SNP molecular marker of sorghum plant height related gene SbPH51 and application thereof

Abstract

The application discloses a SNP molecular marker of a sorghum plant height related gene SbPH51 and application thereof. The application solves the technical problem of identifying or assisting in identifying the sorghum plant height. Specifically disclosed is application of a substance for detecting polymorphism or genotypes of two SNPs, SNP1 and SNP2, in identifying or assisting in identifying the sorghum plant height, or in preparing a product for identifying or assisting in identifying the sorghum plant height, wherein the SNP1 is the 357th nucleotide in SEQ ID NO:1 in the sequence listing, which is A or G; and the SNP2 is the 925th nucleotide in SEQ ID NO:1 in the sequence listing, which is C or G. It is found through detection of various sorghum genomes that the sorghum plant height with the genotype AACC is higher than or is a candidate for being higher than the sorghum plant height with the genotype GGGG, and the molecular marker and a substance for identifying the molecular marker can be used in genetic breeding of the sorghum plant height.

Description

Technical Field

[0001] This invention belongs to the field of gene biotechnology, specifically relating to genes related to sorghum plant height. SbPH51 SNP molecular markers and their applications. Background Technology

[0002] Soil salinization is one of the major challenges facing agriculture worldwide. Globally, 955 million hectares of soil are threatened by salinization, with secondary salinization expanding at an average annual rate of 1.5%. Salinization severely inhibits crop growth and leads to significant yield reductions by damaging soil structure, causing osmotic stress, and resulting in ion poisoning. Soil salinization is a crucial factor affecting crop growth and yield, seriously hindering sustainable agricultural development. Saline-alkali land is an important reserve of arable land for ensuring national food security and sustainable agricultural development, as well as a reserve of arable land to meet the increasing food demand brought about by population growth. Therefore, cultivating and planting salt-tolerant crops is of great significance for agricultural production and the improvement and utilization of saline-alkali land.

[0003] Salt stress has varying effects on sorghum at different growth stages, with the most severe impact on biomass accumulation occurring during the seedling and vegetative growth stages. Even after salt stress is relieved, plants can partially recover, but growth remains significantly limited. Plant height is one of the important traits of forage sorghum and is highly correlated with biomass. Plant height significantly affects sorghum growth, photosynthetic efficiency, lodging resistance, and harvesting, and is a key factor determining yield. Studies have shown a generally significant positive correlation between sorghum plant height and grain yield. Higher plant height results in greater biomass; therefore, breeding taller sorghum varieties can effectively increase biomass, produce more resources, and achieve higher economic benefits.

[0004] By studying the genes that regulate sorghum plant height, obtaining KASP molecular markers that are closely linked to plant height genes, locating and detecting major gene loci for sorghum plant height, effectively regulating sorghum plant height type, and breeding new sorghum varieties with the desired plant height type, it is of great significance for improving the biomass yield of forage sorghum. Summary of the Invention

[0005] The technical problem to be solved by this invention is how to identify or assist in the identification of sorghum plant height traits or how to conduct sorghum breeding.

[0006] To address the above technical problems, this invention provides primers for identifying or assisting in the identification of sorghum plant height. The primers can be primer set F1, primer combination F1-F2, or primer set F2. The primer set F1 may be a combination of primers F1-A, F1-B, and F1-C; primer F1-A may be a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence listing or a single-stranded DNA molecule whose nucleotide sequence is positions 22-41 of sequence 2 in the sequence listing; primer F1-B may be a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence listing or a single-stranded DNA molecule whose nucleotide sequence is positions 22-40 of sequence 3 in the sequence listing; and F1-C may be a single-stranded DNA molecule whose nucleotide sequence is sequence 4 in the sequence listing. The primer compositions F1-F2 may be compositions consisting of primer sets F1 and F2, wherein primer set F2 may include primers F2-A, F2-B, and F2-C; primer F2-A may be a single-stranded DNA molecule whose nucleotide sequence is sequence 5 in the sequence listing or a single-stranded DNA molecule whose nucleotide sequence is positions 22-41 of sequence 5 in the sequence listing; primer F2-B may be a single-stranded DNA molecule whose nucleotide sequence is sequence 6 in the sequence listing or a single-stranded DNA molecule whose nucleotide sequence is positions 22-39 of sequence 6 in the sequence listing; and primer F2-C may be a single-stranded DNA molecule whose nucleotide sequence is sequence 7 in the sequence listing.

[0007] F1-A (SEQ ID NO: 2): 5'- GAAGGTGACCAAGTTCATGCT CTGGTCACTGCCCAACAAGA -3'; F1-B (SEQ ID NO: 3): 5'-GAAGGTCGGAGTCAACGGATT TGGTCACTGCCCAACAAGG -3'; F1-C (SEQ ID NO: 4): 5'-CTCCCTCAGGTTCCCCAAGTAGTT-3'.

[0008] The primer set F2 for identifying SNP2 polymorphism is as follows: F2-A (SEQ ID NO: 5): 5'- GAAGGTGACCAAGTTCATGCT CTGGAGCTCATCGTCCTCC -3' F2-B (SEQ ID NO: 6): 5'-GAAGGTCGGAGTCAACGGATT TGGAGCTCATCGTCCTCG -3' F2-C (SEQ ID NO: 7): 5'-CGGCTGAAATGGCCTTACT-3' This invention also provides a method for identifying or assisting in the identification of sorghum plant height, the method including A1 and / or A2. The A1 may include detecting the genotype of SNP1 in the sorghum to be tested, and identifying or assisting in the identification of sorghum plant height based on the genotype of SNP1 in the sorghum to be tested. The sorghum plant height of the genotype of SNP1 is higher than or candidate to be higher than that of the sorghum plant with the genotype of GG. The SNP1 is a single nucleotide polymorphism site in the sorghum genome, which is the 357th nucleotide of SEQ ID NO: 1 in the sequence listing, and it is A or G. The genotype of SNP1 is AA, which is homozygous for the 357th nucleotide of SEQ ID NO: 1 in the sequence listing being A. The genotype of SNP1 is GG, which is homozygous for the 357th nucleotide of SEQ ID NO: 1 in the sequence listing being G. The A2 may include detecting the genotype of SNP2 in the sorghum to be tested, and identifying or assisting in the identification of sorghum plant height based on the genotype of SNP2 in the sorghum to be tested. The sorghum plant height of the genotype CC of SNP2 is higher than or candidate to be higher than that of the sorghum plant with the genotype GG. SNP2 is a single nucleotide polymorphism site in the sorghum genome, which is the 925th nucleotide of SEQ ID NO: 1 in the sequence listing, and it is C or G. The genotype CC of SNP2 is a homozygous type of the 925th nucleotide of SEQ ID NO: 1 in the sequence listing being C, and the genotype GG of SNP2 is a homozygous type of the 925th nucleotide of SEQ ID NO: 1 in the sequence listing being G.

[0009] This invention also provides a method for sorghum breeding, which can be M1 or M2. M1 may include detecting the genotypes of SNP1 and / or SNP2 in the genome of the sorghum to be tested, using the sorghum to be tested with the genotype GGGG as the parent, and breeding sorghum with low plant height (sorghum with a plant height lower than the parent), wherein GGGG is the genotype where SNP1 is GG and SNP2 is GG. M2 may include detecting SNP1 and / or SNP2 in the genotype of the sorghum to be tested, selecting the sorghum to be tested with the genotype AACC as the parent, and cultivating tall sorghum (sorghum with a plant height higher than the parent), wherein AACC is the genotype where SNP1 is AA and SNP2 is CC.

[0010] The present invention can also detect the genotype of SNP1 in the sorghum to be tested, and identify or assist in identifying the sorghum plant height based on the genotype of SNP1 in the sorghum to be tested. The sorghum plant height of SNP1 with genotype AA is higher than or candidate to be higher than that of sorghum with genotype GG; or, it includes detecting the genotype of SNP2 in the sorghum to be tested, and identifying or assisting in identifying the sorghum plant height based on the genotype of SNP2 in the sorghum to be tested. The sorghum plant height of SNP2 with genotype CC is higher than or candidate to be higher than that of sorghum with genotype GG.

[0011] This invention can also detect the haplotype of the sorghum to be tested. The haplotype is the polymorphic combination of the two SNPs, SNP1 and SNP2, on one chromosome of the sorghum to be tested. The plant height of the homozygous genotype corresponding to haplotype SbPH51-Hap1 is lower or candidate lower than that of the homozygous genotype corresponding to haplotype SbPH51-Hap2. The haplotype SbPH51-Hap1 is a haplotype where SNP1 is G and SNP2 is G, and the haplotype SbPH51-Hap2 is a haplotype where SNP1 is A and SNP2 is C.

[0012] The present invention also provides applications, which may be N1, N2, N3 or N4; The N1 refers to the substance used to detect the polymorphism or genotype of SNP1 and SNP2 mentioned above in sorghum breeding and / or identification or auxiliary identification of sorghum plant height. The N2 is a substance for detecting haplotypes used in sorghum breeding and / or identification or auxiliary identification of sorghum plants. The haplotype is a polymorphic combination of the two SNPs, SNP1 and SNP2, mentioned above, on a chromosome of sorghum. The N3 is a substance used to detect the polymorphism or genotype of SNP1 mentioned above in sorghum breeding and / or identification or auxiliary identification of sorghum plant height. The N4 is a substance used to detect the polymorphism or genotype of the SNP2 mentioned above in sorghum breeding and / or identification or auxiliary identification of sorghum plant height.

[0013] The application may also be Q1, Q2, Q3 or Q4; Q1 can be the application of substances that detect the polymorphism or genotype of the two SNPs SNP1 and SNP2 mentioned above in the preparation of products for sorghum breeding and / or identification or auxiliary identification of sorghum plant height. Q2 can be the application of substances for detecting haplotypes in sorghum breeding and / or identification or auxiliary identification of sorghum plants. The haplotype is the polymorphic combination of the two SNPs, SNP1 and SNP2, mentioned above, on a chromosome of sorghum. Q3 can be the application of substances that detect the polymorphism or genotype of SNP1 mentioned above in the preparation of products for sorghum breeding and / or identification or auxiliary identification of sorghum plant height; Q4 can refer to the application of substances that detect the polymorphism or genotype of SNP2 mentioned above in the preparation of products for sorghum breeding and / or identification or auxiliary identification of sorghum plant height.

[0014] The genotype of SNP1 can be AA, GG, or AG, where AA is homozygous for SNP1 being A; GG is homozygous for SNP1 being G; and AG is heterozygous for SNP1 being both A and G. The genotype of SNP2 can be CC, GG, or CG, where CC is homozygous for SNP2 being C; GG is homozygous for SNP2 being G; and CG is heterozygous for SNP2 being both C and G. The sorghum plant height with genotype AACC is higher than that with genotype GGGG. AACC is a combination of two SNPs where the genotype of SNP1 is AA and the genotype of SNP2 is CC, and GGGG is a combination of two SNPs where the genotype of SNP1 is GG and the genotype of SNP2 is GG.

[0015] In the above applications, the substance may be C1), C2), or C3). C1) The substance described is a primer composition for amplifying sorghum genomic DNA fragments including the SNP1 and / or SNP2 sites. C2) The substance described is a PCR reagent containing the primer composition described in C1). C3) The substance is a kit containing the primer composition described in C1) or the PCR reagent described in C2).

[0016] The present invention also provides a product, which may be any of the following: B1) The PCR primers mentioned above; B2) PCR reagents containing the PCR primers described in B1); B3) A kit containing the PCR primers described in B1) or the PCR reagents described in B2); B4) A detection instrument containing the PCR primers described in B1), the PCR reagents described in B2), or the kit described in B3).

[0017] In this invention, the sorghum can be a pure sorghum line or a self-pollinated sorghum line.

[0018] The present invention also provides a DNA molecule, which may be sequence 1 in the sequence listing.

[0019] Alternatively, the DNA molecule can be used as a detection target.

[0020] The substance that detects the SNP polymorphism and genotype or the haplotype can be combined with other substances (such as substances that detect single nucleotide polymorphisms or genotypes of other molecular markers related to sorghum plant height) to prepare a product for identifying sorghum plant height varieties.

[0021] The present invention also provides applications of the DNA molecule, wherein the application may be any of the following: D1) Determine the height of sorghum plants; D2) Preparation of products for identifying sorghum plant height; D3) Sorghum breeding; D4) Prepare breeding products related to sorghum plant height traits; D5) Products that detect single nucleotide polymorphisms or genotypes related to sorghum plant height; D6) Prepare products for identification or auxiliary identification of sorghum plant height.

[0022] In this invention, the indicator for sorghum breeding can be sorghum plant height; the purpose of sorghum breeding can be to screen individual plants, lines, strains, or varieties of sorghum according to plant height.

[0023] The sorghum plant height mentioned above refers specifically to the plant height at maturity.

[0024] In the applications and methods described above, sorghum inbred lines can be selected as parents for breeding.

[0025] In the above applications and methods, breeding tall sorghum may include selecting sorghum with the AACC genotype as a parent for breeding, and the method may include crossing the parent with another parent with a non-AACC genotype, wherein the tall sorghum variety has a plant height greater than the other parent; breeding short sorghum may include selecting sorghum with the GGGG genotype as a parent for breeding, and the method may include crossing the parent with another parent with a non-GGGG genotype, wherein the short sorghum variety has a plant height less than the other parent. In the above applications, methods, and products, the substance may be a reagent and / or instrument required to determine the polymorphism or genotype of the SNP by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and SNP chips. The SNP chips include chips based on nucleic acid hybridization reactions, chips based on single-base extension reactions, chips based on allele-specific primer extension reactions, chips based on one-step reactions, chips based on primer ligation reactions, chips based on restriction endonuclease reactions, chips based on protein-DNA binding reactions, and chips based on fluorescent molecule-DNA binding reactions.

[0026] In the above applications, methods, and products, the primer composition may or may not be labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be linked to a nucleic acid. Markers include, but are not limited to, dyes; radioactive markers, such as 32P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent, or fluorescent moieties; and fluorescent dyes alone or in combination with moieties whose emission spectra can be inhibited or shifted by fluorescence resonance energy transfer (FRET). The marker can provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetric determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moiety (positive or negative charge) or, optionally, charge-neutral. The marker can include nucleic acid or protein sequences or combinations thereof, provided that the sequence containing the marker is detectable. In some embodiments, nucleic acids are detected directly without labeling (e.g., direct sequence reading).

[0027] This invention utilizes the analysis of sorghum inbred line populations... SbPH51 Genetic variation analysis revealed two SNPs, with SNP1 located in a gene in the sorghum genome associated with plant height. SbPH51 In the gene sequence, specifically at position 357 of SEQ ID NO: 1, SNP2 is located in the sorghum genome and is associated with plant height. SbPH51 The gene sequence, specifically position 925 of SEQ ID NO: 1, provides primer compositions for amplifying sorghum genomic DNA fragments including SNP1 and SNP2, and primer compositions for amplifying sorghum genomic DNA fragments including SNP1 and SNP2. It also provides a method for identifying or assisting in the identification of sorghum plant height using these primer compositions. The method established in this invention can be used to predict the phenotypic effect of sorghum on plant height, for early screening of sorghum to be screened, and for marker-assisted breeding of sorghum. It has significant application value in the research of discovering sorghum germplasm resources with higher plant height and breeding taller sorghum varieties. Attached Figure Description

[0028] Figure 1 The results are the molecular marker validation results of 30 sorghum samples using primer sets F1 and F2. Detailed Implementation

[0029] The 221 sorghum inbred line associations in the following examples were provided by the Jing Haichun Laboratory of the Ecological Grassland and Animal Husbandry Laboratory, Institute of Botany, Chinese Academy of Sciences, and are disclosed in Table S1 of the following document: Wu X., Liu Y., Luo H., Shang L., Leng C., Liu Z., Li Z., Lu X., Cai H., Hao H., and Jing H.-C. (2022). Genomic footprints of sorghum domestication and breeding selection for multiple end uses. Mol. Plant 15, 537-551. Detailed information on the varieties is shown in Table 1, where the variety names correspond to the Sample ID column in Table S1. The public can obtain these 221 sorghum inbred line related populations from the applicant. This biological material is solely for the purpose of replicating experiments of this invention and may not be used for any other purpose.

[0030] Example 1: Discovery of SNP molecular markers related to sorghum plant height I. Plant height statistics of the tested materials 1. Cultivation of test materials The test materials consisted of 221 sorghum germplasm resources, which were planted in early May 2025 in experimental fields in moderately to severely saline-alkali land in Hexi Town, Guide County, Hainan Tibetan Autonomous Prefecture, Qinghai Province. All experimental fields adopted a randomized complete block design. The experimental plots were 3m long and 2m wide, with 3 rows of 20 plants per row, a plant spacing of 0.3m, and a row spacing of 0.5m. Conventional management and normal irrigation were implemented.

[0031] 2. Plant height statistics of the tested materials After the 221 sorghum inbred lines were fully mature, 5 plants were selected from each material, and the height of the main stem of each plant was counted. The average of three replicates was taken as the final result of the plant height of the sample, as shown in Table 1.

[0032] II. Genes SbPH51 Discovery of related SNP molecular markers 1. Whole-genome sequencing of 221 sorghum inbred line associated populations Whole-genome sequencing data of 221 sorghum inbred line populations were provided by the Jing Haichun Laboratory of the Ecological Grassland and Animal Husbandry Laboratory, Institute of Botany, Chinese Academy of Sciences.

[0033] 2. Genes SbPH51 Discovery of related SNP molecular markers Based on the plant height of sorghum inbred lines and their genome sequencing results, a gene related to sorghum plant height was screened. SbPH51The haplotype combination comprises two SNP sites: SNP1 corresponds to position 45622085 on chromosome 10 of the sorghum inbred line BTx623, with nucleotides A or G, corresponding to position 357 of SEQ ID NO: 1 in the sequence listing, denoted by R; SNP2 corresponds to position 45622653 on chromosome 10 of the sorghum inbred line BTx623, with nucleotides C or G, corresponding to position 925 of SEQ ID NO: 1 in the sequence listing, denoted by S.

[0034] Sequence 1 (SEQ ID NO: 1) is as follows:

[0035] The genotyping results for each sorghum variety are shown in Table 1. The results show that there are two genotypes at SNP1 (referred to as SNP1 genotypes): AA or GG. Genotype AA is homozygous for SNP1 with an A nucleotide, and genotype GG is homozygous for SNP1 with a G nucleotide. The homozygous SNP1 with an A nucleotide is homozygous for nucleotide A at position 357 of sequence 1, and the homozygous SNP1 with a G nucleotide is homozygous for nucleotide G at position 357 of sequence 1. Similarly, there are two genotypes at SNP2 (referred to as SNP2 genotypes): CC or GG. Genotype CC is homozygous for SNP2 with a C nucleotide, and genotype GG is homozygous for SNP2 with a G nucleotide. The homozygous SNP2 with a C nucleotide is homozygous for nucleotide C at position 925 of sequence 1, and the homozygous SNP2 with a G nucleotide is homozygous for nucleotide G at position 925 of sequence 1.

[0036] A detection method was designed based on the above genotypes.

[0037] III. Genes SbPH51 Design of specific primers for SNP molecular markers and establishment of related methods Based on the positive chain of SEQ ID NO: 1, specific primer sequences for SNP1 and SNP2 were designed and synthesized by Zhongyu Jin Marker (Beijing) Biotechnology Co., Ltd., forming primer compositions F1-F2, which consist of primer set F1 and primer set F2.

[0038] The primer set F1 for identifying SNP1 site polymorphism is as follows: Specific primer F1-A (SEQ ID NO: 2): 5'- GAAGGTGACCAAGTTCATGCT CTGGTCACTGCCCAACAAGA -3'; Specific primer F1-B (SEQ ID NO: 3): 5'-GAAGGTCGGAGTCAACGGATT TGGTCACTGCCCAACAAGG -3'; Universal primer F1-C (SEQ ID NO: 4): 5'-CTCCTCAGGTTCCCCAAGTAGTT-3'.

[0039] The primer set F2 for identifying SNP2 polymorphism is as follows: Specific primer F2-A (SEQ ID NO: 5): 5'- GAAGGTGACCAAGTTCATGCT CTGGAGCTCATCGTCCTCC -3' Specific primer F2-B (SEQ ID NO: 6): 5'-GAAGGTCGGAGTCAACGGATT TGGAGCTCATCGTCCTCG -3' Universal primer F2-C (SEQ ID NO: 7): 5'-CGGCTGAAATGGCCTTACT-3' The first 21 positions of primers F1-A and F2-A are FAM sequences; the first 21 positions of primers F1-B and F2-B are HEX sequences.

[0040] The fragment with SNP1 site A in SEQ ID NO: 1 of the single-stranded DNA molecule amplification sequence listing SEQ ID NO: 2 and SEQ ID NO: 4 can be read by an enzyme-linked immunosorbent assay (ELISA) reader or a real-time PCR instrument to detect the fluorescent signal of the fluorescent group bound to the FAM sequence in the template. The fragment with SNP1 at site G in SEQ ID NO: 1 of the single-stranded DNA molecule amplification sequence listing SEQ ID NO: 3 and SEQ ID NO: 4 can be read by an enzyme-linked immunosorbent assay (ELISA) reader or a real-time PCR instrument to detect the fluorescent signal of the fluorescent group in the template that binds to the HEX sequence.

[0041] The fragment with SNP2 at position C in SEQ ID NO: 1 of the single-stranded DNA molecule amplification sequence listing SEQ ID NO: 5 and SEQ ID NO: 7 can be read by an enzyme-linked immunosorbent assay (ELISA) reader or a real-time PCR instrument to detect the fluorescent signal of the fluorescent group bound to the FAM sequence in the template. The fragment with SNP2 at site G in the single-stranded DNA molecule amplification sequence SEQ ID NO: 1 shown in the above sequences SEQ ID NO: 6 and SEQ ID NO: 7 can be read by an enzyme-linked immunosorbent assay (ELISA) reader or a real-time PCR instrument to detect the fluorescent signal of the fluorescent group in the template that binds to the HEX sequence. Genomic DNA was extracted from the tested sorghum variety using a plant genomic DNA extraction kit (DP305-02, TIANGEN), dissolved in ddH2O to obtain a template, and then used for PCR amplification.

[0042] The template obtained above was amplified by PCR using the above SNP primer sets F1 and F2, respectively, to detect the polymorphism (nucleotide type) and genotype of the SNP site; the PCR products of the F1 and F2 primer sets were read by fluorescence data using the Douglas-Araya high-throughput automated fluorescence signal scanner, and the fluorescence signal was processed using Douglas-Kraken software.

[0043] Preparation of primer mixture: First, dilute primers F1-A, F1-B, and F1-C with ddH2O to a concentration of 100 mmol·L⁻¹. -1Primer solutions F1-A, F1-B, and F1-C were obtained separately. 60 μL of each primer solution was taken, along with 150 μL of each primer solution, and 230 μL of 10 mM Tris-HCl was added to obtain primer mixture F1. Primer solutions F2-A, F2-B, and F2-C were obtained using the same method. 60 μL of each primer solution was taken, along with 150 μL of each primer solution, and 230 μL of 10 mM Tris-HCl was added to obtain primer mixture F2.

[0044] If the PCR product of the F1 primer set shows only the fluorescent signal of the fluorescent group that binds to the FAM sequence (near the X-axis), then the genotype of the sorghum SNP1 locus to be tested is AA (i.e., the homozygous type of SNP1 (SbPH51-SNP1) locus in the sorghum genome is A); if it shows only the fluorescent signal of the fluorescent group that binds to the HEX sequence (near the Y-axis), then the genotype of the sorghum SNP1 locus to be tested is GG (i.e., the homozygous type of SNP1 (SbPH51-SNP1) locus in the sorghum genome is G; the control is near the origin of the XY axis. If the PCR product of the F2 primer set shows only the fluorescent signal of the fluorescent group that binds to the FAM sequence (near the X-axis), then the genotype of the sorghum SNP2 locus to be tested is CC (i.e., the homozygous type of the SNP2 (SbPH51-SNP2) locus in the sorghum genome is C); if it shows only the fluorescent signal of the fluorescent group that binds to the HEX sequence (near the Y-axis), then the genotype of the sorghum SNP2 locus to be tested is GG (i.e., the homozygous type of the SNP2 (SbPH51-SNP2) locus in the sorghum genome is G; the control is the blank control located near the origin of the XY axis).

[0045] Thirty sorghum varieties (251, Tu30, WSC85, 141, 398, 400, 168, 2031, 370, 2009, 139, 106, 123, 161, 392, 137, 2035, 43, 140, J136, 2027, J130, 2026, 51, 144, 131, 48, 197, 2010, and 2023) from Table 1 were selected for molecular marker validation. These varieties were planted in experimental fields in Hexi Town, Guide County, Hainan Tibetan Autonomous Prefecture, Qinghai Province in early May 2025. All experimental fields used a randomized complete block design. Each experimental plot was 3m long and 2m wide, with 3 rows of 20 plants per row, a plant spacing of 0.3m, and a row spacing of 0.5m. Standard management and normal irrigation were implemented.

[0046] The genotyping results of primer F1 on different sorghum germplasm resources are shown in the figure. Figure 1 The left-middle figure shows the genotyping results of primer group F2 on different sorghum germplasm resources.Figure 1 The image is shown in the middle right corner.

[0047] The results showed that primer set F1 could clearly separate the two homozygous genotypes of SNP1, AA and GG. The dots closer to the X-axis were homozygous genotypes carrying the A allele, with 28 samples, of which 17 (60%) were plants taller than 180 cm. The dots closer to the Y-axis were homozygous genotypes carrying the G allele, with 2 samples, of which 2 (100%) were plants shorter than 180 cm. The dots closer to the origin of the X and Y axes were blank controls.

[0048] Using primer F2, the two homozygous genotypes CC and GG for SNP2 can be clearly separated. The dots closer to the X-axis represent homozygous genotypes of CC carrying the C allele, totaling 28 samples. Among these, 17 samples (60%) are taller than 180cm. The dots closer to the Y-axis represent homozygous genotypes of GG carrying the G allele, totaling 2 samples. Among these, 2 samples (100%) are shorter than 180cm. The dots closer to the origin of the X and Y axes represent the blank control.

[0049] Therefore, the primer sets F1 and F2 provided by this invention can be used for the selection and breeding of sorghum plant height trait germplasm, and this invention accurately performs genotyping of sorghum plant height trait. This molecular marker can be applied to early large-scale germplasm screening to assist in the molecular breeding of functional sorghum.

[0050] Sorghum samples to be tested: 221 sorghum inbred line related populations In early May 2025, the experimental plots were planted in the moderately to severely saline-alkali land of Hexi Town, Guide County, Hainan Tibetan Autonomous Prefecture, Qinghai Province. All experimental plots adopted a randomized complete block design. The experimental plots were 3m long and 2m wide, with 3 rows of 20 plants per row, a plant spacing of 0.3m, and a row spacing of 0.5m. The plots were managed in a conventional manner and irrigated normally.

[0051] I. Measurement of Sorghum Plant Height The same detection method as in Example 1 was used to detect the genotype and plant height of 221 sorghum inbred lines in an associated population. The results are shown in Table 1. 221 sorghum inbred lines were planted in farmland soil in Hexi Town, Guide County, Hainan Tibetan Autonomous Prefecture, Qinghai Province, China. Detailed information on the varieties is shown in Table 1. Significant differences in plant height were observed among different sorghum varieties, ranging from 71.2 to 309.40 cm. 118 sorghum inbred lines had a plant height exceeding 180 cm, accounting for approximately 53.40% of the associated population.

[0052] II. Molecular identification or auxiliary identification of plant height of sorghum inbred lines Genomic DNA was extracted from the sorghum stalks to be tested and dissolved in ddH2O to serve as a template. PCR amplification was performed using the genome-specific primer set F1 and primer set F2 from Example 1, yielding... SbPH51 Polymorphism information of SNP sites in gene-related gamete genotypes is used to determine the genes of the sorghum stalk being tested. SbPH51 Related gamete genotypes and genotypes were used to identify or assist in identifying the plant height of the tested sorghum varieties: The plant height of sorghum with the genotype AACC for SNP1 and SNP2 (such as sorghum inbred lines) was higher than or candidate higher than that of sorghum with the genotype GGGG (such as sorghum inbred lines); gamete genotype SbPH51- The plant height of sorghum plants with the homozygous genotype Hap1 (AG) (such as sorghum inbred lines) is higher than or candidate to be higher than that of the gamete genotype. SbPH51- The homozygous genotype of sorghum corresponding to Hap2 (GG) (such as sorghum inbred lines).

[0053] The SNP genotypes and plant heights of the 221 sorghum samples tested are shown in Tables 1 and 2. The SNP loci in the tested sorghum samples contained two genotypes: AACC and GGGG (SNP1 and SNP2 genotypes are listed in the columns). Two haplotypes of SNP loci were found in the genome of the tested sorghum samples, namely haplotypes SbPH51-Hap1 (AC) and SbPH51-Hap2 (GG).

[0054] The test results showed that among the 221 sorghum varieties, 9 of the 211 varieties with gamete genotypes of SbPH51-Hap1(GG) (i.e., SNP1 genotype is GG and SNP2 genotype is GG) had a plant height of less than 180cm.

[0055] Among sorghum varieties with the SbPH51-Hap2(AC) genotype (i.e., SNP1 genotype AA, SNP2 genotype CC), 117 varieties had a plant height exceeding 180 cm. This means that 52.94% of sorghum varieties with the gamete genotype SbPH51-Hap1(AC) had a plant height exceeding 180 cm, while 90% of sorghum varieties with the gamete genotype SbPH51-Hap1(GG) had a plant height below 180 cm. This indicates that using the gamete genotype SbPH51-Hap1(GG) to eliminate low-plant-height sorghum varieties and selecting tall sorghum varieties with the gamete genotype SbPH51-Hap2(AC), and using this gamete genotype as a molecular marker for sorghum plant height-assisted selection, is indeed effective.

[0056] Table 1. Genotypes and plant height at two SNP loci in 221 sorghum varieties.

[0057] Notes: IS: Improved sweet sorghum; IG: Improved grain sorghum; LG: Local grain sorghum; AL: Unknown sorghum; LB: Local broom sorghum; Wild: Wild sorghum; Sudangrass: Forage sorghum; Weedy: Weedy sorghum The following examples use statistical software to process the data. The experimental results are expressed as mean ± standard deviation. An independent samples t-test is used. When the significance level is 0.05, a * is marked after the minimum mean; when the significance level is 0.01, a ** is marked after the minimum mean.

[0058] Significant differences were found between the two genotypes and plant height. Homozygous sorghum plants of haplotype SbPH51-Hap1 were shorter than those of haplotype SbPH51-Hap2 (P<0.01). Homozygous sorghum plants of haplotype SbPH51-Hap1 were shorter or candidate shorter than those of haplotype SbPH51-Hap.

[0059] Table 2. By gene SbPH51 The plant height of 221 sorghum inbred lines was statistically analyzed based on genotype and haplotype homozygous combinations.

[0060] The analysis of the differences between the genotype of individual SNP1 or SNP2 and plant height showed that there was a highly significant difference in plant height between sorghum with the genotype AA (SNP1 being a homozygous A type) and sorghum with the genotype GG (SNP1-GG) (P<0.01). The plant height of sorghum with the genotype SNP1-AA was higher than or candidate higher than that of sorghum with the genotype SNP1-GG.

[0061] The plant height of sorghum with the homozygous CC genotype of SNP2 (SNP3-CC) was significantly different from that of sorghum with the homozygous GG genotype (SNP3-GG) (P<0.01). The plant height of sorghum with the SNP2-CC genotype was higher than or candidate higher than that of sorghum with the SNP2-GG genotype.

[0062] Table 3 Genes SbPH51Analysis of plant height and differences among 221 sorghum inbred lines corresponding to different genotypes at two SNP loci

[0063] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. Primers used for identifying or assisting in the identification of sorghum plant height, characterized in that, The primers are primer set F1, primer combination F1-F2, or primer set F2. The primer set F1 is a composition consisting of primers F1-A, F1-B, and F1-C; primer F1-A is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence listing or whose nucleotide sequence is the single-stranded DNA at positions 22-41 of sequence 2 in the sequence listing; primer F1-B is a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence listing or whose nucleotide sequence is the single-stranded DNA at positions 22-40 of sequence 3 in the sequence listing; and F1-C is a single-stranded DNA molecule whose nucleotide sequence is sequence 4 in the sequence listing. The primer compositions F1-F2 are compositions composed of primer sets F1 and F2, wherein primer set F2 includes primers F2-A, F2-B, and F2-C; primer F2-A is a single-stranded DNA molecule whose nucleotide sequence is sequence 5 in the sequence listing or whose nucleotide sequence is the single-stranded DNA at positions 22-41 of sequence 5 in the sequence listing; primer F2-B is a single-stranded DNA molecule whose nucleotide sequence is sequence 6 in the sequence listing or whose nucleotide sequence is the single-stranded DNA at positions 22-39 of sequence 6 in the sequence listing; and primer F2-C is a single-stranded DNA molecule whose nucleotide sequence is sequence 7 in the sequence listing.

2. A method for identifying or assisting in the identification of sorghum plant height, characterized in that, The method includes A1 and / or A2, The A1 method includes detecting the genotype of SNP1 in the sorghum to be tested, and identifying or assisting in the identification of sorghum plant height based on the genotype of SNP1 in the sorghum to be tested. Sorghum plants with the genotype of SNP1 being AA have a higher or candidate higher plant height than sorghum plants with the genotype GG. SNP1 is a single nucleotide polymorphism site in the sorghum genome, which is the 357th nucleotide of SEQ ID NO: 1 in the sequence listing, and it is either A or G. The genotype of SNP1 being AA is a homozygous type where the 357th nucleotide of SEQ ID NO: 1 in the sequence listing is A, and the genotype of SNP1 being GG is a homozygous type where the 357th nucleotide of SEQ ID NO: 1 in the sequence listing is G. A2 includes detecting the genotype of SNP2 in the sorghum to be tested, and identifying or assisting in the identification of sorghum plant height based on the genotype of SNP2 in the sorghum to be tested. The sorghum plant height of the genotype CC of SNP2 is higher than or candidate to be higher than that of the sorghum plant with the genotype GG. SNP2 is a single nucleotide polymorphism site in the sorghum genome, which is the 925th nucleotide of SEQ ID NO: 1 in the sequence listing, and it is C or G. The genotype CC of SNP2 is a homozygous type of the 925th nucleotide of SEQ ID NO: 1 in the sequence listing, and the genotype GG of SNP2 is a homozygous type of the 925th nucleotide of SEQ ID NO: 1 in the sequence listing, which is G.

3. A method for sorghum breeding, wherein the method is M1 or M2. M1 includes detecting the genotypes of SNP1 and / or SNP2 in the genome of the sorghum to be tested. The sorghum to be tested with the genotype GGGG is used as the parent to cultivate sorghum with low plant height (sorghum with a plant height lower than the parent). The GGGG genotype is the genotype where SNP1 is GG and SNP2 is GG. M2 includes detecting SNP1 and / or SNP2 in the genotype of the sorghum to be tested, selecting the sorghum to be tested with the genotype AACC as the parent, and cultivating tall sorghum (sorghum with a plant height higher than the parent), wherein AACC is the genotype where SNP1 is AA and SNP2 is CC.

4. Application, characterized in that, The application is N1, N2, N3, or N4; The N1 refers to the application of substances used to detect the polymorphisms or genotypes of SNP1 and SNP2 described in claim 3 in sorghum breeding and / or identification or auxiliary identification of sorghum plant height. The N2 is a substance for detecting haplotypes and / or for identifying or assisting in the identification of sorghum plants. The haplotype is a polymorphic combination of the two SNPs, SNP1 and SNP2, on a chromosome of sorghum. The N3 refers to the application of the substance used to detect the polymorphism or genotype of SNP1 in claim 3 in sorghum breeding and / or identification or auxiliary identification of sorghum plant height. The N4 is the substance used to detect the polymorphism or genotype of SNP2 as described in claim 3 in sorghum breeding and / or identification or auxiliary identification of sorghum plant height.

5. Application, characterized in that, The application is Q1, Q2, Q3, or Q4; Q1 refers to the application of substances that detect the polymorphism or genotype of the two SNPs, SNP1 and SNP2, as described in claim 3 in the preparation of products for sorghum breeding and / or identification or auxiliary identification of sorghum plant height. Q2 refers to the application of substances for detecting haplotypes in sorghum breeding and / or identification or auxiliary identification of sorghum plants. The haplotype is the polymorphic combination of the two SNPs, SNP1 and SNP2, on a chromosome of sorghum as described in claim 3. Q3 refers to the application of the substance that detects the polymorphism or genotype of SNP1 in claim 3 in the preparation of products for sorghum breeding and / or identification or auxiliary identification of sorghum plant height; Q4 refers to the application of substances that detect the polymorphism or genotype of SNP2 as described in claim 3 in the preparation of products for sorghum breeding and / or identification or auxiliary identification of sorghum plant height.

6. The application according to claim 4 or 5, characterized in that, The substance is either C1), C2), or C3). C1) The substance described is a primer composition for amplifying sorghum genomic DNA fragments including the SNP1 and / or SNP2 sites. C2) The substance described is a PCR reagent containing the primer composition described in C1). C3) The substance is a kit containing the primer composition described in C1) or the PCR reagent described in C2).

7. The product, characterized in that, The product is any one of the following: B1) The PCR primers as described in claim 1; B2) PCR reagents containing the PCR primers described in B1); B3) A kit containing the PCR primers described in B1) or the PCR reagents described in B2); B4) A detection instrument containing the PCR primers described in B1), the PCR reagents described in B2), or the kit described in B3).

8. The primer according to claim 1, the method according to claim 2 or 3, the application according to claims 4-6, or the product according to claim 7, characterized in that, The sorghum is a pure line or a self-pollinated line of sorghum.

9. A DNA molecule, characterized by, The DNA molecule is sequence 1 in the sequence listing.

10. The application of the DNA molecule as described in claim 9, characterized in that, The application is any one of the following: D1) Determine the height of sorghum plants; D2) Preparation of products for identifying sorghum plant height; D3) Sorghum breeding; D4) Prepare breeding products related to sorghum plant height; D5) Products that detect single nucleotide polymorphisms or genotypes related to sorghum plant height; D6) Prepare products for identification or auxiliary identification of sorghum plant height.

Images