Molecular markers associated with soybean branch angle on chromosome 1 and uses thereof
Patent Information
- Application Number
- CN202611347833.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-09-02
- Publication Date
- 2026-09-29
AI Technical Summary
[0003]然而,分枝角度属于典型的数量性状,受多基因控制且易受环境影响,遗传机制十分复杂
(1)本发明的发明人筛选出了一个与大豆分枝角度相关的分子标记Gm_Chr01_54668955,该分子标记位于1号染色体上,采用本发明的分子标记Gm_Chr01_54668955可以快速预测大豆植株分枝角度的大小。
Smart Images

Figure CN122833209A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular marker technology, specifically relating to a molecular marker located on chromosome 1 that is related to the branching angle of soybean and its application. Background Technology
[0002] As an indispensable crop in the global food and oil system, increasing soybean yield is crucial for alleviating the increasingly tense supply and demand relationship. Among the many factors affecting yield, plant architecture improvement, especially the precise control of branching angle, is key to achieving high yields through dense planting. An ideal branching angle not only optimizes canopy structure but also significantly improves light energy utilization, thereby unlocking the yield potential of soybeans.
[0003] However, branching angle is a typical quantitative trait, controlled by multiple genes and easily influenced by the environment, with a very complex genetic mechanism. Traditional breeding methods rely heavily on field phenotypic identification, which is not only time-consuming and labor-intensive but also inefficient in selection, making it difficult to meet the precision requirements of modern breeding.
[0004] With the rapid development of bioinformatics technology, modern molecular breeding has provided a completely new approach to understanding this complex trait. Through high-throughput sequencing and bioinformatics analysis, researchers can precisely locate key quantitative trait loci (QTLs) controlling branching angles across the entire genome. Based on this, KASP (competitive allele-specific PCR) markers developed for these key loci, with their advantages of high sensitivity, high stability, and low cost, have enabled precise genotyping of target single nucleotide polymorphisms (SNPs). This strategy of combining QTL mapping with KASP markers allows breeders to perform high-throughput screening of soybean genotypes at the seedling stage, significantly shortening the breeding cycle and propelling soybean breeding towards higher efficiency, greater precision, and more molecularly designed approaches. Summary of the Invention
[0005] One of the objectives of this invention is to provide a molecular marker related to the branching angle of soybean.
[0006] The second objective of this invention is to provide the application of the aforementioned molecular markers related to soybean branching angle.
[0007] To achieve the above objectives, the present invention adopts the following technical solution: This invention discloses a molecular marker related to soybean branching angle. Through statistical analysis of soybean branching angles at maturity and QTL mapping, the inventors located a linkage region in soybean containing a single SNP locus, named Gm_Chr01_54668955. This locus is located at position 54668955 on chromosome 1 of the soybean reference genome Glycine max Wm82.a4.v1.Glyma.01G202800 The coding region of the site contains a C / T base mutation. The nucleotide sequence of this SNP site is shown in SEQ ID NO.1. When the base at this site is C (CC genotype, hereinafter referred to as 0 / 0 genotype), the branching angle of the soybean material is small. When the base at this site is T (TT genotype, hereinafter referred to as 1 / 1 genotype), the branching angle of the soybean material is large. There is also a heterozygous case, namely the CT genotype, also known as 0 / 1 genotype, which has a moderate branching angle. Population validation results show that the branching angle of soybean material with genotype 0 / 0 is small and significantly lower than that of soybean material with genotype 1 / 1.
[0008] Specifically, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein a C / T base mutation exists at position 25 of the sequence shown in SEQ ID NO.1, and the sequence is as follows: TCAAACTGATTCAGCATATGCATC[ C / T ]ATAATTCTTCAAATTTGGGTACATC (as shown in SEQ ID NO.1, the bold and underlined part is the SNP site Chr01_54668955 (C / T)).
[0009] Based on this SNP site, a primer set for the KASP marker was designed to amplify the KASP marker associated with soybean branching angle. The primer pair sequences for the molecular marker are as follows: Gm_Chr01_54668955-F1: GAAGGTGACCAAGTTCATGCTTCAAACTGATTCAGCATATGCATCC (shown in SEQ ID NO.2); Gm_Chr01_54668955-F2: GAAGGTCGGAGTCAACGGATTTCAAACTGATTCAGCATATGCATCT (shown in SEQ ID NO.3); Gm_Chr01_54668955-R:TGCTGATTATGATGTACCCAAATTTGAAG (shown as SEQ ID NO.4).
[0010] Two forward primers are attached to different fluorescent adapter sequences; the 5' end of forward primer Gm_Chr01_54668955-F1 is attached to the FAM fluorescent adapter sequence, and the 5' end of forward primer Gm_Chr01_54668955-F2 is attached to the VIC fluorescent adapter sequence; the FAM and VIC fluorescent adapter sequences are as follows: FAM: GAAGGTGACCAAGGGCATGCT (shown in SEQ ID NO.5); VIC: GAAGGGCGGAGGCAACGGAGG (shown in SEQ ID NO. 6).
[0011] This invention also discloses the application of the primer set of the aforementioned molecular markers in marker-assisted breeding related to soybean branching angle. In other words, the primer set of the molecular markers of this invention can be used in future marker-assisted breeding to predict the branching angle of soybean materials by extracting DNA from seedling leaves and detecting the presence of the molecular markers of this invention. The detection can be performed using quantitative real-time PCR, specifically using the aforementioned molecular marker primer set.
[0012] This invention also discloses the application of the aforementioned molecular marker primer set in predicting the branching angle of soybean. Specifically, the specific steps for predicting the branching angle of soybean are as follows: Using the DNA of the tested soybean germplasm as a template for quantitative real-time PCR amplification, quantitative real-time PCR amplification was performed using the primer pair corresponding to the molecular marker Gm_Chr01_54668955. The reaction system for quantitative real-time PCR amplification is shown in Tables 1-3. Table 1 PCR primer premix preparation
[0013] Table 2 Reaction system configuration
[0014] Table 3 PCR reaction procedure
[0015] Quantitative real-time PCR (qPCR) amplification was performed using primer sets Gm_Chr01_54668955-F1, Gm_Chr01_54668955-F2, and Gm_Chr01_54668955-R. If the PCR product only detected FAM fluorescence signal corresponding to primer Gm_Chr01_54668955-F1 (with fluorescent adapter sequence), the detection site was identified as genotype 0 / 0, indicating a homozygous type with a small branching angle. If the PCR product only detected VIC fluorescence signal corresponding to primer Gm_Chr01_54668955-F2 (with fluorescent adapter sequence), the detection site was identified as genotype 1 / 1, indicating a homozygous type with a large branching angle. If primers Gm_Chr01_54668955-F1 and Gm_Chr01_54668955-F2 (with fluorescent adapter sequence) were detected simultaneously, the genotype was identified as genotype 1 / 1, indicating a homozygous type with a large branching angle. The corresponding FAM and VIC fluorescence signals indicate that the detection site is the 0 / 1 genotype (corresponding to the CT genotype), which is determined to be a heterozygous type with a moderate branching angle.
[0016] In addition, this invention also protects a kit for predicting soybean branching angle, the kit containing primer sets Gm_Chr01_54668955-F1, Gm_Chr01_54668955-F2, and Gm_Chr01_54668955-R. Other components of the kit are from Guangzhou Goodbio's FLU-ARMS for KASP 2×PCR Mix V5F. This invention does not impose any special restrictions on the concentration of the primer sets, but a concentration of 10 μM is recommended. This invention does not impose any special restrictions on the source of the 2×PCR Mix; commercially available KASP genotyping kits are acceptable.
[0017] The kit of this invention can quickly predict the size of soybean branching angle, and can also quickly predict the genotype of soybean branching angle. The specific method refers to the steps for predicting the branching angle of soybeans. Analysis of the quantitative PCR amplification results reveals the following: If the PCR product only detects the FAM fluorescence signal corresponding to primer Gm_Chr01_54668955-F1 with the fluorescent adapter sequence, the detection site indicates a genotype 0 / 0, with base information of CC, and is determined to be a homozygous type with a small branching angle. If the PCR product only detects the VIC fluorescence signal corresponding to primer Gm_Chr01_54668955-F2 with the fluorescent adapter sequence, the detection site indicates a genotype 1 / 1, with base information of TT, and is determined to be a homozygous type with a large branching angle. If both FAM and VIC fluorescence signals corresponding to primers Gm_Chr01_54668955-F1 and Gm_Chr01_54668955-F2 with the fluorescent adapter sequence are detected simultaneously, the detection site indicates a genotype 0 / 1, with base information of CT, and is determined to be a heterozygous type with a moderate branching angle.
[0018] Beneficial effects: (1) The inventors of this invention screened out a molecular marker Gm_Chr01_54668955 that is related to the branching angle of soybean. This molecular marker is located on chromosome 1. Using the molecular marker Gm_Chr01_54668955 of this invention, the size of the branching angle of soybean plants can be quickly predicted.
[0019] (2) Using markers linked to the branching angle of soybeans for screening is beneficial for molecular marker-assisted selection breeding. The method is simple and feasible, which can improve efficiency and save costs.
[0020] (3) The molecular markers of the present invention have the characteristics of convenient detection, stable amplification products and high specificity. They can be easily, quickly and with high throughput applied to the molecular marker-assisted breeding practice and material prediction of soybean branching angle. Attached Figure Description
[0021] Figure 1 The results of QTL localization analysis of soybean branch angles are whole-genome signals obtained based on qtl / r software analysis. The text annotations indicate the SNP locations associated with this invention.
[0022] Figure 2 The results of KASP analysis on soybean materials used to develop KASP molecular markers are shown. Two negative controls were used to exclude typing errors.
[0023] Figure 3This is a violin plot showing the branching angle distribution of the genotype at the Gm_Chr01_54668955 locus in the soybean population of Example 1 of this invention. 0 / 0 indicates a homozygous small branching angle genotype at the Gm_Chr01_54668955 locus; 1 / 1 indicates a homozygous large branching angle genotype; and 0 / 1 indicates a heterozygous medium branching angle genotype. Multiple comparisons (Tukey HSD) were used to determine the significance of the data.
[0024] Figure 4 The results of genotyping and the correspondence between branching angle phenotypes at the Gm_Chr01_54668955 locus of the present invention are shown in Example 2. Detailed Implementation
[0025] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, unless otherwise specified, the specific experimental methods involved in the following embodiments are conventional methods or implemented according to the conditions recommended in the manufacturer's instructions.
[0026] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used can be purchased commercially.
[0027] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.
[0028] Example 1: Development of molecular markers related to soybean branching angle This invention uses the large-branching soybean variety "Qihuang 34" as the male parent and the small-branching soybean variety "Dongnong 50" as the female parent for hybridization. After obtaining the F1 hybrid offspring, self-pollination is performed to obtain the F2 generation soybean population. The F2 generation is then self-pollinated and single-seed transfer is used to obtain recombinant F1 soybeans. 2:3 Materials were obtained by examining 236 soybean recombinant F1 varieties planted in 2025 at the Shandong Agricultural University Agronomic Experiment Station. 2:3The maximum unilateral branching angle at material maturity was used for QTL mapping in soybean, combined with genetic mapping. A linked region containing a single SNP locus, named Gm_Chr01_54668955, was located at position 54668955 on chromosome 1 of the soybean reference genome Glycine max Wm82.a4.v1 (downloadable from https: / / phytozome-next.jgi.doe.gov / ). Glyma.01G202800 The coding region; a C / T base mutation exists at this site. The nucleotide sequence of this SNP site is shown in SEQ ID NO. 1, located at position 25 (counting from the first base at the 5' end as position 1). When the base at this site is C (0 / 0 genotype), the soybean branching angle is small; when the base at this site is T (1 / 1 genotype), the soybean branching angle is large. A violin plot showing the branching angle distribution corresponding to the genotypes at the Gm_Chr01_54668955 site in the population is shown below. Figure 3 Among them, soybean materials with genotype 0 / 0 showed a small branching angle, soybean materials with genotype 1 / 1 showed a large branching angle, soybean materials with genotype 0 / 1 showed a branching angle between the two, and there were significant differences in the branching angles between each pair of soybean materials with genotypes 0 / 1, 1 / 1, and 0 / 0.
[0029] Based on this SNP site and its upstream and downstream sequences, markers for KASP detection were developed, and the following primer set was designed using SnapGene: Gm_Chr01_54668955-F1: GAAGGTGACCAAGTTCATGCTTCAAACTGATTCAGCATATGCATCC (shown in SEQ ID NO.2); Gm_Chr01_54668955-F2: GAAGGTCGGAGTCAACGGATTTCAAACTGATTCAGCATATGCATCT (shown in SEQ ID NO.3); Gm_Chr01_54668955-R:TGCTGATTATGATGTACCCAAATTTGAAG (shown as SEQ ID NO.4).
[0030] Using this primer set, quantitative real-time PCR amplification was performed on the sample. The results showed that if the PCR product only detected the FAM fluorescence signal corresponding to primer Gm_Chr01_54668955-F1 (linked with a fluorescent adapter sequence), the detection site was identified as genotype 0 / 0, indicating a homozygous type with a small branching angle. If the PCR product only detected the VIC fluorescence signal corresponding to primer Gm_Chr01_54668955-F2 (linked with a fluorescent adapter sequence), the detection site was identified as genotype 1 / 1, indicating a homozygous type with a large branching angle. If both FAM and VIC fluorescence signals corresponding to primers Gm_Chr01_54668955-F1 and Gm_Chr01_54668955-F2 (linked with fluorescent adapter sequences) were detected simultaneously, the detection site was identified as genotype 0 / 1, indicating a heterozygous type with a moderate branching angle. Figure 2 ).
[0031] This study developed markers in 128 soybean accessions. Of these, 39 accessions had a genotype of 0 / 0 at the Gm_Chr01_54668955-F1 locus; 36 accessions had a genotype of 1 / 1 at the Gm_Chr01_54668955-F2 locus; and 53 accessions had a genotype of 0 / 1 at the Gm_Chr01_54668955-F2 locus. Multiple testing showed significant differences between the 0 / 0 genotype and the 0 / 1 and 1 / 1 genotypes. The results were consistent with the genotypes at the Gm_Chr01_54668955-F1 locus and the actual branching angle measurements. Figure 3 It also has a high classification accuracy rate (96.9%).
[0032] The 128 soybean materials used for marker development were derived from artificially constructed recombinant F14 gene sequences. 2:3 The population consists of a male parent of soybean variety "Qihuang 34" provided by Shandong Academy of Agricultural Sciences and a female parent of soybean variety "Dongnong 50" provided by Northeast Agricultural University.
[0033] Example 2: Accuracy verification of the molecular markers described in this invention In addition, this invention also uses the above-mentioned molecular markers to predict 43 random soybean germplasm resources in the germplasm resource bank. The specific maximum unilateral branching angle of the soybean germplasm resources and the genotype corresponding to the Chr01_54668955 locus are shown in Table 4: Table 4. Branching angles and genotypes corresponding to the Chr01_54668955 locus in 43 soybean germplasm materials.
[0034] Using the genomic DNA of the soybean to be predicted as a template, the primer set was used for real-time PCR amplification to obtain the real-time PCR product; The reaction system for real-time PCR amplification is as follows: 1 μL genomic DNA, 5 μL 2×PCR Mix, 0.063 μL SNP-specific primers, and sterile distilled water to a final volume of 10 μL. The preferred reaction program for quantitative real-time PCR amplification is as follows: initial denaturation at 95℃ for 15 min; denaturation at 95℃ for 20 s, annealing and extension at 61℃ for 1 min, 10 cycles (cooling down by 0.6℃ per cycle); denaturation at 95℃ for 20 s, annealing and extension at 55℃ and fluorescence reading for 1 min, 33 cycles; final fluorescence reading at 30℃ for 1 min.
[0035] Predicting soybean branching angles based on quantitative real-time PCR signals: From Table 4 and Figure 4 As can be seen from the predictions made in this study among 43 soybean germplasm resources, 19 soybean germplasm resources had a genotype of 0 / 0 at the Gm_Chr01_54668955 locus, and 24 soybean germplasm resources had a genotype of 1 / 1 at the Gm_Chr01_54668955 locus. The t-test showed that the difference between the 0 / 0 and 1 / 1 genotypes was extremely significant. P <0.001). The detection results corresponded consistently with the genotype at the Gm_Chr01_54668955 locus and the actual branching angle statistics. Therefore, the KASP marker of this invention can effectively predict the size of soybean branching angle and can be used for the prediction and screening of soybean material branching angle.
[0036] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.
Claims
1. A molecular marker located on chromosome 1 and associated with soybean branching angle, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein there is a C / T base mutation at position 25 of the sequence shown in SEQ ID NO.
1. When the base at this position is C, the branching angle of the soybean material is small, and when the base at this position is T, the branching angle of the soybean material is large.
2. The molecular marker located on chromosome 1 and related to soybean branching angle according to claim 1, characterized in that, The molecular marker is a KASP marker designed based on SNP sites.
3. A primer set for amplifying the molecular marker of claim 1, characterized in that, The primer set includes: Gm_Chr01_54668955-F1: GAAGGTGACCAAGTTCATGCTTCAAACTGATTCAGCATATGCATCC; Gm_Chr01_54668955-F2:GAAGGTCGGAGTCAACGGATTTCAAACTGATTCAGCATATGCATCT; Gm_Chr01_54668955-R: TGCTGATTATGATGTACCCAAATTTGAAG.
4. The primer set of molecular markers according to claim 3, characterized in that, The two forward primers are connected to different fluorescent adapter sequences; the 5' end of the forward primer Gm_Chr01_54668955-F1 is connected to the FAM fluorescent adapter sequence, and the 5' end of the forward primer Gm_Chr01_54668955-F2 is connected to the VIC fluorescent adapter sequence.
5. A kit for predicting the branching angle of soybeans, characterized in that, The kit contains the primer set of the molecular markers as described in claim 3.
6. The use of the primer set of the molecular marker as described in claim 3 or 4 or the kit as described in claim 5 in predicting or assisting in the prediction of soybean branch angle size.
7. The application according to claim 6, characterized in that, A method for predicting soybean branch angle using the primer set of the molecular markers or the kit includes the following steps: (1) Extract soybean genomic DNA for testing; (2) Using the genomic DNA extracted in step (1) as a template, perform real-time PCR amplification using the primer set of the molecular marker or the kit, and analyze the results of real-time PCR amplification. (3) Make a judgment based on the result of step (2), and the specific criteria are as follows: Quantitative real-time PCR amplification was performed using primer sets Gm_Chr01_54668955-F1, Gm_Chr01_54668955-F2, and Gm_Chr01_54668955-R. If only FAM fluorescence signal was detected in the PCR product of the sample, the locus was identified as 0 / 0 genotype, which is determined to be a homozygous type with a small branching angle. If only VIC fluorescence signal was detected in the PCR product of the sample, the locus was identified as 1 / 1 genotype, which is determined to be a homozygous type with a large branching angle. If both FAM and VIC fluorescence signals were detected, the locus was identified as 0 / 1 genotype, which is determined to be a heterozygous type with a medium branching angle.