.

4. The application according to claim 3, characterized in that: The nucleotide sequence of primer 1 is SEQ ID NO: 2; The nucleotide sequence of primer 2 is SEQ ID NO:

3.

5. Any of the following substances: The primer set as described in claim 3 or 4; Alternatively, a PCR reagent or kit containing the primer set as described in claim 3 or 4.

6. The use of the primer set, PCR reagent, or kit according to claim 5 in any of the following: 1) To identify or assist in the identification of lycopene content in wheat grains; 2) Screening or assisting in screening wheat with high lycopene content in the grains; 3) Select wheat varieties with high lycopene content in their grains.

7. A method for identifying or assisting in the identification of lycopene content in wheat grains, comprising the following steps: detecting whether the SNP site Ta-7A-SNP haplotype in the wheat genome is CC or GG, wherein the lycopene content of the wheat grains to be tested with the haplotype CC at the Ta-7A-SNP site is greater than or candidate greater than the lycopene content of the wheat grains to be tested with the haplotype GG at the Ta-7A-SNP site.

8. A method for breeding wheat with high lycopene content in grains, comprising the following steps: detecting whether the SNP site Ta-7A-SNP haplotype in the wheat genome is CC or GG, selecting wheat with the Ta-7A-SNP site haplotype CC for breeding, and obtaining the target wheat.

9. The method according to claim 7 or 8, characterized in that: The method for detecting whether the SNP site Ta-7A-SNP in the wheat genome is CC or GG includes the following steps: using the wheat genome to be tested as a template, performing a KASP reaction with the PCR reagent described in claim 5 to obtain the haplotype.

Images