MOPEVAC-based platform for heterologous ORF(s) expression

Abstract

This invention relates to nucleic acid constructs comprising DNA molecules encoding recombinant L or S fragments of Mopea virus (MOPV), expression cassettes or vectors containing them, eukaryotic cells containing them, and methods for expressing one or more polypeptides or proteins or fragments thereof heterologous to Mopea virus (MOPV) in eukaryotic host cells, particularly using the nucleic acid constructs of this invention, and / or for generating recombinant attenuated live Mopea virus (MOPV) expressing one or more polypeptides or proteins or fragments thereof heterologous to MOPV. The present invention also relates to compositions comprising viral particles obtained by the method, viral particles obtained by the method, and a set of nucleic acid constructs, expression cassettes, or vectors comprising thereof, wherein the set comprises at least one nucleic acid construct, expression cassette, or vector comprising a recombinant L fragment of Mopeia virus (MOPV), and a nucleic acid construct, expression cassette, or vector comprising a recombinant S fragment of Mopeia virus (MOPV) encoding a MOPV nucleoprotein (NP) having attenuated exonuclease activity, wherein one or both nucleic acid constructs, expression cassettes, or vectors comprise polynucleotides encoding a heterologous polypeptide or protein for MOPV, and when located on the S fragment, the latter is different from a non-MOPV GPC, and wherein the position of the polynucleotide encoding at least one heterologous polypeptide or protein for MOPV inserted into the nucleic acid construct, expression cassette, or vector is specific.

Description

Technical Field

[0001] This invention relates to the field of isovirus-based platforms for expressing ORFs and genes, and particularly isovirus-based vaccine platforms.

[0002] This invention relates to nucleic acid constructs and ways of including or using them. The invention also relates to methods for expressing one or more heterologous peptides or proteins or fragments thereof for Mopea virus (MOPV) in eukaryotic host cells, and / or generating recombinant attenuated live Mopea virus (MOPV) while simultaneously expressing one or more heterologous peptides or proteins or fragments thereof for MOPV. The invention further relates to therapeutic approaches and applications derived from the use of a platform. Background Technology

[0003] According to WO2017 / 068190, a so-called MOPEVAC based on attenuated live Mopea virus (MOPV) is known. LASV The vaccine targets Lassa virus (LASV). Therefore, WO2017 / 068190 describes the so-called MOPEVAC platform, which delivers attenuated live MOPV, where attenuation is achieved through mutations in the nucleoprotein (NP) exonuclease domain of the MOPV. Notably, MOPEVAC... LASV Vaccines are based on chimeric constructs: although MOPEVAC LASVThe vaccine is based on the Mopea virus genomic backbone, but the Lassa virus glycoprotein precursor (GPC) replaces the MOPV GPC to induce immunity against Lassa pathogenic arenavirus (LASV). The MOPEVAC platform has proven to be a versatile tool for generating recombinant attenuated live viruses expressing heterologous envelope glycoproteins of pathogenic arenaviruses using the Mopea virus genetic backbone with its exonuclease activity eliminated. This platform allows for the generation of vaccines that protect animals in preclinical studies from Old World arenaviruses such as Lassa virus (Mateo M, Reynard S, Carnec X, et al. Vaccines inducing immunity to Lassa virus glycoprotein and nucleoprotein protect macaques after a single shot. Sci Transl Med. 2019;11(512):1-18) (Carnec X, Mateo M, Page A, et al. A Vaccine Platform against Arenaviruses Based on a Recombinant Hyperattenuated Expressing Heterologous Glycoproteins. J Virol. 2018) or New World arenaviruses such as Machupo virus and Guanarito virus (Reynard S, Carnec X, Picard C, et al. A MOPEVAC multivalent vaccine induces sterile protection against New World arenaviruses in non-human primates. NatMicrobiol.). Candidate vaccines for lethal infections (2023), as detailed in WO2023 / 175044. However, this platform is not tailored to provide attenuated live MOPVs other than those in which the Lassa virus GPC replaces the MOPV GPC.

[0004] Therefore, to date, it has not been demonstrated that the so-called MOPEVAC platform can support the introduction of non-sand-virus coding sequences, i.e., in the case of this specification, in particular sequences encoding heterologous polypeptides or proteins derived from sand-viruses used for expression purposes.

[0005] Furthermore, the Mopeya virus genome possesses dual-segment RNA characteristics. Another issue is that it remains unknown whether such a genome can be used to simultaneously express multiple heterologous proteins from the same recombinant virus, particularly non-arenavirus peptides or proteins. Summary of the Invention

[0006] This invention originates from an experiment designed to solve this problem.

[0007] This paper describes the modifications made to the MOPEVAC platform for expressing heterologous ORFs, and the means, particularly nucleic acid molecules, required for this purpose. The result is a novel MOPEVAC platform (so-called MOPEVAC NEXT in some illustrative examples) capable of expressing heterologous ORFs for arenaviruses. Consistent evidence of the platform's practical significance is provided by describing the first application of the newly designed MOPEVAC vaccine platform (aimed at against Crimean-Congo hemorrhagic fever virus (CCHFV)) and the recombinant attenuated live vaccine against Crimean-Congo hemorrhagic fever virus obtained using the novel MOPEVAC platform of this invention.

[0008] Arenaviruses are a genus of viruses that infect rodents and occasionally humans. At least eight species of arenaviruses are known to cause human disease. Arenaviruses are divided into at least two groups, the most representative being Old World viruses and New World viruses. The differences between these groups are geographical and genetic. Arenaviruses are spherical, pleomorphic, and enveloped, ranging in diameter from 60 to 300 nm. Although they are often misclassified as negative-sense viruses, they are actually double-sense viruses. This confusion stems from the fact that white sections of their genome are considered negative-sense and encode genes in the reverse direction, while other parts encode genes in the opposite (positive / positive) direction. This complex gene expression structure is theoretically considered a primitive regulatory system of the virus, enabling it to control when and which proteins are synthesized. The life cycle of arenaviruses is confined to the cytoplasm. Viral particles, or virions, are pleomorphic because they vary in appearance, but in many cases they are spherical and covered with surface glycoprotein spikes.

[0009] Therefore, arenaviruses possess a fragmented RNA genome consisting of two single-stranded ambiguous RNAs. Genomic RNA alone is not infectious and requires viral replication mechanisms to initiate infection within host cells. The sense RNA of the genome packaged into the arenavirus particle is designated as negative-sense RNA and must first be copied into positive mRNA to produce viral proteins. These two RNA fragments are called the small (S) fragment and the large (L) fragment, and they encode four viral proteins using a unique ambiguous coding strategy. Each RNA fragment encodes two viral proteins in opposite directions, such that the negative-sense RNA genome serves as a template for transcribing a single mRNA, while the positive copy of the RNA genome serves as a template for a second mRNA. Specifically, the S fragment RNA encodes a viral nucleocapsid protein (NP) and a glycoprotein (GP), particularly a glycoprotein precursor (GPC); while the L fragment RNA encodes a viral RNA-dependent RNA polymerase (L) and a small protein (Z) containing a RING domain. The independent coding sequences for these two viral proteins are separated by an intergenic RNA sequence expected to fold into a stable hairpin structure. Those skilled in the art will understand that the genomic sequences of various arenaviruses, as well as the protein sequences encoded by these viruses, are publicly available. For example, they can be found on the Virus Sequence Database (VSD) website, established and maintained by the National Institute of Health Immunology and Pathology, Korea Centers for Disease Control and Prevention. Therefore, when referring to (RNA) viruses in this application, it also refers equivalently (and implicitly) to clones of said (RNA) viruses, such as RNA, DNA, or cDNA clones. As implemented herein, the present invention relates to nucleic acid constructs comprising a cDNA molecule encoding a recombinant L or S fragment of Mopea virus (MOPV herein), conforming to the characteristics described below. After a detailed description of the three nucleic acid constructs, general definitions of the terms used are provided. In this context, a cDNA molecule refers to a synthetic DNA molecule whose sequence is derived from single-stranded RNA. However, in the case of the present invention, the cDNA molecule may also contain non-coding sequences in addition to its coding sequence, particularly when these non-coding sequences are necessary to ensure the possibility of efficient transcription of the coding sequence contained in the cDNA molecule.

[0010] The nucleic acid constructs of the present invention specifically refer to purified, if necessary isolated, cDNA molecules that are obtained or can be obtained by recombination of several polynucleotide fragments operatively linked or cloned together as detailed herein.

[0011] This invention relates to nucleic acid constructs encoding L or S fragments of Mopeya virus (MOPV herein), which can also be used as a means to achieve the simultaneous generation of viral particles using the platform system described herein to express heterologous peptides or proteins or fragments thereof, particularly in the methods described herein. Therefore, they have the same level of functionality for this purpose, are equally involved in this purpose, and have similar structures, but differ in the relative arrangement of their constituent parts due to the different functional properties of their respective components. Furthermore, these nucleic acid constructs can also be used together, i.e., synergistically for the same purpose, and for the expression of multiple heterologous peptides or proteins or fragments thereof.

[0012] According to the first aspect, when relating to providing a nucleic acid construct encoding a Mopeya virus (MOPV) L fragment, the present invention relates to a nucleic acid construct comprising a DNA molecule encoding a recombinant MOPV L fragment, wherein the DNA molecule comprises, from its 5' end to its 3' end, in the following order: a) Polynucleotides encoding the open reading frame (ORF) of MOPV L polymerase (Lpol), and b) Polynucleotides containing the MOPV intergenic region (IGR), and c) A polynucleotide encoding at least one polypeptide or protein heterologous to MOPV, and d) A polynucleotide encoding a 2A self-cleaving peptide, optionally having an additional polynucleotide linker sequence at the 5' end of the polynucleotide encoding the 2A self-cleaving peptide, and e) Polynucleotides encoding the MOPV Z protein ORF, and The polynucleotides a) and e) are each side-joined with a polynucleotide consisting of a non-coding sequence, the non-coding sequence containing a regulatory element for controlling the transcription of the coding sequence of the nucleic acid construct, and wherein the polynucleotides c), d) and e) are operatively linked for expression.

[0013] Therefore, this type of nucleic acid construct contains the MOPV Lpol ORF and the MOPV Z protein ORF, the latter being in a ambiguous gene arrangement relative to the Lpol ORF, commonly found in the L fragment RNA of MOPV. At least one heterologous polypeptide or protein for MOPV is placed between the intergenic region and the MOPV Z protein ORF, a position that was unexpectedly determined to be effective in the experiments described herein. Notably, the arenavirus Z protein is known to interact with multiple factors in its bifragmented genome, particularly during translation, meaning that the effectiveness of this position is at least unpredictable. The Z protein is relatively small (approximately 100 residues), and the addition of the P2A sequence and additional linkers at the C-terminus of the Z protein adds 21 residues, which is relatively large compared to the initial size of the Z protein. Therefore, such alterations may affect the structure and function of the Z protein.

[0014] According to one particular embodiment, the nucleic acid construct of the present invention does not contain an "internal ribosome entry site" (IRES) sequence, specifically replacing the P2A sequence disclosed herein. An IRES is an RNA element that, as part of the larger process of protein synthesis, allows translation to be initiated in a cap-independent manner. The difference between the IRES sequence and the P2A sequence is that the IRES sequence allows translation of the downstream ORF in a polycistronic mRNA, while the P2A sequence results in the generation of two separate polypeptides from a single ORF.

[0015] According to one particular embodiment, portion c) of the nucleic acid construct, i.e., the polynucleotide encoding at least one polypeptide or protein heterologous to MOPV, is positioned at the 5' end of a stop codon, which may be engineered in the nucleic acid molecule sequence of the nucleic acid construct for this purpose. According to one particular embodiment, the stop codon is the stop codon of the MOPV Z protein ORF. Stop codons are well known to those skilled in the art. "Positioned at the 5' end of a stop codon" can be understood as meaning that the 5' position is "read in genomic sense," which does not necessarily refer to the linear description of the DNA molecule contained in a specific order from its 5' end to its 3' end as described above. In this respect, the "genomic" meaning mentioned above also corresponds to the manner in which the polypeptide or protein is transcribed from the corresponding polynucleotide. "Positioned at the 5' end when read in genomic sense" can also mean "towards the 5' end (or terminology) of the nucleic acid molecule," and in particular "towards the 5' end (or terminology) of the nucleic acid molecule relative to the position under consideration," i.e., the specific element of the nucleic acid molecule, as described. Conversely, according to the conventional definition used in the art, "located at the 3' end" or "downstream" means "towards the 3' end (or terminology, used synonymously) of a nucleic acid molecule," and in particular "towards the 3' end (or terminology, used synonymously) of a nucleic acid molecule relative to the position under consideration." In the context of this paragraph and similar paragraphs thereafter, it should be understood that, according to conventional practice in the art, the use of the 5' and 3' ends of nucleic acid molecules herein and in the claims is for the purpose of describing the nucleic acid constructs under discussion, and in particular for the purpose of describing the order in which the parts constituting these nucleic acid constructs are arranged.

[0016] The statement “wherein polynucleotides c), d) and e) are operably linked to express” conveys that the described polypeptide and / or the DNA molecule as a result are arranged such that the Mopeia virus L fragment (or the S fragment with necessary modifications) generated from the corresponding polynucleotides can be transcribed.

[0017] Based on the guidance provided herein (particularly the description of the cloning strategy in the Materials and Methods section) and the constructs disclosed herein, according to a specific embodiment, a polynucleotide encoding at least one polypeptide or protein heterologous to MOPV can ultimately be placed between the last codon and the stop codon of the MOPV Z protein ORF. Because, according to the cloning strategy that can be used in the specific embodiment, the polynucleotide encoding at least one polypeptide or protein heterologous to MOPV is inserted into a cloning cassette inserted between the last codon and the stop codon of the MOPV Z protein ORF in the nucleic acid construct, i.e., upstream of the stop codon when read genomically, the stop codon of the MOPV Z protein ORF is found to be separated from the remainder of the MOPV Z protein ORF by the polynucleotide encoding at least one polypeptide or protein heterologous to MOPV and a 2A self-cleaving peptide, which may also have an additional polynucleotide linker sequence at the 5' end of the polynucleotide encoding the 2A self-cleaving peptide (particularly when read genomically). In other words, according to a particular embodiment, in c), the polynucleotide encoding at least one polypeptide or protein heterologous to MOPV is immediately adjacent (especially when read in genomic sense, at its 5' end) to the stop codon of the MOPV Z protein ORF (which is ambiguous relative to the MOPV Lpol ORF), and in e), the polynucleotide encoding the MOPV Z protein ORF has a sequence that does not contain its stop codon.

[0018] According to a second aspect, when relating to providing a nucleic acid construct encoding a MOPV L fragment, the present invention relates to a nucleic acid construct comprising a DNA molecule encoding a recombinant MOPV L fragment, wherein the DNA molecule comprises, from its 5' end to its 3' end, in the following order: a) A polynucleotide encoding at least one polypeptide or protein heterologous to MOPV, and b) A polynucleotide encoding a 2A self-cleaving peptide, optionally having an additional polynucleotide linker sequence at the 5' end of the polynucleotide encoding the 2A self-cleaving peptide, and c) Polynucleotides encoding the MOPV L polymerase (Lpol) ORF, and d) Polynucleotides containing the MOPV intergenic region (IGR), and e) Polynucleotides encoding the MOPV Z protein ORF, and The polynucleotides a) and e) are each side-attached to a polynucleotide consisting of a non-coding sequence containing a regulatory element for controlling the transcription of the coding sequence of the nucleic acid construct, and wherein the polynucleotides a), b) and c) are operatively linked for expression.

[0019] Therefore, this type of nucleic acid construct contains the MOPV Lpol ORF and the MOPV Z protein ORF, the latter being in a ambiguous gene arrangement relative to the Lpol ORF and commonly found in the L fragment RNA of MOPV. At least one polypeptide or protein heterologous to MOPV is placed at the 5' end of the nucleic acid construct as a whole, upstream of the MOPV Lpol ORF, as determined as a valid location in the experiments described herein.

[0020] According to one particular embodiment, portion a) of the nucleic acid construct, namely the polynucleotide encoding at least one polypeptide or protein heterologous to MOPV, is placed downstream of a start codon, which may be engineered in the nucleic acid molecule sequence of the nucleic acid construct for this purpose. According to one particular embodiment, this start codon is the start codon of MOPV Lpol ORF. Because, according to a cloning strategy that may be used in the particular embodiment, the polynucleotide encoding at least one polypeptide or protein heterologous to MOPV is inserted into a cloning cassette inserted between the first and second codons of the Lpol ORF in the nucleic acid construct, in the final obtained nucleic acid construct, the start codon of the MOPV Lpol protein ORF is found to be separated from the rest of the MOPV Lpol protein ORF by the polynucleotide encoding at least one polypeptide or protein heterologous to MOPV and a 2A self-cleaving peptide, which may also carry an additional polynucleotide linker sequence at the 5' end of the polynucleotide encoding the 2A self-cleaving peptide (particularly when read genomically). In other words, according to a specific embodiment, in a) the polynucleotide encoding at least one polypeptide or protein heterologous to MOPV is immediately following (at its 3' end) the start codon of the MOPV Lpol protein ORF (the Lpol protein ORF is ambiguous relative to the MOPV Z ORF at the 3' end of the nucleic acid construct), and in c) the polynucleotide encoding the MOPV Lpol protein ORF has a sequence that does not contain its start codon. In b) the polynucleotide encoding the 2A self-cleaving peptide (optionally with an additional polynucleotide linker sequence) is located at the 3' end of the at least one polypeptide or protein heterologous to MOPV and at the 5' end of the remainder of the MOPV Lpol protein ORF (excluding its start codon).

[0021] According to a third aspect, when relating to providing a nucleic acid construct encoding a MOPV S fragment, the present invention relates to a nucleic acid construct comprising a DNA molecule encoding a recombinant MOPV S fragment, wherein the DNA molecule comprises, from its 5' end to its 3' end, in the following order: a) A polynucleotide encoding at least one polypeptide or protein heterologous to MOPV, and b) A polynucleotide encoding a 2A self-cleaving peptide, optionally having an additional polynucleotide linker sequence at the 5' end of the polynucleotide encoding the 2A self-cleaving peptide, and c) Polynucleotides encoding MOPV nucleoprotein (NP) with diminished exonuclease activity, and d) Polynucleotides containing the MOPV intergenic region (IGR), and e) Encoding polynucleotides of MOPV or non-MOPV glycoprotein precursors (GPCs), particularly New World arena virus GPCs, and The polynucleotides a) and e) are each side-attached to a polynucleotide consisting of a non-coding sequence containing a regulatory element for controlling the transcription of the coding sequence of the nucleic acid construct, and wherein the polynucleotides a), b) and c) are operatively linked for expression.

[0022] Therefore, such nucleic acid constructs contain a MOPV nucleoprotein (NP) ORF and a MOPV or non-MOPV glycoprotein precursor (GPC), the latter being ambiguous relative to the NP ORF and commonly found in the S-segment RNA of MOPV. At least one polypeptide or protein heterologous to MOPV is positioned at the 5' end of the nucleic acid molecule as a whole, upstream of the MOPV NP ORF, as determined as a valid location in the experiments described herein.

[0023] According to one specific embodiment, portion a) of the nucleic acid construct, namely the polynucleotide encoding at least one polypeptide or protein heterologous to MOPV, is placed downstream of a start codon, which may be engineered in the nucleic acid molecule sequence of the nucleic acid construct for this purpose. According to one specific embodiment, this start codon is the start codon of the sequence encoding the MOPV NP found in the nucleic acid sequence. Because, according to a cloning strategy that may be used in the specific embodiment, the polynucleotide encoding at least one polypeptide or protein heterologous to MOPV is inserted into a cloning cassette inserted between the first and second codons of the NP ORF in the nucleic acid construct, in the final obtained nucleic acid construct, the start codon of the MOPV NP protein ORF is found to be separated from the rest of the MOPV NP protein ORF by the polynucleotide encoding at least one polypeptide or protein heterologous to MOPV and a 2A self-cleaving peptide, which may also have an additional polynucleotide linker sequence at the 5' end of the polynucleotide encoding the 2A self-cleaving peptide. In other words, according to a specific embodiment, in a) the polynucleotide encoding at least one polypeptide or protein heterologous to MOPV is immediately following (at its 3' end) the start codon of the MOPV NP protein ORF (the MOPV NP protein ORF is ambiguous relative to the MOPV or non-MOPV GPC ORF at the 3' end of the nucleic acid construct), and in c) the polynucleotide encoding the MOPV NP protein ORF has a sequence that does not contain its start codon. In b) the polynucleotide encoding the 2A self-cleaving peptide (optionally with an additional polynucleotide linker sequence) is located at the 3' end of the at least one polypeptide or protein heterologous to MOPV and at the 5' end of the remainder of the MOPV NP protein ORF (excluding its start codon).

[0024] According to one specific embodiment, when a non-MOPV GPC is found in part e) of the nucleic acid molecule, the non-MOPV GPC replaces the MOPV GPC naturally present in MOPV. Furthermore, in the sense of "a polypeptide or protein heterologous to MOPV" as defined in part a) of the nucleic acid molecule, the non-MOPV GPC is not "a polypeptide or protein heterologous to MOPV". According to one specific embodiment, the non-MOPV GPC glycoprotein precursor (GPC) is a GPC of Old World arenavirus or a GPC of New World arenavirus. Examples are given in this specification.

[0025] Using different syntax, for the nucleic acid constructs described above, we can say that items a) to e) are numbered b) to f) respectively (numbering can be adjusted as needed), and the flanking polynucleotide regions are respectively: a) A 5' non-coding polynucleotide containing a regulatory element for controlling the transcription of the coding sequence of this nucleic acid construct, and g) A 3' non-coding polynucleotide containing a regulatory element for controlling the transcription of the coding sequence of the nucleic acid construct.

[0026] It is worth noting that the 5' and 3' non-coding polynucleotide sequences contain regulatory elements for controlling the transcription of the coding sequence of this nucleic acid construct, together with the IGR region of d) above.

[0027] Furthermore, as described above, when using a cloning cassette strategy to obtain the nucleic acid construct of the present invention, the location in which a cloning cassette containing a polynucleotide encoding at least one polypeptide or protein heterologous to MOPV is inserted into the nucleic acid construct, expression cassette, or vector from the 5' to 3' end of the MOPV DNA fragment can be considered as follows: o is located on the L segment of MOPV, between the MOPV Z protein ORF and its stop codon, or o is located on the L segment of MOPV, between the start codon of MOPV Lpol ORF and the rest of MOPV Lpol ORF, or o is located on the S segment of MOPV, between the start codon of the MOPV nucleoprotein (NP) ORF with weakened exonuclease activity and the rest of the MOPV NP ORF.

[0028] The accompanying experimental section provides precise guidance on the positions of nucleotides that may be affected by insertion (though these positions are still defined by the nature of the fragment, as detailed in this article).

[0029] The characteristics that can be applied to any of the nucleic acid constructs described herein are now described.

[0030] The term "encoding" encompasses the ability of the DNA molecule of the present invention to be transcribed into a full-length recombinant MOPV L or S fragment comprising at least one heterologous polypeptide or protein of MOPV, wherein the DNA or cDNA molecule is specifically used as a template for transcription and, where appropriate, for translation to express the product in a cell or cell line. Thus, when the DNA or cDNA is a double-stranded molecule, one strand performs this function. As described later in this specification, an expression cassette comprising a promoter for transcription of the full-length recombinant S or L fragment of Mopea virus can be used, while the ambiguous viral ORF is expressed from the 5' and 3' non-coding sequences of the nucleic acid construct of the present invention.

[0031] The term "encode" is also used to refer to the ability of the DNA or cDNA molecule to produce a peptide or polypeptide required to produce a full-length recombinant MOPV L or S fragment containing at least one polypeptide or protein heterologous to MOPV, such as MOPV L polymerase (Lpol) ORF, at least one polypeptide or protein heterologous to MOPV, MOPV Z protein ORF, MOPV nucleoprotein (NP) with attenuated exonuclease activity, and MOPV or non-MOPV glycoprotein precursor (GPC).

[0032] The “polynucleotides consisting of non-coding sequences containing regulatory elements for controlling transcription of the coding sequence of the nucleic acid construct” located at the 3’ and 5’ ends of the nucleic acid construct, respectively, refer to sequences conventionally known to enable transcription and / or control transcription of the coding sequence flanking them. These regions are also referred to as “5’ flanking regions” and “3’ flanking regions,” respectively. They are transcribed into RNA but not translated into functional proteins. The regulatory elements controlling transcription of the coding sequence located in the flanking non-coding sequences are promoters and / or terminators for transcription, and possibly enhancers and other cis-acting elements. Such elements are well known in the art. The conventional size of such non-coding sequences is 20 to 100 nucleotides. Depending on a particular embodiment, they are 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, or any range within any of these numbers. In one specific embodiment, these regulatory elements are regulatory elements for plasmid nucleic acid constructs that embed coding sequences, such as the 5’ and 3’ non-coding sequences of the pRF108 plasmid. Specific examples are provided in the sequences described herein: SEQ ID NO: 25 and 26 described herein are used as the 5' uncoded and 3' uncoded sequences of the S segment, respectively, and SEQ ID NO: 27 and 28 described herein are used as the 5' uncoded and 3' uncoded sequences of the L segment, respectively. According to a particular embodiment, the 5' uncoded and 3' uncoded sequences may be sequences having at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identity with any of SEQ ID NO: 26, 27, 28, or 29, which serve as reference sequences, provided that the functionality of the regulating elements of the reference sequence is preserved. The percentage of identity may be calculated based on common sense of those skilled in the art or by following the guidance provided later in this specification. Software tools for calculating the percentage of identity are well-known and readily available to those skilled in the art: they are particularly available free of charge via the Internet. Details of the available tools are provided in the literature. Specifically, the percentage of identity is typically calculated using local or global sequence alignment algorithms and their available computerized implementations. In one particular implementation, the percentage of identity is calculated over the full length of the sequences being compared. Local sequence alignment algorithms aim to find the subsequence with the highest degree of matching between two sequences. An example of a local alignment algorithm is the Smith-Waterman algorithm. Global alignment attempts to compare every residue in each sequence and is most useful when the sequences in the query set are similar and approximately equal in size. A common global alignment technique is the Needleman-Wunsch algorithm. The computerized implementation of the algorithm used is typically associated with default parameters in the literature that can be used to run such an algorithm.Those skilled in the art can easily make adjustments based on their objectives or the sequence comparisons performed.

[0033] According to an aspect applicable to any nucleic acid construct described in any embodiment disclosed herein, a polynucleotide encoding at least one polypeptide or protein heterologous to MOPV (present in the nucleic acid construct of the present invention) is operatively linked to other elements of the nucleic acid construct, particularly those described in a) through e) (if applicable). The expression “operatively linked” may be replaced by the expression “operatively cloned,” referring to the functional cloning or insertion of the heterologous polynucleotide into the nucleic acid construct of the present invention, such that the polynucleotide and the nucleic acid construct can be transcribed efficiently or effectively and translated where appropriate, particularly in cells, cell lines, or host cells used as part of the rescue system for expression or production described herein.

[0034] In other words, for any nucleic acid construct described in any of the embodiments disclosed herein, a polynucleotide encoding at least one polypeptide or protein heterologous to MOPV (present in the nucleic acid construct of the present invention) can also be said to be placed “within the box” relative to a different part of the nucleic acid construct, provided that there is the potential to be transcribed.

[0035] In one particular implementation, it is placed within a box such that a single ORF is ultimately present in the nucleic acid construct.

[0036] The "at least one polypeptide or protein heterologous to MOPV" encoded by the nucleic acid constructs of this invention are polypeptides or proteins for which expression is sought using the platform system of this invention. Therefore, they correspond to nucleic acid sequences that differ from those required for the system to function when used in cells, even if the latter are occasionally non-MOPV sequences (e.g., non-MOPV GPC sequences).

[0037] Therefore, the “at least one polypeptide or protein heterologous to MOPV” encoded by the nucleic acid construct of the present invention corresponds to at least one “heterologous nucleic acid” sequence, which, according to a particular embodiment, is not derived from MOPV isavirus (i.e., non-MOPV nucleic acid molecules), and according to a more particular embodiment, is not derived from isavirus, particularly not from GPC isavirus sequence, and is inserted (e.g., cloned) into a location in the MOPV isavirus genome fragment where the sequence is not naturally present, so as to express the sequence in addition to the expression of the constituent elements required for the MOPV-based platform to function.

[0038] According to a particular embodiment, the “heterologous” polypeptides or proteins expressed by the platform system of the present invention are not merely tags intended to detect the presence or localization of nucleic acid molecules or their target sequences within cells, or merely reporter nucleic acid sequences, even reporter genes with similar purposes, but correspond to “heterologous” polypeptides or proteins expressed by the platform of the present invention that simultaneously have biological functions in the fields of animal or human medical prevention, diagnosis, treatment, or therapy.

[0039] According to a specific implementation, the "heterologous" polypeptides or proteins expressed by the platform system of the present invention are derived from sand virus or sand virus, or even MOPV polypeptides or proteins, but in this case, they are found (and expressed) outside of the expression of the constituent elements required for the platform system of the present invention to function.

[0040] According to a particular implementation, the polynucleotide encoding at least one polypeptide or protein heterologous to MOPV is at least 100 bp in size, particularly 1000 bp to 2500 bp.

[0041] According to a specific implementation, the length of the polynucleotide encoding at least one polypeptide or protein heterologous to MOPV is 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400 or 2500 bp, or any size chosen between any of these boundaries based on all possible combinations thereof.

[0042] According to a specific implementation scheme, the size of the polynucleotide encoding at least one polypeptide or protein heterologous to MOPV is at least 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400 or at least 2500 bp.

[0043] According to a specific embodiment, the size of the polynucleotide encoding at least one polypeptide or protein heterologous to the MOPV is up to 2500, 2400, 2300, 2200, 2100, 2000, 1900, 1800, 1700, 1600, 1500, 1400, 1300, 1200, 1100, or up to 1000 bp. Therefore, according to a specific embodiment, the size of the polynucleotide encoding at least one polypeptide or protein heterologous to the MOPV is 100 to 2500 bp, or 100 to 2000 bp, or 100 to 1500 bp, or 100 to 1000 bp, or 200 to 2500 bp, or 300 to 2500 bp, or 400 to 2500 bp, or 500 to 2500 bp. Other combinations are similarly disclosed based on the list of boundaries set in the paragraphs immediately preceding this paragraph.

[0044] According to a specific embodiment, the polynucleotide encoding at least one polypeptide or protein heterologous to MOPV is at least 1000 bp in size, particularly 1000 bp to 2500 bp, or 1100 bp to 2500 bp, or 1200 bp to 2500 bp, or 1300 bp to 2500 bp, or 1400 bp to 2500 bp, or 1500 bp to 2500 bp, or 1600 bp to 2500 bp, or 1700 bp to 2500 bp, or 1800 bp to 2500 bp, or 1900 bp to 2500 bp, or 2000 bp to 2500 bp, or 2100 bp to 2500 bp, or 2200 bp to 2500 bp, or 2300 bp to 2500 bp, or 2400 bp. From bp to 2500 bp.

[0045] According to a specific implementation, encoding "at least one" polypeptide or protein means one, two, three, four, or five polypeptides or proteins. However, according to the specific implementation reported above, although the nucleic acid construct can carry multiple (several) heterologous polypeptides or proteins, they remain within the same reading frame, resulting in the final presence of a single ORF in the nucleic acid construct (the nucleic acid sequence can subsequently be cleaved into several polypeptides or proteins, with a single ORF present. One way to determine the presence of a single ORF is by the presence of a single start codon in the operable sequence under consideration).

[0046] According to a particular embodiment, the polynucleotide encoding at least one polypeptide or protein heterologous to MOPV is a reporter gene. According to a particular embodiment, the polynucleotide is a cellular ORF, particularly a human cellular ORF. According to a particular embodiment, the polynucleotide encodes an antigenic determinant of a human or animal pathogen or a fragment thereof, or is derived from a human or animal pathogen.

[0047] According to a specific implementation, the polynucleotide encoding at least one polypeptide or protein heterologous to MOPV is neither a tag nor a reporter sequence or gene, similar to that described in the preceding paragraphs, and its size is at least 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400 or at least 2500 bp, and / or its size is at most 2500, 2400, 2300, 2200, 2100, 2000, 1900, 1800, 1700, 1600, 1500, 1400, 1300, 1200, 1100 or at most 1000 bp, or any size selected between any of these boundaries according to all possible combinations thereof.

[0048] According to a specific embodiment, the polynucleotide encoding at least one heterologous polypeptide or protein of MOPV is expressed by the platform of the present invention and has biological function in the fields of animal or human medical prevention, diagnosis, treatment diagnosis or treatment—which is made possible by the platform of the present invention—and its size is at least 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400 or 2500 bp, and / or its size is at most 2500, 2400, 2300, 2200, 2100, 2000, 1900, 1800, 1700, 1600, 1500, 1400, 1300, 1200, 1100 or 1000 bp. bp, or any size chosen between any of these boundaries based on all its possible combinations. For example, a GFP (or similar) reporter sequence, or a Cherry sequence or HA tag, is not an element with a biological function in the context of animal or human medical prevention, diagnosis, treatment, or therapy. Biological function means having a purpose or intervention in the context of animal or human medical prevention, diagnosis, treatment, or therapy that goes beyond merely detecting or localizing molecules within cells, but is purposeful to the patient's whole body in the context of animal or human medical prevention, diagnosis, treatment, or therapy, or directly beneficial to the patient's health through interactions with the patient's cellular or molecular mechanisms.

[0049] According to a specific embodiment that can be combined with any other embodiment described herein, the polynucleotide encoding at least one polypeptide or protein heterologous to MOPV is a cellular ORF, particularly a human cellular ORF, and / or encodes an antigenic determinant of a human or animal pathogen or a fragment thereof, or is derived from a human or animal pathogen, and has a size of at least 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, or 2500 bp, and / or a size of up to 2500, 2400, 2300, 2200, 2100, 2000, 1900, 1800, 1700, 1600, 1500, 1400, 1300, 1200, 1100, or 1000 bp. bp, or any size chosen from any of these boundaries based on all possible combinations thereof.

[0050] According to a specific embodiment, the polynucleotide encoding at least one polypeptide or protein heterologous to MOPV encodes an antigenic determinant of CCHFV or a fragment thereof as described in any embodiment herein, particularly in the experimental portion, for example, taken from IBAR10200 strain (GenBank number NC_005302.1 (NC_005302.1 – SEQ ID NO: 50 – (Crimea-Congo hemorrhagic fever virus S fragment, complete sequence), and NC_005300.2 – SEQ ID NO: 51 – for M fragment (Crimea-Congo hemorrhagic fever virus M fragment, complete sequence)).

[0051] According to a specific embodiment that can be combined with any embodiment disclosed herein, a polynucleotide encoding at least one polypeptide or protein heterologous to MOPV is codon-optimized for expression in a specific cell type, such as codon-optimized to promote expression in mammalian cells, particularly human cells.

[0052] According to a specific embodiment that can be combined with any embodiment disclosed herein, the polynucleotide encoding at least one polypeptide or protein heterologous to MOPV has at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identity with a reference sequence, provided that the functionality of the reference sequence is maintained. The percentage of identity can be calculated according to the guidance provided earlier in this specification.

[0053] Depending on the specific implementation that can be combined with any of the implementations disclosed herein, the reference sequence in the preceding paragraph is the corresponding unoptimized sequence.

[0054] According to a specific implementation, the polynucleotide encoding at least one polypeptide or protein heterologous to MOPV, as a codon-optimized sequence or not, is the NORF (SEQ ID NO: 52) of CCHFV of IBAR10200 strain or the modified NORF (Nmut: SEQ ID NO: 53), while maintaining the functionality (conversion to alanine residue) of the modified position as described herein when considering the optimized sequence.

[0055] According to a specific embodiment, a polynucleotide encoding at least one polypeptide or protein heterologous to MOPV, as a codon-optimized sequence or not, encodes the GP38 sequence of strain IBAR10200, for example as a fusion of polynucleotides corresponding to residues 1-23 and 233-519 (inclusive) of the M fragment ORF of Crimean-Congo hemorrhagic fever virus disclosed in SEQ ID NO: 50.

[0056] According to a specific implementation, a polynucleotide encoding at least one polypeptide or protein heterologous to MOPV, as a codon-optimized sequence or not, encodes the Gn sequence of strain IBAR10200, for example as a fusion of polynucleotides corresponding to residues 1-23 and 506-843 (inclusive) of the M fragment ORF of Crimean-Congo hemorrhagic fever virus disclosed in SEQ ID NO: 51.

[0057] According to a specific implementation, a polynucleotide encoding at least one polypeptide or protein heterologous to MOPV, as a codon-optimized sequence or not, encodes the Gc sequence of strain IBAR10200, for example, a polynucleotide corresponding to residues 956-1684 (inclusive) of SEQ ID NO: 51.

[0058] According to a specific implementation, a polynucleotide encoding at least one polypeptide or protein heterologous to MOPV, as a codon-optimized sequence or not, encodes a sequence corresponding to a chimeric GcGn sequence of strain IBAR10200, for example as a fusion of polynucleotides corresponding to residues 1-23, 506-839 and 996-1684 (inclusive) of SEQ ID NO: 51.

[0059] According to a specific implementation applicable to any nucleic acid construct disclosed herein, when a heterologous sequence or, in particular, a heterologous ORF gene or a heterologous ORF seeking to express it using the platform system of the present invention is inserted into a nucleic acid construct disclosed herein, it is cloned in the same frame as any of the NP, Lpol, or Z sequences that are part of the nucleic acid construct under consideration.

[0060] According to a specific implementation plan, the nucleic acid molecule described herein encodes the full-length recombinant L or S fragment of MOPV.

[0061] According to a particular implementation, the N ORF, Nmut ORF, or GP38 ORF of the CCHFV, particularly as described above and in any of the implementations described herein, is included within the full-length S-fragment of the MOPV.

[0062] According to a particular implementation, the Gc, Gn, or GcGn ORF of CCHFV, particularly as described above and in any of the implementations described herein, is included within the full-length L-fragment of MOPV.

[0063] The ORF of MOPV L polymerase (Lpol) or MOPV Z protein is well known in the art. If necessary, refer to WO2017 / 068190 or Mateo M, Reynard S, Carnec X, et al. Vaccines inducing immunity to Lassa virus glycoprotein and nucleoprotein protect macaques after a single shot. Sci Transl Med. 2019;11(512):1-18 or (Carnec X, Mateo M, Page A, et al. A Vaccine Platform against Arenaviruses Based on a Recombinant Hyperattenuated Mopeia Virus Expressing Heterologous Glycoproteins. J Virol. 2018) or Reynard S, Carnec X, Picard C, et al. A MOPEVAC multivalent vaccine induces sterile protection against New World arenaviruses in non-human primates. Nat Microbiol. 2023, which describes it therein. Those skilled in the art can rely on such descriptions and annotation databases to determine its sequence. Examples are also provided herein by reference to specific sequences that are part of this specification. An exemplary reference sequence for MOPV is the sequence of Mopeia strain AN21366 (GenBank accession numbers JN561684.1 (S fragment) and JN561685.1 (L fragment)).

[0064] Intergenic regions (IGRs) are nucleotide segments located between genes within the genome of a species. Those skilled in the art possess extensive knowledge of IGRs, particularly the IGR regions of MOPVs found in the nucleic acid sequences encoding the L and S fragments of MOPV. Reference can be made in this regard to annotated databases, particularly the reference sequence for MOPVs being the sequence of Mopeia strain AN21366 (GenBank accessions JN561684.1 (S fragment) and JN561685.1 (L fragment)), as well as the examples provided herein. Specifically, SEQ ID NO: 29 provides an example of an intergenic region that can be used in a recombinant S fragment nucleic acid construct according to the present invention, and SEQ ID NO: 30 provides an example of an intergenic region that can be used in a recombinant S fragment nucleic acid construct according to the present invention. According to one specific embodiment, the polynucleotide containing the intergenic region (IGR) of the MOPV, for the S fragment nucleic acid construct, has a sequence of SEQ ID NO: 29 or a variant having at least 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 29, which serves as a reference sequence, particularly whose size differs from the reference sequence by no more than 10%. According to one specific embodiment, correspondingly, the polynucleotide containing the intergenic region (IGR) of the MOPV, for the L fragment nucleic acid construct, has a sequence of SEQ ID NO: 29 or a variant having at least 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 30, which serves as a reference sequence, particularly whose size differs from the reference sequence by no more than 10%.

[0065] Depending on the specific implementation, the IGR variants described herein retain the functional characteristics of their reference sequence, which may be related to their secondary structure.

[0066] Those skilled in the art also possess knowledge of the polynucleotide sequences encoding 2A self-splicing peptides. Such sequences are well known in the art. 2A self-splicing peptides, or 2A peptides, are a class of peptides approximately 20 amino acids in length, typically having 18 to 22 amino acids, which can induce ribosome jumping during protein translation within cells. Self-splicing 2A peptides can generate equimolar levels of multiple nucleic acid molecules from the same mRNA.

[0067] The following provides exemplary sequences of common 2A peptides.

[0068] These peptides share a core sequence motif, DxExNPGP: in genetic engineering, they can cleave longer peptides into two shorter ones. In some cases, an optional linker, such as "GSG" (glycine-serine-glycine), can be found at the N-terminus (5' end) of the 2A peptide, which helps improve efficiency.

[0069] It is worth noting that this document describes the use of 2A self-cleaving peptides with or without such optional linkers as "GSG". According to one specific embodiment, the 2A self-cleaving peptide has a linker "GSG". Correspondingly, the nucleotide sequence containing the 2A peptide sequence can be a codon-optimized sequence. Therefore, regardless of whether the nucleotide sequence corresponding to the 2A peptide sequence is an optimized sequence, they have the same peptide sequence. According to one specific embodiment, the nucleotide sequence corresponding to the 2A self-cleaving peptide is not an optimized sequence. According to another specific embodiment, the nucleotide sequence corresponding to the 2A self-cleaving peptide is an optimized sequence. According to one specific embodiment, the nucleotide sequence corresponds to a P2A peptide.

[0070] Numerous examples of optimized and non-optimized P2A sequences are available in the literature. For instance, optimized sequences available under the following GenBank accessions can be cited: MQ290132.1, MQ290131.1, MQ086759.1, MP711669.1, MP711668.1, LP836003.1, LP836002.1, LP981116.1, or LP981115.1 (SEQ ID NOs: 31 to 33 in this document). These sequences are 66 bp in length, including 9 bp for the so-called GSG connector and 57 bp for the P2A sequence itself. Further examples are provided in the Examples section of this document (see the provided construct sequences, as noted). According to a specific embodiment, the polynucleotide sequence encoding the 2A self-splicing peptide is a sequence of any one of SEQ ID NO: 31 to 33 that does not contain the "GSG" portion, or a variant having at least 95%, 96%, 97%, 98%, or 99% identity with any one of SEQ ID NO: 31 to 33 as a reference sequence, particularly wherein its size differs from the size of the reference sequence by no more than 10%. According to a specific embodiment, the polynucleotide sequence encoding the 2A self-splicing peptide is as defined in any description provided herein, or a variant having at least 95%, 96%, 97%, 98%, or 99% identity with the description provided herein as a reference sequence, particularly wherein its size differs from the size of the reference sequence by no more than 10%.

[0071] According to a specific implementation, the 2A peptide variants described herein retain the functional properties of their reference sequence, which may be related to their secondary structure.

[0072] Those skilled in the art also possess knowledge of sequences for polynucleotide linker sequences to be discovered at the 5' end of a polynucleotide encoding a 2A self-cleaving peptide, examples of which are provided in the Examples section of this document (see the provided construction sequences, as noted). Such sequences can be 6 to 45 nucleotides in length, corresponding to 2 to 15 amino acids, and are known to those skilled in the art to function as linkers. This function can typically be assessed by determining the cleavage efficiency of the 2A peptide immediately following the linker.

[0073] According to a particular implementation, the length of the sequence is selected from the following nucleotides: 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, and 45, which correspond to amino acid linker lengths of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, and 15 amino acids, respectively.

[0074] Most typically, such sequences are 6 to 12 nucleotides in length, especially 9 nucleotides (corresponding to 3 amino acids). These 3-amino acid linker sequences usually have the amino acid sequence of GSG, whose corresponding nucleotide sequence takes into account the degeneracy of nucleotide codons.

[0075] According to a particular implementation, the selected adapter has a sequence that is non-immunogenic to the host to which the adapter is applied, or has no immunogenic effect.

[0076] MOPV NP proteins with reduced exonuclease activity and their corresponding nucleotide sequences are well documented in the art. See, for example, their descriptions in WO2017 / 068190 or WO2023 / 175044, which are incorporated herein by reference in their entirety.

[0077] According to a specific embodiment in which the nucleic acid construct encodes a MOPV nucleoprotein (NP) with weakened exonuclease activity, the latter being encoded by a polynucleotide in which one or more mutations are introduced relative to the sequence of the wild-type MOPV NP, resulting in partial or complete loss of the exonuclease activity of the NP.

[0078] "Nucleic acid encoding MOPV nucleoprotein (NP) with weakened exonuclease activity" herein refers to a nucleic acid molecule containing an ORF of the Mopeia virus nucleoprotein, wherein the ORF contains codon mutations relative to the wild-type Mopeia virus ORF to express a nucleoprotein with weakened exonuclease activity (also referred to in the art as ribonuclease activity). The codon mutations encompass mutations in at least two codons, particularly in codons 2, 3, 4, 5, or 6, wherein these mutations collectively result in impaired, particularly weakened or inhibited, exonuclease activity of the encoded mutant nucleoprotein relative to the wild-type MOPV nucleoprotein. Examples have been described in WO2017 / 068190 or WO2023 / 175044, which can be referenced herein for the mutant amino acid residues of the wild-type Mopeia virus nucleoprotein and can be deduced from the substituted amino acid residues.

[0079] According to a specific implementation, "nucleoprotein (NP)" refers to a nucleoprotein that has been mutated relative to the wild-type nucleoprotein of MOPV strain AN21366 (GenBank accession number: AEO89356.1), said mutation being the substitution of at least two, particularly 2, 3, 4, 5, or 6 amino acid residues, wherein said mutation collectively results in impaired, particularly attenuated or inhibited, exonuclease activity of the wild-type MOPV nucleoprotein (corresponding to the disclosure in section "C. Attenuation of MOPV" of WO2017 / 068190). The aim is to obtain attenuated live MOPV that can replicate in the host to a degree sufficient to induce an immune response but insufficient to induce disease. Therefore, according to a specific embodiment of this disclosure, if the NP of Mopea virus (MOPV) is mutated relative to the wild-type NP of MOPV strain AN21366, and said mutation destabilizes and / or eliminates the exonuclease activity of the wild-type NP of MOPV strain AN21366, then the Mopea virus (MOPV) is said to be attenuated by impaired, particularly weakened or inhibited, exonuclease activity of the wild-type nucleoprotein of MOPV. In other words, the attenuation of MOPV used in this invention through mutation results in the loss of function of the NP of MOPV present in the virus, and said loss of function can be readily determined by appropriate experimental setup, according to detailed guidance known in the art and therefore available to those skilled in the art, or guidance provided in the literature, particularly the guidance provided in WO2017 / 068190.

[0080] According to a specific implementation scheme, the loss of function of NP exonuclease activity relative to the reference value can reach (minus) 50%, 60%, 70%, 80%, 90%, or 100%, as achieved through appropriate experimental settings (e.g., Example 6 of WO2017 / 068190 and WO2017 / 068190). Figure 7 The reporter gene assay disclosed in WO2017 / 068190 was used to compare the activity of IFN antagonists in the test NP mutants. According to this exemplary reporter gene assay, the activity of IFN antagonists in the test NP mutants was measured. In one specific embodiment of this exemplary assay, cells transfected with a plasmid encoding a luciferase driven by the IRF-3 promoter and a plasmid encoding wild-type (wt) or mutant NPs were infected with Sendai virus (SeV), a strong inducer of IRF-3 and IFN responses. The induction of IFN-derived promoters by Sendai virus (SeV) could then be evaluated in transfected cells expressing different NP mutants. Figure 7 B demonstrates that, in the case of WO2017 / 068190, NP-wt can block the induction of luciferase expression in response to SeV. Conversely, all mutants tested in WO2017 / 068190 with mutations in the so-called ExoN domain were affected in their ability to reduce reporter gene expression induction. Therefore, by comparing the observed degree of signal regulation (in Example 6 of WO2017 / 068190 and...), Figure 7 In the case of the disclosed assay, if necessary, by referring to the induction observed against SeV (the signal may correspond to the absolute value or fold change induced by IRF3), those skilled in the art can readily determine whether the loss of function of the exonuclease activity of a particular mutant relative to the exonuclease activity of the NP in the MOPV strain AN21366 reaches the level of (minus) 50%, 60%, 70%, 80%, 90%, or 100% as defined herein for assessing the presence of the loss of function of the exonuclease activity of the NP in MOPV.

[0081] Therefore, those skilled in the art can readily determine the applicability of mutations leading to loss-of-function mutations. The exonuclease activity-responsible domain of the wild-type NP of MOPV strain AN21366 is located between residues 340 and 570 of GenBank accession number AEO89356.1 (this entry is also reproduced in SEQ ID NO: 34 herein), describing the nucleoprotein itself: therefore, it can be used to identify the amino acids mentioned in this specification, and thus, starting from its initial identification in sequence AEO89356.1, the corresponding amino acids can be readily identified in different sequences. For example, accession number JN561684.1 describes the complete CDS of the glycoprotein precursor (GPC) and nucleoprotein (NP) genes of the MOPV strain AN 21366-BNI S fragment—starting from the position in the amino acid sequence, a correspondence can also be established in the corresponding nucleic acid sequence. Any part of the domain between residues 340 and 570 of GenBank accession number AEO89356.1 can be mutated to destabilize and / or eliminate the exonuclease activity of wild-type NP in MOPV strain AN21366, particularly where the loss of function of NP exonuclease activity relative to the reference value of NP exonuclease activity in MOPV strain AN21366 can reach the level of (minus) 50%, 60%, 70%, 80%, 90% or 100% as described above.

[0082] According to a specific aspect, residues 390, 392, 393, 430, 467, 529, and 534 of the sequence found under GenBank accession number AEO89356.1 are known to specifically participate in the exonuclease activity of MOPV, and these residues are located in the exonuclease activity-responsible domain of wild-type NP in MOPV strain AN21366. Therefore, such residues can be targeted by mutations. It should be understood that mutations of residues surrounding residues 390, 392, 393, 430, 467, 529, and 534 of SEQ ID NO: 34, and / or mutations of residues between residues 340 and 570 of SEQ ID NO: 34, can also be appropriate as loss-of-function mutations as defined herein (see above for a description of how to identify these residues in any sequence that may contain them).

[0083] According to a specific embodiment, amino acid positions D390 and G393 of the MOPV nucleoprotein are substituted to weaken the exonuclease function of the nucleoprotein (NP) (see above for instructions on how to identify these residues in any sequence that may contain them. This applies to any amino acid numbering mentioned herein in the same context). In a specific embodiment, the amino acid substitutions are D390A and G393A (MOPV-ExoN in WO2017 / 068190). While the specific mutations described above were determined with reference to the positions of amino acid residues in the nucleoprotein sequence of Mopeia strain AN21366, those skilled in the art can readily define the corresponding polynucleotide sequences to be considered. The S fragment of Mopeia strain AN21366 is disclosed under GenBank accession number JN561684.1 and includes the MOPV nucleoprotein sequence AEO89356.1, and the L fragment of Mopeia strain AN21366 is disclosed under GenBank accession number JN561685.1 – the correspondence to the polypeptide sequence can be readily accomplished using the annotated sequences in the database.

[0084] If a Mopea virus strain different from the Mopea strain AN21366 is used according to the present invention, the amino acid residues can be easily determined by comparing the amino acid sequence with the NP sequence of the Mopea strain AN21366.

[0085] According to other embodiments, it can be cumulative with the above embodiments, or, according to any combination of possible substitutions, at least one additional amino acid substitution can be added at the position selected from E392, H430, D467, H529, and D534 of the MOPV nucleoprotein of Mopeia strain AN21366. In a specific embodiment, the additional substitution is selected from E392A, H430A, D467A, H529A, and D534A, or any combination thereof.

[0086] In some embodiments, the nucleoprotein, relative to the NP sequence of Mopeia strain AN21366, includes an amino acid substitution at amino acid position D390 or G393. In some embodiments, the nucleoprotein, relative to the NP sequence of Mopeia strain AN21366, includes an amino acid substitution at amino acid position D390 or G393, and further includes at least one amino acid substitution selected from positions E392, H430, D467, H529, and D534. In some embodiments, the nucleoprotein, relative to the NP sequence of Mopeia strain AN21366, includes amino acid substitutions at amino acid positions D390 and G393. In some embodiments, the nucleoprotein, relative to the NP sequence of Mopeia strain AN21366, includes amino acid substitutions at amino acid positions D390 and G393, and further includes at least one amino acid substitution selected from positions E392, H430, D467, H529, and D534.

[0087] In some embodiments, the nucleoprotein contains an amino acid substitution of D390A or G393A. In some embodiments, the nucleoprotein contains amino acid substitutions of both D390A and G393A. In some embodiments, the nucleoprotein further contains at least one amino acid substitution selected from E392A, H430A, D467A, H529A, and D534A. In some embodiments, it contains amino acid substitutions of D390A, G393A, E392A, H430A, D467A, H529A, and D534A. The recombinant attenuated MOPV enhanced in WO2017 / 068190, containing amino acid substitutions at amino acid positions D390A, G393A, E392A, H430A, D467A, H529A, and D534A, is named MOPV-ExoN, as described in the Examples section of this document. Figure 7 The "MOPEVAC NP plasmid" is also known as "ExoN". ko "NP ORF", in which the six mutated residues responsible for eliminating exonuclease activity are displayed in white text against a black background (or underlined as described below: "For ExoN..."). ko The NP ORF, the six mutated residues responsible for eliminating exonuclease activity, is shown in SEQ ID NO: 41 described herein. underline (”).

[0088] However, it is readily understood from the above that those skilled in the art can define different mutations for the same purpose of eliminating exonuclease function. According to a particular embodiment, amino acid positions D390, H430, and D467 of the MOPV nucleoprotein of the Mopeia strain AN21366 are substituted to weaken the exonuclease function of the nucleoprotein (NP). In a specific embodiment, the amino acid substitutions are D390A, H430A, and D467A. According to other embodiments, this can be cumulative with the previously described embodiments, or, according to any combination of possible substitutions, at least one additional amino acid substitution is added at a position selected from E392, G393, H529, and D534 of the MOPV nucleoprotein of the Mopeia strain AN21366. In a specific embodiment, the additional substitution is selected from E392A, G393A, H529A, and D534A, or any combination thereof. In some embodiments, particularly relative to the sequence of Mopeia strain AN21366, the nucleoprotein contains an amino acid substitution of D390A, H430A, or D467A (one substitution). In some embodiments, particularly relative to the sequence of Mopeia strain AN21366, the nucleoprotein contains amino acid substitutions of D390A, H430A, and D467A (three substitutions). In some embodiments, particularly relative to the sequence of Mopeia strain AN21366, the nucleoprotein further contains at least one amino acid substitution selected from E392A, G393A, H529A, and D534A. In some embodiments, particularly relative to the sequence of Mopeia strain AN21366, it contains amino acid substitutions of D390A, H430A, D467A, E392A, G393A, H529A, and D534A.

[0089] When substitutions are present, they are defined above relative to the Mopea strain AN21366. According to a specific embodiment, the remaining portion of the nucleic acid of the ORF encoding the MOPV nucleoprotein (NP) with weakened exonuclease activity (discussed in the preceding paragraphs) has a sequence that is either a sequence of the Mopea strain AN21366 or a corresponding (aligned) wild-type sequence of MOPV, particularly with the corresponding sequences of MOPV strain AN21366 (Genbank accession numbers JN561684.1 (which includes the MOPV nucleoprotein sequence AEO89356.1) and JN561685.1, respectively), possessing at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity. The percentage of identity can be calculated based on common sense in those skilled in the art. The following guidance is provided if needed. Software tools used for calculating the percentage of identity are well-known and readily available to those skilled in the art: they are particularly available free of charge via the Internet. The literature provides detailed information on available tools. In particular, the identity percentage can typically be calculated using local or global sequence alignment algorithms and their available computerized implementations. In a particular implementation, the identity percentage is calculated over the entire length of the sequences being compared. When the sequences in the query set are similar and approximately equal in size, attempting a global alignment of every residue in each sequence is most useful. The computerized implementations of the algorithms used are typically associated with default parameters in the literature, which can be used to run one or another of such algorithms. Those skilled in the art can readily adapt these parameters, taking into account their purpose or the sequence comparisons being performed.

[0090] According to a specific implementation scheme, the mutation of MOPV NPs to attenuate MOPV still enables the mutated NPs to support viral transcription and replication in order to produce recombinant viruses (production step).

[0091] MOPV or non-MOPV glycoprotein precursors (GPCs) (including arenavirus glycoprotein precursors (GPCs) and their corresponding nucleotide sequences) are well described in the art. See, for example, the same descriptions in WO2017 / 068190 or WO2023 / 175044, which are incorporated herein by reference in their entirety.

[0092] According to a specific implementation scheme in which the nucleic acid construct encodes a GPC, the GPC may be derived, without limitation, from one of the following arena viruses: Lassa virus (LASV) – Genbank accession number AAA46286.1 (protein), from J04324.1 (S fragment), Machupo virus (MACV – see accession number below), Sabya virus (SABV – see accession number below), Chapare virus (CHAPV – see accession number below), Junin virus (JUNV – see accession number below), Guanarito virus (GTOV – see accession number below), Lujo virus (see accession number below), and Whitewater Arroyo virus (see accession number below).

[0093] Those skilled in the art will understand that the genomic sequences of various cited arenaviruses, as well as the genomic sequences of proteins encoded by these arenaviruses, are publicly available. For example, they can be found on the Virus Sequence Database (VSD) website, established and maintained by the Center for Immunology and Pathology, National Institutes of Health, Korea Centers for Disease Control and Prevention.

[0094] In addition, for example, the following GPC (protein) sequence: Machupo virus (MACV) can be found under Genbank accession number AAT40451.1 (protein) and Genbank accession number AY619643 (S fragment). - SABV can be found under Genbank accession number YP_089665.1 (protein) and Genbank accession number NC_006317 (S fragment). - Chapare virus (CHAPV) can be found under Genbank accession number YP_001816782.1 (protein) and Genbank accession number NC_010562 (S fragment). Junin virus (JUNV) can be found in Genbank accession number WAD86878.1 (protein), from OL774853.1 (S fragment). - Guanarito virus (GTOV) can be found under Genbank accession number AAN05423.1 (protein) and Genbank accession number AY129247 (S fragment). - Luho virus can be found in GenBank accession number YP_002929490.1 (protein), from NC_012776.1 (S fragment), and... - Whitewater Arroyo virus can be found in GenBank accession number AAN09950.1 (protein), from AF485264.1 (S fragment).

[0095] If not available in public databases, the corresponding nucleotide sequence can be readily deduced from the sequences described above, and if relevant, genetic code degeneracy or codon optimization should be considered. Examples are also provided in the example plasmid constructs of SEQ ID NO: 17 to 24 in this specification.

[0096] According to a specific embodiment, the nucleic acid construct of the present invention encoding a recombinant L fragment of Mopeya virus (MOPV) has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with any of the corresponding segments of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 15, or SEQ ID NO: 16 (excluding excluded segments) in all segments not annotated as corresponding to a cloning cassette (for SEQ ID NO: 1 or SEQ ID NO: 2), a heterologous ORF (SEQ ID NO: 15, or SEQ ID NO: 16). Such a nucleic acid construct further comprises a polynucleotide encoding at least one heterologous polypeptide or protein of MOPV as defined herein.

[0097] According to a specific implementation, the nucleic acid construct of the present invention encoding the recombinant S fragment of Mopeya virus (MOPV) is associated with all segments not annotated as corresponding to a cloning cassette (for any one of SEQ ID NO: 3 or SEQ ID NO: 17 to 24), a heterologous ORF (SEQ ID NO: 13 or SEQ ID NO: 14), or a pRF108 plasmid (all of SEQ ID NO: 3, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, or SEQ ID NO: 24). 22. Any of the corresponding segments of SEQ ID NO: 23 or SEQ ID NO: 24 (excluding excluded segments) has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity. Such nucleic acid constructs further comprise a polynucleotide encoding at least one heterologous polypeptide or protein for MOPV as defined herein.

[0098] The present invention also relates to expression cassettes or vectors comprising nucleic acid constructs encoding recombinant S or L fragments of Mopeia virus according to any embodiment defined or disclosed herein, particularly vectors of expression vectors, and more particularly vectors of plasmids.

[0099] Typically, an expression cassette is a component of a nucleotide vector, consisting of one or more ORFs or genes to be expressed by transfected cells, along with regulatory sequences controlling their expression. An expression cassette usually contains a promoter sequence and at least one ORF or gene. It may contain a 3' untranslated region. Depending on the specific implementation, a mouse Pol I promoter and terminator (pPolI) may be used within the expression cassette to express transcripts of the S and L fragments described herein.

[0100] According to a specific implementation, the nucleic acid construct of the present invention is embedded as an expression cassette in the pRF108 plasmid (FlickR, Pettersson RF. Reverse genetics system for Uukuniemi virus (Bunyaviridae): RNA polymerase I-catalyzed expression of chimeric viral RNAs. J Virol. 2001 Feb;75(4):1643-55), which also contains a mouse Pol I promoter and terminator (pPolI), and can be used to express transcripts of the S and L fragments of the recombinant MOPV according to the present invention.

[0101] According to a specific embodiment, the expression cassette or vector of the present invention encoding the recombinant L fragment of Mopeya virus (MOPV) has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with any of the corresponding segments of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 15, or SEQ ID NO: 16 (excluding excluded segments) in all segments not annotated as corresponding to a cloning cassette (for SEQ ID NO: 1 or SEQ ID NO: 2) or a heterologous ORF (SEQ ID NO: 15 or SEQ ID NO: 16). Such nucleic acid constructs further comprise a polynucleotide encoding at least one heterologous polypeptide or protein of MOPV as defined herein.

[0102] According to a specific embodiment, the expression cassette or vector of the present invention encoding the recombinant S fragment of Mopeya virus (MOPV) has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with any of the corresponding segments of SEQ ID NO: 3, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, or SEQ ID NO: 24 (excluding excluded segments) in all segments not annotated as corresponding to clone cassettes (for any one of SEQ ID NO: 3 or SEQ ID NO: 17 to 24) or heterologous ORFs (SEQ ID NO: 13 or SEQ ID NO: 14). Such nucleic acid constructs further contain polynucleotides encoding at least one polypeptide or protein as defined herein for MOPV heterologs.

[0103] Those skilled in the art will recognize that other plasmids can be used to express the recombinant viral fragments of the present invention, such as plasmids in which a nucleic acid construct encoding a recombinant S or L fragment of Mopeia virus is cloned between, for example, the promoter and terminator of a T7 RNA polymerase, thereby enabling the generation of the fragment in the cytoplasm of a host cell – see, for example, Albariño CG, Bergeron E, Erickson BR, Khristova ML, Rollin PE, Nichol ST. Efficient reverse genetics generation of infectious junin viruses differing in glycoprotein processing. J Virol. 2009 Jun;83(11):5606-14. It is important to note that the promoter for the full-length recombinant S or L fragment used to transcribe the mopeya virus can be found in the expression cassette, particularly in the plasmid, while the ambiguous viral ORF is expressed from the 5' and 3' non-coding sequences of the nucleic acid construct of this invention. According to this scheme, the ambiguous nature of the final expression is independent of the promoter used for the full-length recombinant S or L fragment used to transcribe the mopeya virus, which can be present in the expression cassette, particularly in the plasmid.

[0104] The present invention also relates to eukaryotic cells, particularly eukaryotic host cells comprising nucleic acid constructs, expression cassettes, or vectors according to any embodiment defined or disclosed herein.

[0105] According to a specific embodiment, the cell or host cell is a VeroE6 cell. According to a specific embodiment, the cell or host cell is a VeroNP cell, that is, a cell derived from VeroE6 cells and stably expressing wild-type (wt) Mopeya NP. According to a specific embodiment, the cell or host cell is a VERO-NP cell deposited at CNCM (National Center for Microbial Culture Collection) on February 2, 2024, with accession number CNCM I-6034.

[0106] To express one or more heterologous polypeptides or proteins or fragments thereof for Mopeya virus (MOPV), a reverse genetics system as disclosed in the art must be used (particularly the system disclosed in the section "B. Reverse genetics system for MOPV" of WO2017 / 068190). Therefore, in such a system, eukaryotic cells are used as helper cells to express recombinant MOPV particles while simultaneously expressing heterologous sequences according to the invention. In such a reverse genetics system, the eukaryotic cells are transformed, particularly transfected with a variety of polynucleotides covering the following: a) The first plasmid contains a polynucleotide that serves as an expression cassette, encoding a DNA molecule that encodes the MOPV recombinant L fragment (L fragment expression cassette). b) A second plasmid containing a polynucleotide that serves as an expression cassette, encoding a DNA molecule that encodes the MOPV recombinant S fragment (S fragment expression cassette). c) An expression cassette for the Mopeia virus L protein, wherein, in particular, the expression cassette is contained in a third plasmid. d) An expression cassette for the NP protein of Lassa or Mopeya virus, wherein in particular the expression cassette is contained in a fourth plasmid.

[0107] Therefore, the present invention also relates to a method for expressing one or more polypeptides or proteins or fragments thereof that are heterologous to Mopea virus (MOPV) in eukaryotic host cells and / or for producing recombinant attenuated live Mopea virus (MOPV) that expresses one or more polypeptides or proteins or fragments thereof that are heterologous to MOPV, wherein the method comprises the following steps: a) Transfect the eukaryotic host cell with the following: o The first plasmid contains polynucleotides that serve as an expression cassette encoding the recombinant L fragment of MOPV; o The second plasmid contains polynucleotides that serve as an expression cassette encoding the recombinant S fragment of MOPV; o An expression cassette for the Lpol protein in MOPV, wherein, in particular, the expression cassette is contained in a third plasmid; and o An expression cassette for the NP protein of Lassa virus or MOPV, wherein in particular the expression cassette is contained in a fourth plasmid; The first plasmid and / or the second plasmid comprises a nucleic acid construct as defined in any of the embodiments described herein, which contains a polynucleotide encoding at least one polypeptide or protein heterologous to MOPV, and b) Allows for the formation of ribonucleoproteins of recombinant MOPV, thereby enabling the expression of recombinant attenuated live virus particle assemblies, and simultaneously enabling the expression of at least one polypeptide or protein encoded by polynucleotides of the first plasmid and / or the second plasmid, and c) Recover the expressed polypeptide or protein, and optionally recover the recombinant attenuated live Mopeia virus generated after step b).

[0108] Depending on the eukaryotic host cell used, the resulting recombinant attenuated live Mopeia virus can be recovered after budding from the cell membrane.

[0109] Specific protocols may be followed or used as guidance to perform the methods described herein for expressing one or more heterologous peptides or proteins or fragments thereof for Mopea virus (MOPV) in eukaryotic host cells and / or generating recombinant attenuated live Mopea virus (MOPV) expressing one or more heterologous peptides or proteins or fragments thereof for MOPV. For example, refer to Carnec X, Baize S, Reynard S, Diancourt L, Caro V, Tordo N, Bouloy M. Lassa virus nucleoprotein mutants generated by reverse genetics induce arobust type I interferon response in human dendritic cells and macrophages. JVirol. 2011 Nov;85(22):12093-7. Also refer to the Materials and Methods section of this application (“Rescue Experiments and Virus Stockpile Preparation” section).

[0110] According to a specific embodiment, and as an example of a first plasmid containing a polynucleotide encoding an expression cassette encoding a recombinant L fragment of MOPV, such a polynucleotide may encompass a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with any corresponding segment of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 15, or SEQ ID NO: 16 (excluding excluded segments) in all segments not annotated to correspond to a cloning cassette (for SEQ ID NO: 1 or SEQ ID NO: 2), a heterologous ORF (SEQ ID NO: 15, or SEQ ID NO: 16). Such a nucleic acid construct also contains a polynucleotide encoding at least one polypeptide or protein heterologous to MOPV as defined herein. Such polynucleotides may also encompass sequences that have at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the segments of the pRF108 plasmid annotated as belonging to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 15, or SEQ ID NO: 16.

[0111] According to a specific embodiment, the first plasmid in the above method case has the sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 15 or SEQ ID NO: 16 in all portions of the heterologous ORF that do not correspond to the sequence described herein, and also contains a polynucleotide encoding at least one polypeptide or protein heterologous to MOPV as defined herein.

[0112] According to a specific implementation scheme, and as an example of a second plasmid containing a polynucleotide as an expression cassette (S-fragment expression cassette) encoding a DNA molecule encoding a recombinant S-fragment of MOPV, such a polynucleotide may encompass a nucleic acid sequence in all segments not annotated as corresponding to a cloning cassette (for any one of SEQ ID NO: 3 or SEQ ID NO: 17 to 24) or a heterologous ORF (SEQ ID NO: 13 or SEQ ID NO: 14) or a pRF108 plasmid (all of SEQ ID NO: 3, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 or SEQ ID NO: 24), corresponding to SEQ ID NO: 3, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 24. 19, any corresponding segment of SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, or SEQ ID NO: 24 (excluding excluded segments) has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity. Such nucleic acid constructs also contain a polynucleotide encoding at least one polypeptide or protein heterologous to MOPV as defined herein. Such polynucleotides may also encompass sequences that have at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the segments of the pRF108 plasmid annotated as belonging to SEQ ID NO: 3, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, or SEQ ID NO: 24.

[0113] According to a specific embodiment, the first plasmid in the above method case has the sequence of SEQ ID NO: 3, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 or SEQ ID NO: 24 in all portions of the heterologous ORF that do not correspond to the sequence described herein, and further comprises a polynucleotide encoding at least one polypeptide or protein heterologous to MOPV as defined herein.

[0114] According to a specific implementation scheme, and as an example of a third plasmid, the expression cassette for the Mopeia virus L protein may be the relevant portion of SEQ ID NO: 4, or the plasmid shown in SEQ ID NO: 4 as provided herein.

[0115] According to a specific implementation scheme, and as an example of a fourth plasmid, the expression cassette for the NP protein of MOPV may be the relevant portion of SEQ ID NO: 5, or the plasmid shown in SEQ ID NO: 5 as provided herein.

[0116] In some implementations, the supernatant of eukaryotic cells expressing recombinant attenuated live Mopeia virus is used for an additional amplification step by adding the supernatant to VeroE6 (or VeroNP) cells.

[0117] In a particular implementation, the first, second, and, when used, third and fourth polynucleotides are DNA or cDNA.

[0118] In a particular embodiment, the expression cassette for the Lassa virus or Mopeya virus NP protein is contained in a fourth plasmid and contains the unmutated NP protein, i.e., the wild-type NP protein from Lassa virus or Mopeya virus. While not mandatory, this may be beneficial for rescue. It should be noted that in this case, the expression of the wild-type NP protein is strictly limited to the fourth plasmid.

[0119] In another specific embodiment, the expression cassette for the NP protein of Lassa virus or Mopeya virus, particularly such as an expression cassette contained in a fourth plasmid, contains the NP protein, which is mutated by substitution of amino acid residues in the wild-type NP of Lassa virus or Mopeya virus to have reduced exonuclease activity.

[0120] According to a specific embodiment of the method described herein, the first plasmid comprises a nucleic acid construct as defined in any of the embodiments described herein, which comprises a nucleic acid molecule encoding a recombinant L fragment of Mopeya virus (MOPV).

[0121] It should be understood that, depending on the specific implementation, only one of the above-described nucleic acid constructs may be used in the above method, whether in the first plasmid of step a) or in the second plasmid of step b).

[0122] According to a more specific implementation, when the sole nucleic acid construct used is the nucleic acid construct in the recombinant L fragment of the first plasmid, the second plasmid used in this method, according to the specific implementation, comprises a nucleic acid construct containing a polynucleotide encoding a MOPV nucleoprotein (NP) with weakened exonuclease activity, specifically containing an ORF of the nucleoprotein (NP) protein, which is mutated by substituting amino acid residues in the wild-type NP of Mopeia virus to have weakened exonuclease activity. Examples of this are provided herein. Similarly, the second plasmid used in this method may then also contain a polynucleotide encoding a MOPV or non-MOPV glycoprotein precursor (GPC), particularly an Old World or New World arena virus GPC. Examples of this are provided herein.

[0123] According to a specific embodiment of the method described herein, the second plasmid comprises a nucleic acid construct as defined in any of the embodiments described in this specification, comprising a nucleic acid molecule encoding a recombinant S fragment of Mopea virus (MOPV), particularly a nucleic acid molecule encoding a recombinant chimeric S fragment of Mopea virus (MOPV) that lacks the ORF of the Mopea virus glycoprotein precursor (GPC) and contains the ORF of a GPC protein selected from the following Old World or New World sandworm viruses: Lassa virus (LASV), Lujo virus (LUJV), Machupo virus (MACV), Sabya virus (SABV), Chapare virus (CHAPV), Junin virus (JUNV), Guanarito virus (GTOV), or Whitewater Arroyo virus. Examples are provided herein. The first plasmid used may then be based on or not based on the nucleic acid construct of the invention disclosed herein.

[0124] According to another embodiment, the two nucleic acid constructs of the present invention as described in any embodiment herein can be used in a method of expressing one or more polypeptides or proteins or fragments thereof that are heterologous to Mopea virus (MOPV) in eukaryotic host cells and / or generating recombinant attenuated live Mopea virus (MOPV) while simultaneously expressing one or more polypeptides or proteins or fragments thereof that are heterologous to MOPV, namely a nucleic acid construct for recombinant L fragment and a nucleic acid construct for recombinant S fragment.

[0125] When each of the first and second plasmids contains a nucleic acid construct that includes a polynucleotide encoding at least one polypeptide or protein heterologous to MOPV, it allows the expression of at least two heterologous ORFs from a single recombinant virus, due to the dual-fragmented nature of the MOPV genome and the discovery that both the S and L fragments of MOPV, as described herein, can carry “exogenous” sequences.

[0126] To implement methods for expressing one or more heterologous peptides or proteins or fragments thereof for Mopea virus (MOPV) in eukaryotic host cells, and / or for producing recombinant attenuated live Mopea virus (MOPV) while simultaneously expressing one or more heterologous peptides or proteins or fragments thereof for MOPV, those skilled in the art will understand that, generally, the nucleic acid constructs of the present invention can be present in expression cassettes or vectors containing nucleic acid constructs according to any embodiment defined or disclosed herein, particularly expression vectors, and more particularly plasmid vectors, thereby enabling the use of said nucleic acid constructs in the methods discussed in the preceding paragraphs. Those skilled in the art can readily prepare them based on their knowledge, existing information in the art, particularly the patent applications and documents upon which this specification relies, and the experimental portions disclosed herein (if further guidance is required).

[0127] For example, in addition to the ORF, the expression cassette also contains expression control sequences, including promoters and terminators suitable for expressing nucleic acids in host cells.

[0128] When cloned into a plasmid, the nucleic acid constructs of the present invention can also utilize the control sequences of the plasmid, such as promoters and / or terminators suitable for expressing nucleic acids in host cells. Additional non-template G bases can be included at the beginning of the cloning sequence, i.e., the heterologous nucleic acid, to enable proper transcription and replication of the viral fragment driven by the plasmid (see, for example, the Materials and Methods section “Plastics” in WO2017 / 068190, and / or Carnec X, Mateo M, Page A, Reynard S, Hortion J, Picard C, Yekwa E, Barrot L, Barron S, Vallve A, Raoul H, Carbonnelle C, Ferron F, Baize S. A Vaccine Platform against Arenaviruses Based on a Recombinant Hyperattenuated Mopeia Virus Expressing Heterologous Glycoproteins. J Virol. 2018 May 29;92(12):e02230-17; Zivcec M, Scholte FE, Spiropoulou CF, Spengler JR, Bergeron É. Molecular Insights into Crimean-Congo Hemorrhagic Fever Virus). Viruses. 2016 Apr 21;8(4):106 (Materials and Methods section).

[0129] Therefore, according to a particular implementation, the polynucleotide present in any of the nucleic acid constructs described herein that encodes at least one polypeptide or protein heterologous to MOPV has an additional non-template -G base at its 5' end.

[0130] In some embodiments, in order to implement the method according to the invention described above by a reverse genetics system, polynucleotides encoding the L and S segments of the genome of MOPV strain AN21366 (GenBank accession numbers JN561684.1 and JN561685.1) are used as templates for producing the desired construct by reverse genetics for each associated L or S segment.

[0131] In one particular implementation, under the above-described production method, the MOPV strain encoding the reverse genome transcripts for the L and S fragments to provide the first, second, and optionally third and fourth polynucleotides is MOPV strain AN21366 (GenBank accession numbers JN561684.1 and JN561685.1).

[0132] For the purpose of preparing rescued recombinant attenuated live Mopeia virus, the first, second, and, as used herein, third and fourth polynucleotides contain transcription and expression control sequences, such as promoter and terminator sequences.

[0133] Essentially, in order to implement a method for expressing one or more heterologous peptides or proteins or fragments thereof for Mopea virus (MOPV) in eukaryotic host cells, and / or producing recombinant attenuated live Mopea virus (MOPV) while simultaneously expressing one or more heterologous peptides or proteins or fragments thereof for MOPV, and according to one embodiment, starting from a viral RNA extract, a complete transcription of a viral fragment is obtained to provide a polynucleotide sequence comprising the L and S sequences of MOPV, respectively, and then the obtained cDNA is cloned into a plasmid driven by proper transcription under the control of mouse RNA polymerase I—see Examples and references WO2017 / 068190 or WO2023 / 175044 and Mateo M, Reynard S, Carnec X, et al. Vaccines inducing immunity to Lassa virus glycoprotein and nucleoprotein protect macaques after a single shot. Sci Transl Med. 2019;11(512):1-18;Carnec X, Mateo M, Page A, et al. A Vaccine Platform against Arenaviruses Based on a Both *Recombinant Hyperattenuated Mopeia Virus Expressing Heterologous Glycoproteins. J Virol. 2018* and *Reynard S, Carnec X, Picard C, et al. AMOPEVAC multivalent vaccine induces sterile protection against New Worldarenaviruses in non-human primates. Nat Microbiol. 2023* describe such steps.To ensure proper transcription and replication of viral fragments, additional non-template -G bases can be included at the beginning of the clone sequence (Carnec X, Baize S, Reynard S, Diancourt L, Caro V, Tordo N, Bouloy M. Lassavirus nucleoprotein mutants generated by reverse genetics induce a robusttype I interferon response in human dendritic cells and macrophages. J Virol. 2011 Nov;85(22):12093-7).

[0134] In one implementation, the first, second, and, when used, third and fourth polynucleotides are each provided on a plasmid suitable for transfection of the eukaryotic host cell. All plasmids can be sequenced and corrected by site-directed mutagenesis if necessary. The pRF108 plasmid (pPolI) containing the mouse Pol I promoter and terminator (Flick R, Pettersson RF. Reverse genetics system for Uukuniemi virus (Bunyaviridae): RNApolymerase I-catalyzed expression of chimeric viral RNAs. J Virol. 2001 Feb;75(4):1643-55) can be used to express transcripts of the S and L fragments of recombinant MOPV.

[0135] In one particular implementation, the third and fourth polynucleotides were each cloned onto the pTM1 plasmid (Elroy-Stein O, Fuerst TR, Moss B. Cap-independent translation of mRNA conferred by encephalomyocarditis virus 5' sequence improves the performance of the vaccinia virus / bacteriophage T7 hybrid expression system. Proc Natl Acad SciU S A. 1989 Aug;86(16):6126-30), along with Carnec X, Mateo M, Page A, Reynard S, Hortion J, Picard C, Yekwa E, Barrot L, Barron S, Vallve A, Raoul H, Carbonnelle C, Ferron F, Baize S. A Vaccine Platform against Arenaviruses Based on a Recombinant Hyperattenuated Mopeia Virus Expressing Heterologous Glycoproteins. J Virol. 2018 May). Similar to that disclosed in 29;92(12):e02230-17, the reverse genetics of the Mopeya virus is described.

[0136] To enable them to be transcribed and expressed in recombinant eukaryotic cells, the third and fourth polynucleotides contain transcriptional regulatory sequences suitable for achieving the expression of the polypeptides they encode, respectively. In one particular embodiment, the transcriptional regulatory sequences of the third and fourth polynucleotides contain a T7 promoter and a terminator.

[0137] In one particular implementation, eukaryotic cells used to rescue recombinant attenuated live Mopeya virus express T7 RNA polymerase. When used, such third and fourth plasmids may require expression of T7 RNA polymerase to transcribe the NP and Lpol genes encoded by sequences contained in these plasmids.

[0138] Examples of the third and fourth plasmids are provided in the experimental section of this application, as well as protocols for expressing one or more heterologous peptides or proteins or fragments thereof for Mopea virus (MOPV) in eukaryotic host cells, and / or for producing recombinant attenuated live Mopea virus (MOPV) expressing one or more heterologous peptides or proteins or fragments thereof for MOPV. Therefore, annotated versions of exemplary and specific sequences for carrying out the invention are recorded herein.

[0139] In another specific embodiment, eukaryotic cells transformed with the first, second, and optionally third and fourth polynucleotides are also capable of expressing RNA polymerases, such as T7 RNA polymerase. In particular, T7 RNA polymerase of T7 phage is constitutively expressed in eukaryotic cells for rescuing recombinant attenuated live Mopeya virus.

[0140] In some implementations, the eukaryotic cells of interest for rescuing recombinant attenuated live MOPV are BHKT7 / 9 cells (a cell line expressing T7 RNA polymerase). These cells are maintained in culture as described in Carnec X, Baize S, Reynard S, Diancourt L, Caro V, Tordo N, Bouloy M. Lassa virus nucleoprotein mutants generated by reverse genetics induce a robust type I interferon response in human dendritic cells and macrophages. J Virol. 2011 Nov;85(22):12093-7.

[0141] In some implementations, plasmids encoding the first, second, third, and fourth polynucleotides are transfected into host eukaryotic cells in a 1:1:1:1 ratio.

[0142] In one specific embodiment of this method, an amplification step is performed after the virus is generated in the host cells. Vero cells can be used to amplify and recover the viral stock. In particular, Vero cells are grown in Glutamax Durbeco Modified Eagle Medium (DMEM - Life Technologies) supplemented with 5% FCS and 0.5% penicillin-streptomycin.

[0143] Since a first plasmid and a second plasmid containing nucleic acid constructs (the constructs containing polynucleotides encoding at least one polypeptide or protein heterologous to MOPV) will be used in the production method described herein, the present invention also relates to a set of nucleic acid constructs or expression cassettes or vectors containing them, wherein the set includes at least: i. A nucleic acid construct or expression cassette or vector containing it, encoding a recombinant L fragment of Mopeya virus (MOPV), and ii. A nucleic acid construct or expression cassette or vector containing the thereof, which encodes a recombinant S fragment of Mopeya virus (MOPV) that encodes a MOPV nucleoprotein (NP) with attenuated exonuclease activity. One or both nucleic acid constructs, expression cassettes, or vectors contain polynucleotides encoding polypeptides or proteins heterologous to MOPV, and when on the S fragment, the latter differs from non-MOPV GPCs. The location in which a cloning cassette containing a polynucleotide encoding at least one polypeptide or protein heterologous to MOPV is inserted into the nucleic acid construct, expression cassette, or vector, considering the 5' to 3' end of the MOPV DNA fragment, is as follows: o Between the MOPV Z protein ORF and its stop codon on the L segment of MOPV, or o Between the start codon of the MOPV Lpol ORF and the rest of the MOPV Lpol ORF on the L segment of MOPV, or o The start codon of the MOPV nucleoprotein (NP) ORF, which has weakened exonuclease activity on the S fragment of MOPV, is between the start codon and the rest of the MOPV NP ORF.

[0144] According to a specific implementation of the group, the nucleic acid construct or expression cassette or vector containing it is defined with respect to the group as i. and / or ii. as in any of the implementations of the nucleic acid construct or expression cassette or vector described in this application.

[0145] Specifically, the cloning cassette also contains a polynucleotide encoding a 2A self-cleaving peptide, optionally with an additional polynucleotide linker sequence located at the 5' end of the polynucleotide encoding the 2A self-cleaving peptide, particularly when the latter is read in a genomic sense. The “genomic” sense also corresponds to the manner in which the polypeptide or protein derived from the corresponding polynucleotide is transcribed. In fact, for example, when performing C-terminal heterologous ORF cloning in the MOPV L fragment, the cloning cassette is introduced to the C-terminal position of the Z ORF (see [link to ORF]). Figure 1BHowever, in polynucleotide sequences encoding such fragments, the Z ORF is oriented in the reverse genomic direction relative to the Lpol sequence. Nevertheless, adapter sequences are always found near the Z ORF at the 5' end of polynucleotides encoding 2A self-cleaving peptides, especially when the cloning cassette is read in genomic sense.

[0146] Therefore, the relative position of the polynucleotide encoding at least one polypeptide or protein heterologous to MOPV with respect to other parts of the nucleic acid construct, expression cassette, or vector, considering the 5' to 3' end of the MOPV DNA fragment, is as follows: o Between the MOPV Lpol protein and the MOPV Z protein on the L fragment of MOPV, specifically between the 5' end of the MOPV Lpol protein and the 3' end of the MOPV Z protein on the L fragment of MOPV, or o Before the MOPV Lpol protein, that is, at the 5' end of the MOPV Lpol protein on the L segment of MOPV, or o Before the MOPV nucleoprotein (NP) with weakened exonuclease activity, i.e. at the 5' end of the MOPV NP with weakened exonuclease activity on the S segment of MOPV.

[0147] In a particular embodiment, the polynucleotide encoding at least one polypeptide or protein heterologous to MOPV is contained in a nucleic acid construct comprising the polynucleotides a) to e) (numbered as appropriate based on disclosures found elsewhere in this text), and further comprises additional non-coding sequences as defined in any embodiment disclosed herein, particularly their relative positions to each other.

[0148] According to a particular implementation, the group includes a vector as a plasmid, and further includes a third and / or fourth plasmid as disclosed in any of the implementations described herein.

[0149] Therefore, the present invention also relates to a set of nucleic acid constructs or expression cassettes or vectors (including plasmids) comprising them as defined in any embodiment of the nucleic acid constructs or expression cassettes or vectors described herein, for the purpose of expressing one or more proteins or fragments thereof heterologous to Mopea virus (MOPV) in vitro or in vitro in eukaryotic host cells, and / or for the production of recombinant attenuated live Mopea virus (MOPV) in vitro or in vitro in eukaryotic host cells, particularly by means of any embodiment disclosed herein.

[0150] Therefore, the present invention also relates to a set of nucleic acid constructs or expression cassettes or vectors (including plasmids) comprising them as defined in any of the embodiments disclosed herein, for use in expressing one or more proteins or fragments thereof that are heterologous to Mopea virus (MOPV) in eukaryotic host cells, and / or in methods for producing recombinant attenuated live Mopea virus (MOPV) in eukaryotic host cells in vitro or ex vivo, according to any of the embodiments disclosed herein.

[0151] It should be understood that such methods or uses for expressing one or more proteins or fragments thereof that are heterologous to Mopea virus (MOPV), and / or for producing recombinant attenuated live Mopea virus (MOPV) in eukaryotic host cells in vitro or in vitro, are intended to be performed in vitro or in vitro and do not cover any methods of treating humans or animals by surgical or therapeutic procedures.

[0152] Therefore, the methods or uses of the present invention for expressing one or more proteins or fragments thereof that are heterologous to Mopea virus (MOPV), and / or for producing recombinant attenuated live Mopea virus (MOPV) in vitro or in vitro, carried out in eukaryotic host cells, can be said to be carried out in cultures of such eukaryotic host cells, i.e. not in human or animal bodies, and they do not cover any surgical steps, as can be seen from the experimental section.

[0153] Returning to methods for expressing one or more polypeptides or proteins or fragments thereof that are heterologous to Mopea virus (MOPV) in eukaryotic host cells, and / or producing recombinant attenuated live Mopea virus (MOPV) that simultaneously express one or more polypeptides or proteins or fragments thereof that are heterologous to MOPV, the host cells used in the methods, according to a particular embodiment, are cells that stably express an NP wild-type version of MOPV or Lassa virus, particularly VeroE6 cells that stably express an NP wild-type version of MOPV or Lassa virus (e.g., VeroNP cells, including the preservation cell lines described herein).

[0154] The experimental section describes the principles of using a specially engineered “helper” VeroE6 cell line as an optimization technique to enhance virus production.

[0155] The engineered VeroE6-derived cell line has been deposited under the name VERO-NP (identification reference) with accession number CNCMI-6034 at CNCM (National Center for the Collection of Microbial Cultures) on February 2, 2024. Throughout this application, CNCM stands for the National Center for the Collection of Microbial Cultures (Pasteur Institute, 25 Rue du Dr. Rue, F-75724, 15th arrondissement, Paris, France). The address of CNCM is: National Center for the Collection of Microbial Cultures, Pasteur Institute, 28 Rue du Dr. Rue, 75724, 15th arrondissement, Paris, France.

[0156] The VERO-NP cell line is a genetically modified cell line. VERO cells are derived from long-tailed monkeys (…). Cercopithecus aethiops Renal epithelial cells. Vero cells were transduced with VSV-G pseudolentivirus (pLV-NP-ires-Hygro) as disclosed in the examples to stably express bicistronic mRNA encoding the NP (nucleoprotein) of Mopeia virus and the hygromycin resistance gene. In this specification, VERO-NP is also written as "VeroNP".

[0157] According to another aspect, the present invention also relates to the VERO-NP cell line with accession number CNCM I-6034, deposited at CNCM (National Center for Microbial Culture Collection) on February 2, 2024, or a variant cell line derived from the VERO-NP cell line with accession number CNCM I-6034, deposited at CNCM (National Center for Microbial Culture Collection) on February 2, 2024, which retains the characteristics of the parent cell line, particularly the expression of the NP (nucleoprotein) of Mopeia virus, i.e., wild-type Mopeia virus. According to a specific embodiment, such variant cell lines have a genome whose nucleic acid sequence shares no more than 5% identity with the genomic nucleic acid sequence of the VERO-NP cell line.

[0158] The invention also relates to cells belonging to the I-6034 cell line, or variants thereof as defined herein.

[0159] Nevertheless, it is understood that those skilled in the art can readily use another host cell with this capability to implement the production method of the present invention using cell lines that stably express NP wild-type versions of MOPV or Lassa virus. Cell lines can be prepared by retroviral integration into the cell genome or by different preparation methods, such as CRISPR / CAS9 knock-in integration. Kits for this purpose are readily available.

[0160] The ability of cell lines to stably express the wild-type NP version of MOPV or Lassa virus can be readily assessed by those skilled in the art using assays well-known in the art. For example, the expression of genes integrated into cell lines can be verified by various methods, one of which is to detect the presence of the desired NP protein by immunofluorescence after the cells have produced it. The literature, and even this application, provides the necessary guidance in this regard.

[0161] This document also discloses methods for expressing one or more polypeptides or proteins or fragments thereof that are heterologous to Mopea virus (MOPV) in eukaryotic host cells, and / or for producing recombinant live attenuated Mopea virus (MOPV) while simultaneously expressing one or more polypeptides or proteins or fragments thereof that are heterologous to MOPV, using the VERO-NP cell line with accession number CNCM I-6034 deposited at CNCM (National Center for Microbial Culture Collection) on February 2, 2024, or variant cell lines as defined herein, as defined in any embodiments described throughout this specification.

[0162] The sequence of the S fragment of Lassa virus (Josiah strain) is readily available in GenBank database J04324.1 (proteins). The sequence of the Lassa virus nucleoprotein is available in GenBank database AAA46285.1 (proteins) (Auperin DD, McCormick JB. Nucleotide sequence of the Lassa virus (Josiah strain) S genome RNA and amino acid sequence comparison of the N and GPC proteins to other arenaviruses. Virology. 1989 Feb;168(2):421-5). If necessary, the corresponding nucleotide sequences can be readily deduced considering the degeneracy of nucleotide codons.

[0163] The present invention also relates to recombinant attenuated live mopeia virus (MOPV), particularly to one or more polypeptides or proteins or fragments thereof that are heterologous to mopeia virus (MOPV) embedded (e.g., internally) or displayed (e.g., on their surface), which may be obtained from or by the methods described in the preceding paragraphs. The present invention also relates to cells comprising such recombinant attenuated live mopeia virus (MOPV).

[0164] The present invention also relates to compositions comprising viral particles obtained from the methods of the present invention, particularly immunogenic or vaccine compositions. Such compositions may comprise any of: pharmaceutically acceptable carriers, delivery carriers, excipients, preservatives, or any combination thereof.

[0165] As defined herein, “pharmaceutically acceptable carrier, delivery carrier, excipient” or “preservative” encompasses any substance capable of formulating a pharmaceutical composition, particularly an immunogenic or vaccine composition, suitable for administration to a human host and / or, respectively, suitable for appropriate treatment to deliver such compositions to an administration center. In a particular embodiment, the composition is described as having immunogenicity against at least one polypeptide or protein heterologous to MOPV, the polynucleotide sequence of which has been inserted into a plasmid comprising it in a method according to any embodiment described herein.

[0166] According to specific embodiments, the compositions of the present invention are monovalent or multivalent vaccine compositions, particularly bivalent vaccine compositions. Obtaining such compositions is facilitated by the novel platform of the present invention described herein due to the specific design of the platform. Reference is made to the experimental section in this regard. For example, descriptions of the design of monovalent or bivalent vaccines are provided (MOPEVAC NEXTCCHF 1 is a monovalent vaccine expressing Nmut and fusion GnGc, MOPEVAC NEXT CCHF 2 is a bivalent vaccine expressing Nmut and Gc from a first virus and GP38 and Gn from a second virus, and MOPEVAC NEXT CCHF 3 is a bivalent vaccine expressing Nmut and Gn from a first virus and Gc from a second virus).

[0167] A carrier or delivery carrier is any physiologically acceptable substance or combination of substances, i.e., suitable for use in a composition intended for human application, and therefore non-toxic. Examples of such carriers include phosphate-buffered saline solutions, distilled water, emulsions such as oil / water emulsions, various types of wetting agents, sterile solutions, etc. Examples of carriers, delivery carriers, excipients, or preservatives are generally available to those skilled in the art.

[0168] The present invention also relates to viral particles, obtained from methods or compositions according to any embodiment disclosed herein, for use in: a) Used to induce an immune response in a subject, particularly a protective immune response in a subject, especially against at least one polypeptide or protein heterologous to MOPV, the polynucleotide sequence of which has been inserted into a plasmid containing it (in any embodiment of the method described herein) and / or b) As a medicine, particularly as a vaccine, especially for a condition caused or associated with by or related to at least one of the said polypeptides or proteins or by an organism, particularly a pathogenic organism (especially a sand virus), said organism providing such a heterologous polypeptide or protein for MOPV, the polynucleotide sequence of which has been inserted into a plasmid containing it (in any embodiment of the method described herein).

[0169] Therefore, the present invention also relates to methods for inducing an immune response in a subject, particularly for at least one polypeptide or protein heterologous to MOPV, the polynucleotide sequence of which has been inserted into a plasmid containing it (in any embodiment of the method described herein) (e.g., a prophylactic or therapeutic immunogenic response), particularly for pathogens, especially arenaviruses in the subject, particularly Old World or New World arenaviruses, comprising administering to the subject an active ingredient, a viral particle or immunogenic composition as defined in any embodiment herein, including combinations of features from different embodiments. Optionally, the active ingredient or multivalent immunogenic composition, particularly when formulated for use as a vaccine or therapeutic agent, may be administered in combination with an adjuvant or immunostimulatory component, wherein the adjuvant or immunostimulatory component is administered before, simultaneously with or after the administration of the active ingredient or multivalent immunogenic composition. Optionally, based on the same description as provided throughout this specification, any of the following may be present: a pharmaceutically acceptable carrier, delivery carrier, excipient, preservative, or any combination thereof.

[0170] It should be noted that this instruction manual uses the term " For The term "therapeutic application" is used to define therapeutic applications, specifically those selected from: immunogenic, prophylactic, vaccine, and therapeutic (i.e., treatment of hosts infected by pathogens, particularly arenaviruses, especially mammalian hosts, and especially human hosts). Throughout the specification, the expression "therapeutic application" is used. …method The wording “” can be used interchangeably without altering the intended meaning.

[0171] In this case, Protective immune response "Protective immune response" refers to an active ingredient, i.e., viral particles or compositions, particularly immunogenic compositions, that provides a host or subject with complete or partial protection against attack (or infection) by a pathogen (especially isoviruses) against which the subject is subsequently protected by a needle. A protective immune response reduces the risk of a subject contracting a pathogen (especially isoviruses) and / or mitigates the severity of infection with the target pathogen, especially isoviruses (including the spread of infection within the individual or the onset of disease due to infection, as disclosed herein). Therefore, protective immune responses encompass varying degrees of protective response.

[0172] “ drug "This refers to the administration of medication that leads to an improvement in the clinical symptoms of the test subject."

[0173] According to a specific implementation plan, the subject has been infected with a targeted pathogen (in relation to, especially, isavirus), and / or suffers from symptoms or illness caused by the infection with that pathogen (especially isavirus infection) (or may be asymptomatic). Such treatment aims to improve the clinical status of the infected subject, particularly human subjects, by reducing the viral load caused by the infection and / or eliminating or reducing or alleviating the symptoms suffered by the subject and / or, in a specific implementation plan, restoring health.

[0174] According to a specific implementation plan, treat "or" Therapeutic treatment "" refers to eliminating, preventing, or reducing mortality associated with the targeted pathogen, particularly targeted arenavirus infection, to the extent that it increases the chances of survival in infected individuals. According to a specific embodiment, treatment according to the invention reduces the mortality rate of treated subjects by 40%, 50%, 60%, or 70%.

[0175] According to a specific implementation plan, treat "or" Therapeutic treatment It also refers to protecting the subject from the more serious consequences of the disease on their health compared to the consequences of not treating it. This includes eliminating, reducing, or alleviating symptoms associated with the disease.

[0176] Conventional routes of administration, dosages, and administration regimens can be used.

[0177] The present invention also relates to the use of an active ingredient (such as viral particles or immunogenic compositions) as defined herein, in any one or possible combination of embodiments described herein, for the preparation (or manufacture) of a medicament having immunogenic, prophylactic, or vaccine effects.

[0178] Other examples and features of the invention will become apparent upon reading the examples and accompanying drawings, which illustrate experiments conducted by the inventors and supplement the features and definitions given in this specification. Attached Figure Description

[0179] Figure 1 shows the cloning strategy used to introduce heterologous ORFs into the MOPEVAC genome. A) MOPEVAC S ( Figure 1A.1 ) and L ( Figure 1A.2A) Fragment modification. A cloning cassette is introduced at the N-terminus of the MOPEVAC NP and Lpol ORFs. B) MOPEVAC L fragment modification for C-terminal heterologous ORF cloning. A cloning cassette is introduced at the C-terminus of the MOPEVAC Z ORF. The PCR-amplified heterologous ORF gene is cloned within NP, Lpol, or Z frames separated from each other by the adapter-P2A sequence. The resulting mRNA is translated, but due to ribosome jumping, the proximal polypeptide is cleaved from the distal polypeptide at the 2A sequence level. The N-terminal ORF carries 21 residues corresponding to the adapter-P2A sequence at the C-terminus, while the C-terminal ORF carries P residues (from the 2A sequence) at the N-terminus. C) MOPEVAC NEXT lesion-forming unit carrying the mCherry ORF. Figure 1A.1 Modification of the Mopeya S fragment for N-terminal heterogeneous ORF cloning. Figure 1A.2 Modification of the Mopeya L fragment for N-terminal heterogeneous ORF cloning. Figure 1B Modification of the Mopea L fragment for C-terminal heterologous ORF cloning. C) Foci-forming units of recombinant MOPEVACN EXT virus carrying the mCherry reporter gene, such as Figure 1A.1 (Left), Figure 1A.2 (Medium) and Figure 1B As shown on the right.

[0180] Figure 2. Production of MOPEVAC NEXT-derived virus using VeroNP. A) Immunofluorescence staining of VeroNP cells against MOPV WT NP (green) expression. Cell nuclei counterstained with dapi (blue). Scale bar 100µm. B) Comparison of production and titration of MOPEVAC (S) mCherry and (L) MOPEVAC mCherry viruses on VeroE6 and VeroNP cells. Cells were infected with MOI 0.01 and incubated for 4 days, and the corresponding cell culture supernatants were titrated. Titration is expressed as lesion-forming units / mL (FFU / mL).

[0181] Figure 3 Western blot analysis of protein extracts from VeroNP cells infected with (S) NMT1 or (L) Nectine4 virus. HA-NMT1, Nectine4-flag, and β-actine were detected using anti-HA, anti-Flag, and anti-β-actine antibodies, respectively, all of which were HRP-conjugated monoclonal antibodies. Molecular weights are indicated in kDa.

[0182] Figure 4. Rescue of recombinant MOPEVAC NEXT virus carrying ORFs containing YFP (S) and mCherry (L). A) Lesion-forming units of MOPEVAC (S)YFP+(L)mcherry in VeroNP cells. B) Expression of fluorescent proteins YFP and mCherry in VeroNP cells infected with recombinant MOPEVAC (S)YFP+(L)mcherry virus. Cells were infected at a multiplicity of infection (MII) of 0.1 and incubated for 48 hours, then fixed. Cells were counterstained with DAPI. Scale bar: 20 µm.

[0183] Figure 5 Restriction map of MOPEVAC NEXT (Z) plasmid Figure 6 Restriction map of MOPEVAC NEXT (Lpol) plasmid Figure 7 Restriction map of MOPEVAC NEXT (NP) plasmid Figure 8 Restriction map of pTM1 L polymerase Mopeia plasmid Figure 9 Restriction map of pTM1 NP WT Mopeia plasmid Figure 10 Restriction map of pLV-NP MOPV-IRES-Hygro plasmid for stable expression of WT NP in VeroE6 cells. Figure 11 Restriction map of plasmid MOPEVAC NEXT (NP) HA-NMT1 Figure 12 Restriction map of plasmid MOPEVAC NEXT (NP) YFP Figure 13 Restriction map of plasmid MOPEVAC NEXT (Z) NECTIN4-Flag with codon-optimized sequence from MN030916 Figure 14 Restriction map of plasmid MOPEVAC NEXT (Z) mCherry-HA Figure 15 Restriction map of plasmid MOPEVAC NEXT (NP) GPC Guanarito, INH-95551 strain Figure 16 Restriction map of plasmid MOPEVACN EXT (NP) GPC Machupo, Carvallo strain Figure 17 Restriction map of plasmid MOPEVAC NEXT (NP) GPC chaparel Figure 18 Restriction map of plasmid MOPEVAC NEXT (NP) GPC Sabia Figure 19 Restriction map of plasmid MOPEVAC NEXT (NP) GPC Hu Ning, P3790 Espindola strain Figure 20 Restriction map of plasmid MOPEVAC NEXT (NP) GPC Lassa, Josiah strain Figure 21 Restriction map of plasmid MOPEVAC NEXT (NP) GPC Lucho Figure 22 Restriction map of plasmid MOPEVAC NEXT (NP) GPC, strain 9310141, from Arroyo, Baishui. Figure 23. Description of the MOPEVAC NEXT CCHF vaccine. A) The CCHFV sequence was cloned into MOPEVAC NEXT (S) and (L). Using the respective cloning strategies described in this application, the Nmut ORF or GP38 sequence was cloned into MOPEVAC NEXT (S), and the Gn, Gc, or GnGc sequence was cloned into MOPEVAC NEXT (L). B) After rescue in BHKT7 cells, the five recombinant viruses were separated to generate three vaccines: MOPEVAC NEXT CCHF1, a monovalent vaccine expressing Nmut and fused GnGc; MOPEVAC NEXT CCHF2, a bivalent vaccine expressing Nmut and Gc from the first virus and GP38 and Gn from the second virus; and MOPEVAC NEXT CCHF3, a bivalent vaccine expressing Nmut and Gn from the first virus and Gc from the second virus.

[0184] Figure 24 The MOPEVAC NEXT CCHF vaccine protected IFNARko mice from lethal CCHFV attack. A) Study Design. Forty-eight mice were divided into four groups of twelve each. The first three groups received two doses of MOPEVAC NEXT CCHF1, 2, or 3 vaccine (primary immunization + booster immunization) one month apart, and were challenged with CCHFV forty days later. The fourth group received a sham vaccine (control group). Four days post-infection, half of the mice in each group were sacrificed to study T-cell and antibody responses and assess viral spread. Survival rates of the remaining animals in each group were assessed until day twenty-eight. B) Survival Outcomes as represented by Kaplan-Meier curves.

[0185] Figure 25Quantitative analysis of viral titers in plasma and organs of mice euthanized on day 4 post-infection. A) Viral infectivity titer in plasma, expressed as FFU / mL. B) Viral infectivity titers in liver, spleen, lung, brain, testis, and female reproductive tract. Results for the female reproductive tract were not available because all control groups were male. Results are expressed as FFU / mg organ.

[0186] Figure 26 Antibody response to CCHFV-derived antigens was assessed post-vaccination (AB) and during challenge (CF). The presence of antibodies against NP or Gc in serially diluted plasma collected after primary and booster immunizations was measured by indirect ELISA as NP(A) and Gc(B), NP(C) and Gc(D) at four days post-infection, and NP(E) and Gc(F) at twenty-eight days post-infection.

[0187] Figure 27. Assessment of activation of specific CD3+CD4+ and CD3+CD8+ lymphocyte populations against CCHFV-derived NP or Gc antigens. Spleen cells from animals sacrificed four days post-infection were isolated and incubated with overlapping peptides encompassing complete NP (A and C) or Gc (B and D) sequences. Activation of CD3+CD8+ (AB) and CD3+CD4+ (CD) lymphocytes was measured by intracellular detection of IFNγ, TNFα, CD137, or CD154. P<0.05 and P<0.01.

[0188] Figure 28 Restriction enzyme map of the plasmid used to generate the MOPEVAC NEXT CCHF (S) Nmut vaccine.

[0189] Figure 29 Restriction enzyme map of the plasmid used to generate the MOPEVAC NEXT CCHF (S) GP38 vaccine.

[0190] Figure 30 Restriction enzyme map of the plasmid used to generate the MOPEVAC NEXT CCHF (L) Gn vaccine.

[0191] Figure 31 Restriction enzyme map of the plasmid used to generate the MOPEVAC NEXT CCHF (L) Gc vaccine.

[0192] Figure 32 Restriction enzyme map of the plasmid used to generate the MOPEVAC NEXT CCHF (L) GnGc vaccine.

[0193] Figure 33Restriction enzyme map of plasmid used to generate MOPEVAC NEXT CCHF3, virus 2, S fragment. Detailed Implementation

[0194] Materials and Methods plasmid constructs The four plasmid strategies required to rescue Mopevac Lassa, Mopevac New, and Mopevac Virus have been described elsewhere (Carnec et al 2011, in “Lassa Virus Nucleoprotein Mutants Generated by Reverse Genetics Induce a Robust Type I Interferon Response in Human Dendritic Cells and Macrophages”, Journal of Virology, Volume 85 • Number 22 • 15 November 2011, Pages: 12093 – 12097, PubMed: 21880754, https: / / doi.org / 10.1128 / jvi.00429-11 ; Carnec X, Mateo M, Page A, Reynard S, Hortion J, Picard C, Yekwa E, Barrot L, Barron S, Vallve A, Raoul H, Carbonnelle C, Ferron F, Baize S. A Vaccine Platform against Arenaviruses Based on aRecombinant Hyperattenuated Mopeia Virus Expressing Heterologous Glycoproteins. J Virol. 2018 May 29;92(12):e02230-17). The pTM1 plasmid expresses Lpol and NP proteins driven by the T7 promoter. MOPV Lpol (pTM1-Lpol) and NP (pTM1-NP) ORFs were cloned between the NcoI and XhoI sites of the plasmid, respectively. To obtain complete transcription of the two viral fragments, the L and S sequences of MOPV were reverse transcribed from the viral RNA extract in the reverse genomic direction, and the cDNA was finally cloned into the pRF108 plasmid driven by mouse RNA polymerase I. An additional non-template G base was included at the start of the cloned sequence for transcription and replication of the viral fragments. The 3'-5' exonuclease activity of MOPV NP is eliminated by site-directed mutagenesis, which modifies six codons at its active sites (i.e., D390, E392, G393, H430, D467, and D534) to alanine.As described herein, the residue numbers are given with reference to GenBank entry AEO89356.1 (also reproduced herein as SEQ ID NO: 3). Those skilled in the art can easily locate the corresponding residues or nucleotides in different sequences by comparison with this entry.

[0195] The introduction of the cloning box and adapter-P2A sequence was accomplished through a three-step site-directed mutagenesis strategy.

[0196] - First, the cloning box (20bp) itself is introduced between the first and second codons of the NP or Lpol ORF, and between the last codon and the stop codon of the Z ORF.

[0197] - Second, use the positive clone plasmid as an intermediate plasmid to introduce the P2A sequence (57 bp). Introduce the P2A sequence between the last nucleotide of the cassette and the first nucleotide of the second codon of the NP or Lpol ORF, or between the last nucleotide of the last codon of the Z ORF and the first nucleotide of the cassette.

[0198] - Third, for pPOL-S-NP-N-KP2A and pPOL-S-Lpol-N-KP2A plasmids, the GSG adapter (9 bp) is introduced between the last nucleotide of the cassette and the first nucleotide of the P2A sequence; for pPOL-LZC-KP2A plasmid, it is introduced between the last nucleotide of the last codon of the Z ORF and the first nucleotide of the P2A sequence.

[0199] Site-directed mutagenesis was performed according to the manufacturer's instructions (Agilent). All plasmid constructs were sequenced to confirm the presence of correct insertions / mutations.

[0200] Heterogeneous ORF cloned into MOPEVAC NEXT plasmid Cloning of the reporter gene YFP and the human ORF encoding NMT1 with an N-terminal HA tag was performed in the pPOL-S-NP-N-KP2A plasmid. Cloning of the reporter gene mCherry (with a C-terminal HA tag) and the human ORF encoding NECTIN4 with a C-terminal Flag tag was performed in the pPOL-LZC-KP2A plasmid. In short, all ORFs were amplified by PCR (KOD, Sigma Aldrich) using primers with BsmBI restriction sites before the start codon and after the stop codon. The PCR products were then purified by BsmBI (NEB) digestion and cloned into their respective BsmBI-digested plasmids. Positive clones containing ORFs were sequenced, amplified, and purified to obtain transfection-grade preparations, which were then used to rescue recombinant viruses.

[0201] Rescue experiments and preparation of virus reservoir 1.2×10 6 One BHK-T7 / 9 cell was seeded at a 25cm depth. 2 In culture flasks. The following day, cells were transfected with four polynucleotides using Fugene HD reagent (Promega, France): NP, Lpol from pTM1 plasmid, and plasmids responsible for transcribing the S and L fragments derived from MOPV. Transfection was performed at 37°C for 6 hours. Cells were then washed and incubated in DMEM 2% SVF for 7 days. The supernatant from BHK-T7 / 9 cells constituted the seed stock. The virus in the seed stock was subsequently amplified on VeroNP cells for 6 to 7 days. The first passage of the seed stock on VeroNP cells constituted the “generation 1” viral stock. After titration, the “generation 1” virus was used to infect VeroNP cells with a multiplicity of infection (MOI) of 0.0001. Infection was performed for 6 to 7 days, and then the supernatant was collected. This second passage, titrated on VeroNP cells, provided the viral stock for all experiments. All viral stocks were confirmed to be free of mycoplasma contamination using a mycoplasma detection kit (Lonza, Switzerland). Viral RNA was extracted from the reservoir using QiAmp (QIAGEN) and amplified by one-step RT-PCR (Titan, Roche Applied Biosciences). The PCR products were sequenced using Sanger sequencing.

[0202] Viral titration The virus-containing supernatant was collected and clarified by centrifugation at 1500 rpm for 10 minutes. A 10-fold serial dilution of the virus supernatant was added to subconfluent VeroNP cells. After incubation for one hour, the cells were covered with a 1:1 mixture of 5% SVF-DMEM and 2% carboxymethyl cellulose (CMC) and incubated for 10 days. Cells were then fixed with paraformaldehyde (PFA, Sigma Aldrich) and permeabilized with a Triton X100 (Sigma Aldrich). The presence of the virus was visualized by immunostaining with a rabbit polyclonal antibody against the Z protein, a goat anti-rabbit polyclonal antibody conjugated to alkaline phosphatase (Sigma Aldrich), and NBT / BCIP substrate. Results are expressed as FFU / ml (lesion-forming units / ml).

[0203] Immunofluorescence assay To detect WT NP protein expression in VeroNP cells, cells were seeded on ibidi coverslips (Clinisciences), fixed with 4% paraformaldehyde solution, permeabilized with Triton X100, and stained with mouse monoclonal antibody against MOPV NP and A488-conjugated goat anti-mouse polyclonal antibody, followed by counterstaining with DAPI (Sigma Aldrich). Fluorescence images of stained cells and cells infected with recombinant viruses expressing reporter genes (YFP and mCherry) were captured using a Leica DMIL microscope equipped with LASX software.

[0204] SDS-PAGE separation and Western blot analysis VeroNP cells were infected with the specified recombinant virus, followed by lysis with 1X Laemmli buffer, and the sample was boiled at 95°C for 15 min. Whole-cell extracts were then loaded onto pre-prepared gels in a 4–15% gradient and transferred to PVDF membranes. The membranes were immunoblotted with HRP-conjugated mouse anti-HA tag, mouse anti-Flag (Sigma Aldrich 1 / 3000), or mouse anti-human β-actin (Sigma Aldrich 1 / 12000) antibody. The substrate for HRP was Westdura SuperSignal (Pierce, Thermo-Fisher). Chemiluminescence was monitored on a LAS400 (General Electric) and images were analyzed using ImageJ.

[0205] plasmids used A. MOPEVAC NEXT (Z) – SEQ ID NO: 1 – Figure 5 L segment 5' non-coding sequence: 1-57 L polymerase ORF: 58-6771 Intergenic region: 6772-6881 Z-P2A_Interpolation of stop codons for ORF: 6882-6884 Cloning box: 6885-6904 P2A sequence: 6905-6961 Connector: 6962-6970 Z protein ORF (no stop codon) 6971-7279 L segment 3' non-coding sequence: 7280-7358 pRF108 plasmid: 7359-10354 B. MOPEVAC NEXT (Lpol) – SEQ ID NO: 2 – Figure 6 L segment 5' non-coding sequence: 1-57 The start codons for ORF-P2A-Lpol are: 58-60 Cloning box: 61-80 Connector: 81-89 P2A sequence: 90-146 L polymerase ORF: 147-6857 Intergenic region: 6858-6967 Z protein ORF 6968-7279 L segment 3' non-coding sequence: 7280-7358 pRF108 plasmid: 7359-10354 C. MOPEVAC NEXT (NP) – SEQ ID NO: 3 – Figure 7 S-fragment 5' non-coding sequence: 1-69 The start codons for ORF-P2A-NP: 70-72 Cloning box: 73-92 Connector: 93-101 P2A sequence: 102-158 ExoN ko NP ORF: 159-1868 Intergenic region: 1869-1991 Mopeya GPC ORF: 1992-3461 S-fragment 3' non-coding sequence: 3462-3514 pRF108 plasmid: 3515-6510 For ExoN ko NP ORF, the six mutated residues responsible for eliminating exonuclease activity, are listed in SEQ ID NO:41 above. underline Mark it.

[0206] GCC ATA GCA GCGAGACCTGAAGACCCCGTGGAGATAGCTATCTATCAACCTAATAATGGTCAGTATATTCATTTTTACAGGGAACCAACAGACATTAAACAATTCAAACAAGACTCCAAA GCC TCTCATGGCATTGACATCCAAGACCTATTCTCAGTTCAGCCGGGGTTGACAAGTGCTGTAATTGAGAGCCTGCCAAAGAACATGGTCTTGTCGTGTCAAGGTGCTGAT GCC ATCAGAAAGCTTCTTGACTCCCAGAACAGGAGGGACATAAAACTGATTGATGTGTCCATGCAGAAAGACGATGCAAGAAAATTTGAGGATAAGATCTGGGATGAATACAAACACCTTTGTAGAATGCATACGGGGATTGTAACGCAAAAGAAGAAGAGAGGTGGCAAAGAAGAGGTGACACCA CAC TGTGCATTGCTG GCT TGTCTCATGTTTGAAGCAGCAGTCATAGGGAGTCCACAAATTCCAACCCCCAGACCAGTCTTGAGTAGAGACCTGGTGTTTAGAACAGGTCCTCCCAGAGTTGTCCTGTAA D. pTM1 L polymerase Mopeya – SEQ ID NO: 4 – Figure 8 pTM1 plasmid: 1-793 T7 promoter: 794-813 IRES EMCV: 824-1422 L polymerase ORF: 1423-8085 T7 terminator: 8189-8236 pTM1 plasmid: 8237-11576 E. pTM1 NP WT Mopeya – SEQ ID NO: 5 – Figure 9 pTM1 plasmid: 1-793 T7 promoter: 794-813 IRES EMCV: 824-1422 NP WT ORF: 1423-3135 T7 terminator: 3239-3286 pTM1 plasmid: 3287-6626 F. pLV-NP MOPV-IRES-Hygro (used for stable expression of WT NP protein in VeroE6 cells) – SEQ ID NO: 6 – Figure 10 Insertion into VeroE6 cells for constitutive expression of the genetic material of Mopeya WT NP ORF 5' LTR: 1-634 HIV1 capsidation sequence: 680-806 RRE: 1503-1536 cPPT / CTS: 2027-2143 EF-1a core bootloader: 2209-3380 NP WT ORF: 3378-5099 IRES: 5106-5764 Hygromycin resistance gene: 5765-7405 WPRE: 6814-7405 3' LTR: 7609-8242 This substance is derived from the pLV-NP MOPV-IRES-Hygro plasmid – see Figure 10 G. ORF sequences were cloned into MOPEVAC NEXT (NP) and MOPEVAC NEXT (Z). MOPEVAC NEXT (NP) HA-NMT1 NMT1 is an enzyme that catalyzes the incorporation of myristic acid into the N-terminus of a glycine G2 polypeptide after methionine aminopeptidase removes methionine M1 or after the release of the N-terminal G residue following protein cleavage. It is a 1491 bp ORF with 496 residues. The inventors cloned the NMT1 ORF with an N-terminal HA tag into MOPEVAC NEXT (NP).

[0207] HA tag sequence: TACCCATACGATGTTCCAGATTACGCT (SEQ ID NO: 7) Human N-myristyltransferase 1 (NMT1) sequence, GenBank: BC006538.2 (SEQ ID NO: 8) MOPEVAC NEXT (NP) YFP Yellow fluorescent protein is a derivative of the green fluorescent protein reporter gene. It is a 720 bp ORF with 239 residues. The inventors cloned the YFP ORF into MOPEVAC NEXT (NP).

[0208] YFP sequence, Genbank: OQ253287.1 (SEQ ID NO: 9) MOPEVAC NEXT (Z) NECTIN4-Flag NECTIN4 belongs to the immunoglobulin superfamily and participates in cell adhesion through trans-isotropic and heterotropic interactions. It is a single-pass transmembrane type I membrane protein. NECTIN4 acts as a receptor for measles virus. It is a 1554 bp ORF with 518 residues. The sequence used in this paper was codon-optimized for better expression and is derived from the MN030916 sequence. The inventors cloned the NECTIN4 ORF with a C-terminal Flag tag into MOPEVAC NEXT (Z).

[0209] Flag tag sequence: GATTACAAAAGACGATGACGACAAG (SEQ ID NO: 10) Human NECTIN4 sequence, Genbank: codon optimized by MN030916 (SEQ ID NO: 11) MOPEVAC NEXT (Z) mCherry-HA mCherry is a fluorescent protein reporter gene. It is 711 bp long and contains 236 residues. The inventors cloned the mCherry ORF with a C-terminal HA tag into MOPEVAC NEXT (Z).

[0210] HA tag sequence: TACCCATACGATGTTCCAGATTACGCT (SEQ ID NO: 7) mCherry sequence, GenBank: MN781138.1 (SEQ ID NO: 12) H. The plasmids used when the above ORF has been cloned into MOPEVAC NEXT (NP) and MOPEVAC NEXT (Z). Plasmid MOPEVAC NEXT (NP)HA-NMT1–SEQ ID NO: 13– Figure 11 MOPEVAC NEXT (NP)HA-NMT1 sequence S-fragment 5' non-coding sequence: 1-69 The start codons for ORF-P2A-NP: 70-72 HA-NMT1 BC006538.2: 73-1584 Connector: 1585-1593 P2A sequence: 1594-1650 ExoN ko NP ORF: 1651-3360 Intergenic region: 3361-3483 Mopeya GPC ORF: 3484-4953 S-fragment 3' non-coding sequence: 4954-5006 pRF108 plasmid: 5007-8002 For ExoN ko NP ORF, the six mutated residues responsible for eliminating exonuclease activity, are listed in SEQ ID NO:41 above. underline Mark it.

[0211] Plasmid MOPEVAC NEXT (NP) YFP–SEQ ID NO: 14– Figure 12 MOPEVAC NEXT (NP) YFP sequence S-fragment 5' non-coding sequence: 1-69 The start codons for ORF-P2A-NP: 70-72 YFP ORF (OQ253287.1): 73-786 Connector: 787-795 P2A sequence: 796-852 ExoN ko NP ORF: 853-2562 Intergenic region: 2563-2685 Mopeya GPC ORF: 2686-4155 S-fragment 3' non-coding sequence: 4156-4208 pRF108 plasmid: 4209-7204 For ExoN ko NP ORF, the six mutated residues responsible for eliminating exonuclease activity, are listed in SEQ ID NO:41 above. underline Mark it.

[0212] plasmid MOPEVAC NEXT (Z) NECTIN4-Flag, sequence codon-optimized from MN030916 – SEQ ID NO: 15– Figure 13

[01] MOPEVAC NEXT (Z) NECTIN4-Flag sequence, codon optimized by MN030916 L segment 5' non-coding sequence: 1-57 L polymerase ORF: 58-6771 Intergenic spacer region: 6772-6881 Z-P2A_Interpolation of stop codons for ORF: 6882-6884 NECTIN4-Flag ORF: 6885-8459 P2A sequence: 8460-8516 Connector: 8517-8525 Z protein ORF (no stop codon) 8526-8834 L segment 3' non-coding sequence: 8835-8913 pRF108 plasmid: 8914-11909 Plasmid MOPEVAC NEXT (Z) mCherry-HA–SEQ ID NO: 16– Figure 14 MOPEVAC NEXT (Z) mCherry-HA sequence L segment 5' non-coding sequence: 1-57 L polymerase ORF: 58-6771 Intergenic region: 6772-6881 Z-P2A_Interpolation of stop codons for ORF: 6882-6884 mCherry-HA ORF: 6885-7616 P2A sequence: 7617-7673 Connector: 7674-7682 Z protein ORF (no stop codon) 7683-7991 L-fragment 3' non-coding sequence: 7992-8070 pRF108 plasmid: 8071-11066 I. Exchange the GPC ORF of Mopeya with the GPC ORFs of different mammalian arenaviruses. The following plasmid constructs provide examples of exchanging the GPC ORF of Mopeya with the GPC ORF of the following mammalian arenaviruses: Guanarito sequence: AAN05423.1 (protein), from AY129247 (S fragment). Machupo sequence: AAT40451.1 (protein), from AY619643 (S fragment). Sabia sequence: YP_089665.1 (protein), from NC_006317 (S fragment). Chaparel sequence: YP_001816782.1 (protein), derived from NC_010562 (S fragment). Hu Ning sequence: WAD86878.1 (protein), derived from OL774853.1 (S fragment). Whitewater Arroyo sequence: AAN09950.1 (protein), from AF485264.1 (S fragment). Lassa sequence: AAA46286.1 (protein), from J04324.1 (S fragment). Luho sequence: YP_002929490.1 (protein), derived from NC_012776.1 (S fragment). Plasmid MOPEVAC NEXT (NP) GPC Guanarito, INH-95551 strain – SEQ ID NO: 17 – Figure 15 MOPEVAC NEXT (NP) GPC Guanarito INH-95551 strain sequence S-fragment 5' non-coding sequence: 1-69 The start codons for ORF-P2A-NP: 70-72 Cloning box: 73-92 Connector: 93-101 P2A sequence: 102-158 ExoN ko NP ORF: 159-1868 Intergenic region: 1869-1991 Guanarito (AAN05423.1) GPC ORF: 1992-3431 S-fragment 3' non-coding sequence: 3432-3484 pRF108 plasmid: 3485-6480 For ExoN ko NP ORF, the six mutated residues responsible for eliminating exonuclease activity, are listed in SEQ ID NO: 41 above. underline Mark it.

[0213] Plasmid MOPEVAC NEXT (NP)GPC Machupo, Carvallo strain – SEQ ID NO: 18 – Figure 16 MOPEVAC NEXT (NP)GPC Machupo (Carvallo strain) sequence S-fragment 5' non-coding sequence: 1-69 The start codons for ORF-P2A-NP: 70-72 Cloning box: 73-92 Connector: 93-101 P2A sequence: 102-158 ExoN ko NP ORF: 159-1868 Intergenic region: 1869-1991 Machupo (AAT40451.1) GPC ORF: 1992-3482 S-fragment 3' non-coding sequence: 3483-3535 pRF108 plasmid: 3536-6531 For ExoN ko NP ORF, the six mutated residues responsible for eliminating exonuclease activity, are listed in SEQ ID NO:41 above. underline Mark it.

[0214] Plasmid MOPEVAC NEXT (NP) GPC Chapare – SEQ ID NO: 19 – Figure 17 MOPEVAC NEXT (NP) GPC Chapare sequence S-fragment 5' non-coding sequence: 1-69 The start codons for ORF-P2A-NP: 70-72 Cloning box: 73-92 Connector: 93-101 P2A sequence: 102-158 ExoN ko NP ORF: 159-1868 Intergenic region: 1869-1991 Chapare (YP_001816782.1) GPC ORF: 1992-3449 S-fragment 3' non-coding sequence: 3450-3502 pRF108 plasmid: 3503-6498 For ExoN ko NP ORF, the six mutated residues responsible for eliminating exonuclease activity, are listed in SEQ ID NO:41 above. underline Mark it.

[0215] Plasmid MOPEVAC NEXT (NP)GPC Sabiya – SEQ ID NO: 20 – Figure 18 MOPEVAC NEXT (NP) GPC Sabia Sequence S-fragment 5' non-coding sequence: 1-69 The start codons for ORF-P2A-NP: 70-72 Cloning box: 73-92 Connector: 93-101 P2A sequence: 102-158 ExoN ko NP ORF: 159-1868 Intergenic region: 1869-1991 Sabia (YP_089665.1) GPC ORF: 1992-3458 S-fragment 3' non-coding sequence: 3459-3511 pRF108 plasmid: 3512-6507 For ExoN ko NP ORF, the six mutated residues responsible for eliminating exonuclease activity, are listed in SEQ ID NO:41 above. underline Mark it.

[0216] Plasmid MOPEVAC NEXT (NP)GPC Hu Ning, P3790 Espindola strain – SEQ ID NO: 21 – Figure 19 MOPEVAC NEXT (NP) GPC Hu Ning P3790 Espindola strain sequence S-fragment 5' non-coding sequence: 1-69 The start codons for ORF-P2A-NP: 70-72 Cloning box: 73-92 Connector: 93-101 P2A sequence: 102-158 ExoN ko NP ORF: 159-1868 Intergenic region: 1869-1991 Hu Ning GPC ORF: 1992-3449 S fragment 3' non-coding sequence 3450-3502 pRF108 plasmid: 3503-6498 For ExoN ko NP ORF, the six mutated residues responsible for eliminating exonuclease activity, are listed in SEQ ID NO:41 above. underline Mark it.

[0217] Plasmid MOPEVAC NEXT (NP)GPC Lassa, Josiah strain – SEQ ID NO: 22 – Figure 20 The sequence of MOPEVAC NEXT (NP) GPC Lassa (Josiah strain). S-fragment 5' non-coding sequence: 1-69 ORF-P2A-NP start codons: 70-72 Cloning box: 73-92 Connector: 93-101 P2A sequence: 102-158 ExoN ko NP ORF: 159-1868 Intergenic region: 1869-1991 Lassa GPC ORF: 1992-3467 S-fragment 3' non-coding sequence: 3468-3520 pRF108 plasmid: 3521-6516 For ExoN ko NP ORF, the six mutated residues responsible for eliminating exonuclease activity, are listed in SEQ ID NO:41 above. underline Mark it.

[0218] Plasmid MOPEVAC NEXT (NP) GPC Luho – SEQ ID NO: 23 – Figure 21 MOPEVAC NEXT (NP) GPC Luho sequence S-fragment 5' non-coding sequence: 1-69 The start codons for ORF-P2A-NP: 70-72 Cloning box: 73-92 Connector: 93-101 P2A sequence: 102-158 ExoN ko NP ORF: 159-1868 Intergenic region: 1869-1991 Luho (YP_002929490.1) GPC ORF: 1992-3356 S-fragment 3' non-coding sequence: 3457-3409 pRF108 plasmid: 3410-6405 For ExoN ko NP ORF, the six mutated residues responsible for eliminating exonuclease activity, are listed in SEQ ID NO:41 above. underline Mark it.

[0219] Plasmid MOPEVAC NEXT (NP) GPC Whitewater Arroyo, strain 9310141 – SEQ ID NO: 24 – Figure 22 The sequence of MOPEVAC NEXT (NP) GPC Whitewater Arroyo (strain 9310141). S-fragment 5' non-coding sequence: 1-69 The start codons for ORF-P2A-NP: 70-72 Cloning box: 73-92 Connector: 93-101 P2A sequence: 102-158 ExoN ko NP ORF: 159-1868 Intergenic region: 1869-1991 White Water Arroyo (AAN09950.1) GPC ORF: 1992-3434 S-fragment 3' non-coding sequence: 3435-3487 pRF108 plasmid: 3488-6483 For ExoN ko NP ORF, the six mutated residues responsible for eliminating exonuclease activity, are listed in SEQ ID NO:41 above. underline Mark it.

[0220] Materials and methods for generating MOPEVAC NEXT CCHF vaccine Cloning, Virus Rescue and Sequencing All sequences of CCHFV were derived from IBAR10200 strain (GenBank ID NC_005302.1 (NC_005302.1–SEQ ID NO:50–for the S fragment (Crimea-Congo hemorrhagic fever virus S fragment, complete sequence), encoding the NORF of CCHFV, and NC_005300.2–SEQ ID NO:51–for the M fragment (Crimea-Congo hemorrhagic fever virus M fragment, complete sequence), encoding the multi-protein complex responsible for viral entry, including proteins called MLD, GP38, Gn, NSm, and Gc), and were codon-optimized to promote cellular expression in mammalian cells. The CCHFV NORF (SEQ ID NO:52) of IBAR10200 strain was modified by site-directed mutagenesis according to the manufacturer's instructions and cloned into MOPEVAC NEXT (S). Essentially, this NORF was modified by replacing five codons with alanine to inhibit its endonuclease activity and reduce its ability to interact with RNA (Jeeva S, Mir S, Velasquez A, Ragan J, Leka A, Wu S,Sevarany AT, Royster AD, Almeida NA, Chan F, O'Brien L, Mir MA. Crimean-Congohemorrhagic fever virus nucleocapsid protein harbors distinct RNA-bindingsites in the stalk and head domains. J Biol Chem. 2019 Mar 29;294(13):5023-5037), (Guo Y, Wang W, Ji W, Deng M, Sun Y, Zhou H, Yang C, Deng F, Wang H, HuZ, Lou Z, Rao Z. Crimean-Congo hemorrhagic fever virus nucleoprotein revealsendonuclease activity in bunyaviruses. Proc Natl Acad Sci US A. 2012 Mar 27;109(13):5046-51). These mutations are K132A, Q300A, K411A, H453A and Q457A. The mutated N is referred to as Nmut in this paper (the sequence of the mutated IBAR10200 strain CCHFV N ORF is provided in SEQ ID NO: 53).

[0221] The GP38 sequence was cloned into MOPEVAC NEXT (S). The GP38 sequence cloned into MOPEVAC NEXT (S) is disclosed in SEQ ID NO: 54. It is a fusion of residues 1-23 and 233-519 (inclusive) of GPC strain IBAR10200, corresponding to the fusion of nucleotides 1-69 and nucleotides 697-1557 in the GPC ORF of SEQ ID NO: 54 (total length 930 bp).

[0222] The Gn and Gc sequences cloned into MOPEVAC NEXT (L) are as follows: - Gn is a fusion of polynucleotides corresponding to residues 1-23 and 506-843 (inclusive) of the M fragment ORF of the Crimean-Congo hemorrhagic fever virus disclosed in SEQ ID NO: 51. - Gc is a polynucleotide corresponding to residues 956-1684 (inclusive) of SEQ ID NO: 51. - GnGc is a fusion of polynucleotides corresponding to residues 1-23, 506-839 and 996-1684 (inclusive) of SEQ ID NO: 51.

[0223] Rescuing MOPEVAC NEXT-based viruses in BHKT7 cells is identical to that of MOPEVAC-based viruses and is described in Carnec X, Mateo M, Page A, et al. A Vaccine Platform against Arenaviruses Based on a Recombinant Hyperattenuated Mopeia Virus Expressing Heterologous Glycoproteins. J Virol. 2018 (and in this paper). Generation 0 was then expanded on the helper VeroNP cell line, a Vero E6-derived cell line transduced to stably express MOPV WT NP. Generation 3 viruses were sequenced prior to primary and booster immunizations in IFNARko mice. Common sequences for all fragments of all viruses are available in separate files.

[0224] The sequence of MOPEVAC NEXT CCHF 1 (1 virus, 2 fragments) Virus 1 carries the CCHFV Nmut ORF in the MOPEVAC NEXT (S) fragment and the CCHFV GnGc sequence in the MOPEVAC NEXT (Z) fragment.

[0225] - The third generation shared sequence of MOPEVAC NEXT CCHF 1, virus 1, MOPEVAC NEXT CCHF (S) Nmut fragment is provided in SEQ ID NO: 44.

[0226] - The third generation shared sequence of MOPEVAC NEXT CCHF 1, virus 1, MOPEVAC NEXT CCHF (Z) GnGc fragment is provided in SEQ ID NO: 45.

[0227] The sequence of MOPEVAC NEXT CCHF 2 (2 viruses, 4 fragments) Virus 1 carries the CCHFV Nmut ORF in the MOPEVAC NEXT (S) fragment and the CCHF Gc sequence in the MOPEVAC NEXT (Z) fragment.

[0228] - The third generation shared sequence of MOPEVAC NEXT CCHF 2, virus 1, MOPEVAC NEXT CCHF (S) Nmut fragment is provided in SEQ ID NO: 44.

[0229] - The third generation shared sequence of MOPEVAC NEXT 2, Virus 1, MOPEVAC NEXT CCHF (Z) Gc fragment is provided in SEQ ID NO: 46.

[0230] Virus 2 carries the CCHFV GP38 sequence in the MOPEVAC NEXT (S) fragment and the CCHF Gn sequence in the MOPEVAC NEXT (Z) fragment.

[0231] - The third generation shared sequence of MOPEVAC NEXT CCHF 2, virus 2, MOPEVAC NEXT CCHF (S) GP38 fragment is provided in SEQ ID NO: 47. The annotations of SEQ ID NO: 47 are as follows: 1-69 Mopea S5-NC; 2776-2898 Mopea S fragment intergenic region; 4369-4421 Mopea S fragment 3'NC; 70-72 Mopea NP ORF M6b; 1066-2775 Mopea NP ORF M6b(1); 1000-1008 adapter 1009-1065 P2A sequence; 4422-7417 pRF108; 2899-4368 Mopea GPC ORF; 73-999 GP38 CCHF IBAR10200.

[0232] - The third generation shared sequence of MOPEVAC NEXT 2, virus 2, MOPEVAC NEXT CCHF (Z) Gn fragment is provided in SEQ ID NO: 48.

[0233] The sequence of MOPEVAC NEXT CCHF 3 (2 viruses, 4 fragments) Virus 1 carries the CCHFV Nmut ORF in the MOPEVAC NEXT (S) fragment and the CCHF Gn sequence in the MOPEVAC NEXT (Z) fragment.

[0234] - The third generation shared sequence of MOPEVAC NEXT CCHF 3, virus 1, MOPEVAC NEXT CCHF (S) Nmut fragment is provided in SEQ ID NO: 44.

[0235] - The third generation shared sequence of MOPEVAC NEXT 3, Virus 1, MOPEVAC NEXT CCHF (Z) Gn fragment is provided in SEQ ID NO: 48.

[0236] Virus 2 carries the CCHFV Gc sequence in the MOPEVAC NEXT (Z) fragment, and the S fragment is as described in this paper.

[0237] - MOPEVAC NEXT CCHF 3, Virus 2, and the third generation shared sequence of the S fragment (as described in this article – see, for example, in this article) Figure 33 The published content and SEQ ID NO: 49 use the Mopeia S fragment with an NP mutation at position 6 as described in WO2017 / 068190 and SEQ ID NO: 49. The sequence annotation is as follows: 1-69 Mopeia S5-NC; 70-72 Mopeia NP ORF M6b; 73-1782 Mopeia NP ORF M6b(1); 1783-1905 Mopeia S fragment intergenic region; 1906-3375 Mopeia GPC ORF; 3376-3428 Mopeia S fragment 3'NC; 3429-6424 pRF108.

[0238] - The third generation shared sequence of MOPEVAC NEXT 3, virus 2, MOPEVAC NEXT CCHF (Z) Gc fragment (SEQ ID NO: 46).

[0239] Immunity and Attack B6.129S2-Ifnar1tm1Agt / Mmjax “IFNARko” mice were bred and housed at the Pasteur Institute. Animals were 10-12 weeks old at the start of the program. Each group was housed in two cages, with six same-sex littermates per cage. Animals were randomly selected and euthanized on day four post-infection before the start of the study. Mice were immunized with a primary immunization plus booster immunization strategy via intraperitoneal injection (500 µL vaccine / animal). Mice were infected with CCHFV strain Ibar10200 (expected 400 FFU / animal) at the BSL4 Jean Mérieux / INSERM facility. Animals were anesthetized with Vetflurane (Virbac) prior to injection or blood collection. All procedures were approved by the Paris Regional Animal Ethics Committee (2023122213424805) and the Rhône-Alpes Regional Animal Ethics Committee (2024010310515108).

[0240] Viral titration Plasma samples or fluid from ground organs were titrated on Vero E6 cells. Samples were diluted 10-fold in DMEM 5% FBS and 0.5% PenStrep and added to Vero E6 cells in 12-well plates (200 µL plasma inoculum, 100 µL organ inoculum), incubated at 37°C and 5% CO2 for 1 hour, and then added to semi-solid CMC DMEM medium for five days. The presence of viral infection spots was detected by immunostaining using mouse anti-CCHFV ascites fluid and PA-conjugated goat anti-mouse polyclonal antibody and NBT / BCIP substrate. Results are expressed as lesion formation units per mL plasma or per mg organ (FFU / mL or FFU / mg).

[0241] Enzyme-linked immunosorbent assay Recombinant CCHFV N or Gc protein was diluted 1 µg / mL in PBS and coated onto Maxisorp 96-well plates, then incubated overnight. After blocking with PBS containing 1% BSA for 2 hours at room temperature (RT), mouse plasma (1 / 100 to 1 / 12500) diluted with PBS containing 0.05% Tween and 1% BSA was serially diluted 5-fold and added to the wells, then incubated at room temperature for 1 hour. The plates were washed three times with PBS containing 0.05% Tween. Antibody against mouse anti-CCHFV antigen was detected using HRP-conjugated anti-mouse IgG rabbit polyclonal antibody (1 / 10000, in PBS containing 0.005% Tween and 1% BSA). The plates were washed three times with PBS containing 0.05% Tween before adding TMB substrate. The reaction was terminated by adding H3PO4 solution. The signal on the plates was measured using a Tecan microplate reader. The positive control for CCHFV N and IgG detection was internal mouse ascites fluid targeting CCHFV, and the negative control was plasma from IFNARko mice infected with Mopeia virus. A positive CCHFV IgG value was considered to be equivalent to twice the average value of the negative control plus one SD.

[0242] T cell activation Spleen cells from animals were isolated and sacrificed on the fourth day post-infection, and resuspended in RPMI 10% FBS, 2 mM glutamine, 0.1 mM β-mercaptoethanol, 0.2 mM sodium pyruvate, and 0.5% Penstrep. A mixture of Brefeldin A (final concentration 10 µg / ml) and a 15-residue CCHFV-derived peptide N or Gc pool (final concentration 1 µg / ml) was added to one million spleen cells and incubated overnight at 37°C and 5% CO2. Cells were then stained with the following antibodies to detect cell surface expression of CD3, CD4, and CD8, as well as intracellular expression of IFNγ, TNFα, CD137, and CD154: anti-CD3-APC (100312, Biolegend), anti-CD4-APC (100536, Biolegend), anti-CD8-APCH7 (100714, Biolegend), anti-IFNγ-PC7 (505826, Biolegend), anti-TNFα-BV421 (506328, Biolegend), anti-CD137-PE (106106, Biolegend), and anti-CD154-FITC (157006, Biolegend). Fluorescence of stained cells was acquired using a Gallios flow cytometer (Beckman Coulter), and data were analyzed using Kaluza software.

[0243] experiment Modifications used by the MOPEVAC platform to express heterogeneous ORFs: The inventors here demonstrate modifications to the MOPEVAC platform, which they have named MOPEVAC NEXT, that allow the production of recombinant MOPEVAC-based viruses that express at least one heterologous protein in addition to the four proteins encoded by the arenavirus genome. The MOPEVAC platform, in turn, consists of MOPVs (AN21366 strain, GenBank accessions JN561684 and JN561685) that carry the GPC of the target virus in place of their own GPC and have a mutation in the nucleoprotein gene to eliminate exonuclease function, as described in WO2017 / 068190 or (Carnec X, Mateo M, Page A, et al. AVaccine Platform against Arenaviruses Based on a Recombinant Hyperattenuated Mopeia Virus Expressing Heterologous Glycoproteins. J Virol. 2018), which are incorporated herein by reference in their entirety. In this experiment, the inventors determined locations on the MOPEVAC genome that allow the introduction of coding sequences upstream or downstream of the viral ORF. When cloning ORFs, especially when cloning cellular ORFs into the MOPEVAC scaffold, only certain insertion sites of heterologous ORFs are effective.

[0244] The viral fragment modification used to express heterologous proteins from MOPEVAC is a two-step strategy: - By site-directed mutagenesis, a universal cloning strategy based on type II BsmBI enzyme and a cloning cassette consisting of a linker sequence coupled to a 2A self-cleaving peptide sequence were introduced downstream of the ORF start codon (ATG-). BsmbI-CGGCCC-BsmBI-XXX-connect Head-2A -ORF, Figure 1A) or upstream of the stop codon (ORF- Connector-2A-XXX-BsmBI-CGGCC-BsmBI -termination, Figure 1B ).

[0245] - Once the cassette is independently introduced into six of the eight possible locations provided by the four ORFs of MOPEVAC, a standard cloning procedure is used to clone a reporter gene coupled with an HA tag into the cloning site of the cassette.

[0246] From plasmids expressing MOPEVAC viral fragments S (pPOL-S) or L (pPOL-L), Figure 1A and Figure 1BThe cassette described above is introduced into the N-terminus of NP, Lpol, or Z ORF, and the C-terminus of NP, GPC, or Z ORF to construct a plasmid: - pPOL-S-NP-N-KP2A (representing: NP-(N)-terminal insertion-connector (K) and PA2 sequence) - pPOL-S-NP-C-KP2A (representing: NP-(C)-terminal insertion-connector (K) and PA2 sequence) - pPOL-S-GPC-C-KP2A - pPOL-L-Lpol-N-KP2A - pPOL-LZN-KP2A - pPOL-LZC-KP2A Subsequently, the mCherry reporter gene with an N-terminal HA tag (HAmCherry) or a C-terminal HA tag (mCherryHA) was cloned into the above six plasmids to construct the plasmids: - pPOL-S-NP-N-HAmCherry - pPOL-S-NP-C-mCherryHA - pPOL-S-GPC-C-mCherryHA - pPOL-L-Lpol-HAmCherry - pPOL-LZN-HAmCherry - POL-LZC-mCherryH Six rescue experiments were technically previously described from these six constructs, such as WO2017 / 068190 and (Mateo M, Reynard S, Carnec X, et al. Vaccines inducing immunity to Lassa virus glycoprotein and nucleoprotein protect macaques after a single shot. Sci Transl Med. 2019;11(512):1-18)-(Reynard S, Carnec X, Picard C, et al. A MOPEVAC multivalent vaccine induces sterile protection against New World arenaviruses in non-human primates. NatMicrobiol. 2023), and these documents are incorporated herein by reference in their entirety. Three viruses were recovered. - MOPEVAC NEXT Lpol N-HAmCherry - MOPEVAC NEXT Z C-mCherryHA - MOPEVAC NEXT NP N-HAmCherry The results of the rescue, amplification, and titration experiments are as follows: Figure 1C As shown, this demonstrates the ability to rescue MOPEVAC-derived viruses expressing a heterologous protein at the N-terminus of the NP and Lpol ORFs and the C-terminus of the Z ORF. Since HA-mCherry expression from the Lpol ORF is weaker than other expressions, the inventors did not further investigate this method for the purposes of this report. Therefore, when cloning the ORF into the L fragment, it can refer to the C-terminal clone of the Z ORF, as this has been preliminarily investigated. The remaining two positions allow for differentiation of recombinant viruses by the following classification: - MOPEVAC NEXT NP N-HAmCherry = MOPEVAC (S) mCherry - MOPEVAC NEXT Z C-mCherryHA = MOPEVAC (L) mCherry MOPEVAC NEXT expansion was performed using VeroE6 cells that stably expressed Mopeya WT NP.

[0247] MOPEVAC NEXT virus exhibited limited infection titer kinetics in VeroE6. Mutations in the NP gene and the introduction of heterologous sequences were the cause of the observed attenuation. To improve this, the inventors engineered a VeroE6-derived cell line stably expressing wild-type MOPV NP. For this purpose, WT NP ORF was cloned into pLV-MCS-IRES-Hygro, a lentiviral vector that allows ORF cloning upstream of IRES followed by a hygromycin resistance gene. Retroviral particles pseudotyped with the VSV-G envelope glycoprotein were generated and used to infect VeroE6 cells. Hygromycin was then added to the culture medium to screen for cells with integrated viral DNA. VeroNP clones were subsequently isolated, amplified, and NP expression was verified by immunofluorescence (Figure 2A). They then compared the production and titration of MOPEVAC mCherry (S) and MOPEVAC mCherry (L) viruses on VeroE6 cells and / or VeroNP cells. The results in Figure 2B show that when both viruses were produced and titrated on VeroNP cells, they achieved infection titers similar to those of recombinant Mopea virus. Expression of WT NP in VeroE6 cells significantly enhanced the production of MOPEVAC NEXT viral particles. The engineered VeroE6-derived cell line was the VERO-NP cell line deposited at CNCM (National Center for Microbial Culture Collection) on February 2, 2024, with accession number CNCM I-6034.

[0248] Human cell ORF cloned into the (S) or (L) fragment of MOPEVAC NEXT is expressed by recombinant viral epithelial cells during infection. Da.

[0249] As evidence of principle, and to verify whether ORFs other than reporter genes could be expressed in the MOPEVAC NEXT backbone, the inventors cloned ORFs with different cellular functions and locations to demonstrate a range of possibilities for the MOPEVAC NEXT platform. The cloned ORFs were an N-myristyltransferase 1 ORF (HA-NMT1, 1515 bp) cloned into the pPOL-S-NP-N-KP2A plasmid with an N-terminal HA tag, and a Nectine4 ORF (1584 bp) cloned into the pPOL-LZC-KP2A plasmid with a C-terminal Flag tag. NMT1 is a cytoplasmic enzyme responsible for myristylation of cellular proteins, while Nectine4 is a single-pass transmembrane type I membrane protein with an immunoglobulin-like domain involved in cell adhesion. Following rescue experiments, they obtained (S)HA-NMT1 and (L) Nectine4-Flag viruses for infecting VeroNP cells. After cell lysis, total protein extract was collected, separated by SDS-PAGE, and the presence of HA-NMT1 and Nectine4-flag was analyzed by Western blotting. Figure 3 The results showed that full-length HA-NMT1 and Nectine4-flag were present in the extracts of VeroNP cells infected with the corresponding virus.

[0250] The S and L MOPEVAC NEXT derivative fragments were combined to express two heterologous ORFs from a single recombinant virus.

[0251] To determine whether the MOPEVAC-derived virus expressing the first reporter gene from the S fragment and the second reporter gene from the L fragment could be rescued, the CFP ORF was cloned into the plasmid pPOL-S-NP-N-KP2A to generate the pPOL-S-NP-CFP plasmid, and rescue experiments were performed to generate a virus expressing CFP from the NP ORF and mCherryHA from the Z ORF. As shown in Figure 4, the corresponding virus was successfully rescued, and cells infected with MOPEVAC (S) YFP+ (L) mCherry expressed both reporter genes.

[0252] Connect MOPEVAC NEXT with MOPEVAC LAS and MOPEVAC NEW combination The heterologous ORF cloned in the pPOL-S-NP-N-KP2A and pPOL-LZC-KP2A plasmids are hereby reporter gene and cellular ORF, but ORFs derived from animal or human pathogens may also be used, including antigenic or highly antigenic ORFs derived from animal or human pathogens.

[0253] Furthermore, all plasmid constructs generated in this report were created using the S fragment carrying the Mopeya GPC. However, the introduction of MOPEVAC... LAS and MOPEVAC NEWThe cloning cassette in the S segment of the backbone allows the GPC ORF of MOPV to be replaced by the GPC of Lassa virus, Machupo virus, Junin virus, Guanarito virus, Chapare virus, or Sabia virus, thereby producing a recombinant virus expressing a heterologous ORF within a virus carrying another envelope glycoprotein.

[0254] The production of MOPEVAC NEXT CCHF vaccine CCHFV belongs to the genus Orthonairovirus of the family Nairoviridae in the order Bunyavirales. It is an enveloped virus whose genome consists of three negative-sense RNA molecules. The S segment encodes nucleoprotein N and NS proteins in an antisense orientation. The M segment encodes the GPC polymer precursor, which is proteolytically processed into Gn and Gc, responsible for viral entry, and also into the mucin-like domains MLD, GP38, and NSm proteins. The L fragment encodes a large RNA-dependent RNA polymerase (Hawman DW, Feldmann H. Recent advances in understanding Crimean-Congo hemorrhagic fever virus. F1000Res. 2018 Oct 29;7:F1000 Faculty Rev-1715; Zivcec M, Scholte FE, Spiropoulou CF, Spengler JR, Bergeron É.Molecular Insights into Crimean-Congo Hemorrhagic Fever Virus. Viruses. 2016Apr 21;8(4):106). CCHF is a zoonotic disease, primarily transmitted to humans through blood-feeding by infected Hyalomma ticks (the host species). CCHF is a widespread hemorrhagic fever with reported cases in Africa, Europe, and Southeast Asia. Reports of human infection with CCHFV may also occur during the handling and slaughter of infected livestock, as well as in hospital and family settings. Because ticks of the genus *Hypericum* can feed on blood from a variety of domestic and wild (asymptomatic) animals and have a wide geographical distribution, the chain of virus transmission to humans is increased (Hawman DW, Feldmann H. Crimean-Congo haemorrhagic fever virus. Nat Rev Microbiol. 2023 Jul;21(7):463-477).In 2024, the CCHF virus was first identified in livestock and ticks in southern France (Bernard C, JolyKukla C, Rakotoarivony I, Duhayon M, Stachurski F, Huber K, Giupponi C, Zortman I, Holzmuller P, Pollet T, Jeanneau M, Mercey A, Vachiery N, Lefrançois T, Garros C, Michaud V, Comtet L, Despois L, Pourquier P, Picard C, Journeaux A, Thomas D, Godard S, Moissonnier E, Mely S, Sega M, Pannetier D, Baize S, Vial L. Detection of Crimean-Congo haemorrhagic fever virus in Hyalomma marginatum ticks, southern France, May 2022 and April 2023. EuroSurveill. 2024). Feb;29(6):2400023), (Kiwan P, Masse S, Piorkowski G, Ayhan N, Gasparine M, Vial L, Charrel RN, de Lamballerie X, Falchi A. Crimean-Congo Hemorrhagic Fever Virus in Ticks Collected from Cattle, Corsica, France,2023. Emerg Infect Dis. 2024 May;30(5):1036-1039). In humans, infection is usually asymptomatic but can develop into fatal hemorrhagic fever with a high mortality rate (Hawman DW, Feldmann H. Crimean-Congo hemorrhagic fever virus. Nat Rev Microbiol. 2023 Jul;21(7):463-477).

[0255] The MOPEVAC NEXT platform is characterized by cloning the following CCHFV sequences into the modified MOPEVACNEXT S and L constructs described in this article: - Clone the N ORF or GP38 sequence into the MOPEVAC NEXT (S) plasmid ( Figures 28-29 - Clone the Gn, Gc, or GnGc sequence into the MOPEVAC NEXT (L) plasmid ( Figure 30 , 31 and 32) The CCHFV sequences cloned into MOPEVAC NEXT were derived from the “reference” strain IBAR10200 (S fragment GenBank accession number NC_005302.1, encoding the CCHFV N ORF; M fragment GenBank accession number NC_005300.2, encoding the multiprotein complex responsible for viral entry, including proteins known as MLD, GP38, Gn, NSm, and Gc). All CCHFV sequences derived from the cloned plasmid into MOPEVAC NEXT underwent initial codon optimization to increase expression of the cloned sequences in mammalian cells.

[0256] NORF has been modified by replacing five codons with alanine to inhibit its endonuclease activity and reduce its ability to interact with RNA (Jeeva S, Mir S, Velasquez A, Ragan J, Leka A, Wu S, Sevarany AT, Royster AD, Almeida NA, Chan F, O'Brien L, Mir MA. Crimean-Congo hemorrhagic fever virus nucleocapsid protein harbors distinct RNA-binding sites in the stalk and head domains. J Biol Chem. 2019 Mar 29;294(13):5023-5037), (Guo Y, Wang W, Ji W, Deng M, Sun Y, Zhou H, Yang C, Deng F, Wang H, Hu Z, Lou Z, Rao Z. Crimean-Congo hemorrhagic fever virus nucleoprotein reveals endonuclease activity in bunyaviruses. Proc Natl AcadSci US A. 2012 Mar 27;109(13):5046-51). These mutations are K132A, Q300A, K411A, H453A, and Q457A. The mutation N is referred to as Nmut in this paper.

[0257] The Gn, Gc, and GnGc cloning sequences were engineered from the original full-length GPC polyprotein sequence, which was 5052 nucleotides / 1486 residues in length, as follows: - Gn is a fusion of polynucleotides corresponding to residues 1-23 and 506-843 (inclusive).

[0258] - Gc is a polynucleotide corresponding to residues 956-1684 (inclusive).

[0259] - GnGc is a fusion of polynucleotides corresponding to residues 1-23, 506-839, and 996-1684 (inclusive).

[0260] Three CCHFV vaccine candidates based on MOPEVAC NEXT are described in Figure 23 and consist of the following: - Monovalent MOPEVAC CCHF 1, carrying Nmut ORF and GnGc sequences, targets a total of three CCHFV-derived antigens. - Bivalent MOPEVAC CCHF 2, a mixture of two recombinant viruses, one carrying Nmut ORF and Gc sequences, and the other carrying GP38 and Gn sequences, targeting a total of four CCHFV-derived antigens. - Bivalent MOPEVAC CCHF 3, a mixture of two recombinant viruses, one carrying Nmut ORF and Gn sequences, and the other carrying a Gc sequence, targeting a total of three CCHFV-derived antigens. To rescue these five viruses, four plasmids encoding specific polynucleotides were subsequently transfected into the BHKT7 cell line. The detailed steps for rescuing the MOPEVAC NEXT-derived virus are described in particular in the Materials and Methods section (“Rescue Experiments and Virus Stockpile Preparation”). Subsequently, as described in the Experiments section of this application, the supernatant of each virus was amplified in VeroNP cells.

[0261] MOPEVAC CCHF vaccine in lethal IFNAR ko Protective effect in mouse infection models To evaluate the protective efficacy of the three MOPEVAC CCHF attenuated live recombinant vaccines against CCHFV, the inventors used a detailed IFNAR. ko Mouse infection model. This model has been used in more than ten studies to test vaccines or antiviral drugs, in which no animal, regardless of sex, can survive infection without effective prevention or treatment (reviewed in Pirincal A, Doymaz MZ. The Role of Nucleocapsid Protein (NP) in the Immunology of Crimean-Congo Hemorrhagic Fever Virus (CCHFV). Viruses. 2024Sep 30;16(10):1547).

[0262] IFNAR ko Vaccination and attack procedures in mouse models: The experiment began with forty-eight animals, divided into four groups of twelve each. Three groups received the vaccine, while the fourth group received a sham vaccine (control). All groups consisted of six males and six females, except for the control group, which was entirely male. The vaccination strategy involved administering two identical doses of MOPEVAC CCHF (primary immunization + booster immunization) one month apart. The doses of MOPEVAC CCHF 1, 2, and 3 were 3.6 × 10⁻⁶. 5 FFU, 1.0×10 6 FFU and 4.4×10 5FFU / dose. The detailed timeline of the experiment is shown in Figure 2A. During the immunization phase, blood samples were collected 21 days after the initial immunization and 14 days after the booster immunization to extract plasma and assess antibody responses against CCHFV-derived antigens (Ag). During the immunization phase, one female animal in the MOPEVACCCHF 2 group failed to fully recover from anesthesia and was euthanized according to the endpoint criteria. One month after the second immunization, all surviving animals were transferred to the Jean Mérieux / INSERM BSL4 facility and, after an eight-day acclimatization period, were intraperitoneally inoculated with CCHFV IBAR10200 strain (titrated inoculum of 501 FFU / animal and back-titrated inoculum of 340 FFU / animal). Animals were weighed and scored daily according to a standard scoring scale. Four days post-infection, corresponding to the peak of the disease, 6 out of 11 to 12 animals in each group (ideally 3 males + 3 females) were euthanized to collect samples for analysis and comparison of T-cell and antibody responses between groups. Survival rates of the remaining animals were assessed up to the 28th day post-infection.

[0263] Attack results: Kaplan-Meier survival curves for the attack are shown in Figure 2B. All animals vaccinated with MOPEVAC CCHF 1 and 3 survived the infection, while all control animals either reached the pre-set euthanasia score criteria (n=6) or died from the infection between days 3 and 4 (n=6). Five of the six animals vaccinated with MOPEVAC CCHF 2 survived the infection, except for one female animal which was euthanized two days after the attack because it never fully recovered from the anesthesia required for the infection procedure and rapidly reached the endpoint criteria. Ten of the twelve control animals began to lose weight from day 3. All vaccinated animals gained weight during the study period, but were scored periodically based on the location of the ear patches and beard.

[0264] MOPEVAC NEXT CCHF vaccine prevents virus transmission. The inventors first assessed the presence of infectious CCHFV in the plasma and organs of animals euthanized four days after infection. To this end, serial dilutions of plasma and organ lysates were titrated on Vero E6 cells, and the presence of the virus was detected by immunostaining. Figure 3 Results in A showed that all animals vaccinated with the sham vaccine had high viremia, while no infectious CCHFV was detected in animals vaccinated with MOPEVAC CCHF 1, 2, or 3. Similar results were observed in organs. Figure 3B): Strong and widespread viral load was present in the liver, spleen, lungs, and brain of all control group animals. Viral presence in the testes varied from animal to animal. Infectious CCHFV was not detected in the plasma or organs of all animals vaccinated with the MOPEVAC CCHF 2 vaccine, except in the lungs of one animal in the MOPEVAC CCHF 2 vaccination group. These results indicate that the MOPEVAC CCHF vaccine promotes an immune response that blocks viral transmission.

[0265] The MOPEVAC CCHF vaccine promotes a strong antibody response against the CCHFV antigen: During the immunization phase, blood was collected from all animals and plasma was extracted to analyze IgG antibody responses against CCHFVAg via indirect ELISA. Recombinant N or Gc protein was coated onto 96-well plates, saturated, and five-fold serially diluted plasma was added (dilution range: 1 / 100–1 / 12500). Mouse IgG against CCHFVAg was detected using HRP-conjugated anti-mouse IgG polyclonal antibody and TMB substrate. The results in Figure 4A show that all animals in all MOPEVAC CCHF vaccination groups developed a strong antibody response to recombinant CCHFV N protein 21 days after the initial injection. Antibody titers remained positive at a 1 / 12500 dilution after booster injections. Differences in antibody titers against recombinant CCHFV Gc protein can be observed in Figure 4B. The initial immunization plasma antibody titers of animals vaccinated with MOPEVAC CCHF 3 were higher than those of animals vaccinated with MOPEVAC CCHF 2, while no antibodies against Gc were detected in the plasma of animals vaccinated with MOPEVAC CCHF 1. Compared to primary immunization, booster plasma from all vaccines showed higher Gc antibody titers at the same level. Not all plasma from MOPEVAC CCHF1-inoculated animals was positive for anti-Gc IgG after booster immunization.

[0266] Similar results were obtained when assessing antibody responses to N and Gc Ag in the plasma of animals euthanized four days post-infection (Figs. 4C-D). The plasma of control animals lacked IgG recognizing CCHF Ag, unlike all vaccinated animals, suggesting that the presence of IgG against CCHF Ag was solely due to vaccination. N protein antibody titers remained positive at a 1 / 12500 dilution in all vaccinated animals. Gc antibody titers were evenly distributed across all three groups of vaccinated animals, with higher titers in MOPEVAC CCHF 2 and 3 than in MOPEVAC CCHF 1. At 28 days post-infection, N and Gc antibody titers were positive at a 1 / 12500 dilution in all surviving animals, except for two animals vaccinated with MOPEVAC CCHF 1 and one vaccinated with MOPEVAC CCHF 2, all of which were against Gc (Figs. 4E-F), but these increases in Gc antibody titers are more likely related to the host's response to infection.

[0267] Evaluation of CCHFV antibody responses before and after challenge showed that expression of Nmut from MOPEVAC NEXT (S) (a common feature of all MOPEVAC CCHF vaccines) promoted a strong IgG response to the CCHFV N protein, while the IgG response to Gc varied from vaccine to vaccine. The earliest and strongest IgG responses against Gc were obtained using MOPEVAC CCHF 2 and 3, where Gc expression was driven by MOPEVAC NEXT (L). The introduction of a fused GnGc sequence in MOPEVAC CCHF 3, compared to MOPEVAC CCHF 1 and 2, promoted a weaker IgG response to Gc.

[0268] MOPEVAC CCHF vaccine promotes strong T CD4+ and CD8+ lymphocyte responses against CCHFV. The inventors measured the ability of the MOPEVAC CCHF vaccine to promote a specific T-cell response against CCHFV in a assay based on spleen cells isolated from animals euthanized on day four post-infection. The isolated spleen cells were incubated with CCHFV N or Gc-derived peptides, and after 24 hours of incubation, the cells were stained with antibodies to characterize the activation status of CD4+ or CD8+ lymphocytes by detecting intracellular IFNγ, TNFα, CD154, or CD137. Figure 5 The results in A showed that, compared with animals sham-vaccinated, the mean increase in the CD3+CD8+IFNγ+ lymphocyte population stimulated with the N-derived peptide was non-significant in all MOPEVAC CCHF vaccine-vaccine groups. In all three vaccination groups, several animals did not respond better to the N-derived antigen than the control group. These results were similar for the CD3+CD8+CD137+ lymphocyte population. Figure 5Results from group B showed that the control group had a limited response to Gc-derived peptides compared to animals vaccinated with all MOPEVAC CCHF vaccines. On average, for all MOPEVAC CCHF vaccines, 3% to 4% of CD3+CD8+ lymphocytes were positive for IFNγ or TNFα upon stimulation with Gc-derived peptides, and their response was no better than the control group except for the TNFα-positive population targeting MOPEVAC CCHF 1. Except for MOPEVAC CCHF 1, the mean increase in the CD137 or CD154-positive population of CD3+CD8+ lymphocytes was significant in all vaccination groups. CD3+CD4+ lymphocyte populations stimulated with N or Gc-derived peptides exhibited a higher degree of activated discrete distribution compared to CD3+CD8+ lymphocytes. Figure 5 CD). In each vaccination group, several animals had a high percentage of IFNγ or TNFα positive populations, reaching up to 6% positive cells, while the percentage of activated cells in other animals was similar to that in the control group, as illustrated by MOPEVAC CCHF 1 CD3+ CD4+ IFNγ against Gc N-derived peptides ( Figure 5 CD, left image). CD3+CD4+ groups positive for CD154 or CD137 also showed a discrete distribution, with positive cells in animals reaching as high as 2.5% ( Figure 5 (C-intermediate figure), and the responses of other animals were no better than those of the sham-vaccinated animals. In summary, these results indicate that all MOPEVAC CCHF vaccines rapidly elicit a robust CD8+ lymphocyte population against CCHFV-derived antigens, and to a lesser extent, a CD4+ population. Our results also highlight that the envelope glycoprotein Gc appears to be a better activator of the CD8+ lymphocyte response than the N nucleoprotein, while N and Gc appear to be comparable in their ability to promote the CD4+ lymphocyte response.

[0269] in conclusion This disclosure describes the origin of a modified MOPEVAC platform for generating recombinant viruses that, according to a specific embodiment, express one or two heterologous ORFs in helper VeroNP cells. This platform allows for the expression of non-isopyrvirus antigens using attenuated live viral vectors and constitutes a novel and improved vaccine platform. Furthermore, the first application of the MOPEVAC NEXT vaccine platform, designed for the prevention of Crimean-Congo hemorrhagic fever virus, has been completed. In fact, the MOPEVAC NEXT platform is designed to express pathogen antigens for vaccine purposes. As evidence of concept, one monovalent and two bivalent vaccines expressing CCHFV-derived antigens have been generated and have been used in IFNAR cells infected with CCHFV. koThe model employed a primary immunization / booster immunization strategy. Similarities and heterogeneity were observed among the vaccines when assessing host responses. The N nucleoprotein of CCHF is expressed by MOPEVAC NEXT (S) and is a common feature of all vaccines generated in this study. For all MOPEVAC CCHF vaccines, the IgG response to this Ag was rapid and strong immediately after the initial injection and persisted throughout the study. The inventors observed heterogeneity in IgG titers against Gc, which was weaker in MOPEVAC CCHF 1 compared to the other two vaccines. Gc expression in all three vaccines was derived from MOPEVAC NEXT (L), but there are differences that may explain these variations. Gc expression in MOPEVAC CCHF 3 is unique within its virus, while in MOPEVAC CCHF 2 it is conjugated to another CCHFV Ag, or in MOPEVAC CCHF 1 it is directly fused to Gn. Conversely, in all three vaccines, the CD8+ lymphocyte response against Gc was stronger than the response against N. One explanation for these differences may stem from the nature of the Ag itself, their cellular localization (N is a soluble protein found in the cytoplasm, while Gc is a transmembrane glycoprotein transported from the endoplasmic reticulum to the Golgi apparatus to reach the cell surface), and how Gc and N-derived peptides are presented to HCM-I. Our study shows that although the antibody and T-cell responses induced by the three MOPEVAC CCHF vaccines differed, they all protected infected animals from the extensive viral replication and spread that led to their death four days after infection. PCT / RO / 134 form

Claims

1. A nucleic acid construct comprising a DNA molecule encoding a recombinant L fragment of Mopeya virus (MOPV), wherein the DNA molecule comprises, from its 5' end to its 3' end, in the following order: a) Polynucleotides encoding the open reading frame (ORF) of MOPV L polymerase (Lpol), and b) Polynucleotides containing the MOPV intergenic region (IGR), and c) A polynucleotide encoding at least one polypeptide or protein heterologous to MOPV, and d) A polynucleotide encoding a 2A self-cleaving peptide, optionally having an additional polynucleotide linker sequence at the 5' end of the polynucleotide encoding the 2A self-cleaving peptide, and e) Polynucleotides encoding the MOPV Z protein ORF, and The polynucleotides a) and e) are each side-joined with a polynucleotide consisting of a non-coding sequence, the non-coding sequence containing a regulatory element for controlling the transcription of the coding sequence of the nucleic acid construct, and wherein the polynucleotides c), d) and e) are operatively linked for expression.

2. A nucleic acid construct comprising a DNA molecule encoding a recombinant L fragment of Mopeya virus (MOPV), wherein the DNA molecule comprises, from its 5' end to its 3' end, in the following order: a) A polynucleotide encoding at least one polypeptide or protein heterologous to MOPV, and b) A polynucleotide encoding a 2A self-cleaving peptide, optionally having an additional polynucleotide linker sequence at the 5' end of the polynucleotide encoding the 2A self-cleaving peptide, and c) Polynucleotides encoding the open reading frame (ORF) of MOPV L polymerase (Lpol), and d) Polynucleotides containing the MOPV intergenic region (IGR), and e) Polynucleotides encoding the MOPV Z protein ORF, and The polynucleotides a) and e) are each side-attached to a polynucleotide consisting of a non-coding sequence containing a regulatory element for controlling the transcription of the coding sequence of the nucleic acid construct, and wherein the polynucleotides a), b) and c) are operatively linked for expression.

3. A nucleic acid construct comprising a DNA molecule encoding a recombinant S fragment of MOPV, wherein the DNA molecule comprises, from its 5' end to its 3' end, in the following order: a) A polynucleotide encoding at least one polypeptide or protein heterologous to MOPV, and b) A polynucleotide encoding a 2A self-cleaving peptide, optionally having an additional polynucleotide linker sequence at the 5' end of the polynucleotide encoding the 2A self-cleaving peptide, and c) Polynucleotides encoding MOPV nucleoprotein (NP) with diminished exonuclease activity, and d) Polynucleotides containing the MOPV intergenic region (IGR), and e) Encoding polynucleotides of MOPV or non-MOPV glycoprotein precursors (GPCs), particularly New World arena virus GPCs, and The polynucleotides a) and e) are each side-attached to a polynucleotide consisting of a non-coding sequence containing a regulatory element for controlling the transcription of the coding sequence of the nucleic acid construct, and wherein the polynucleotides a), b) and c) are operatively linked for expression.

4. The nucleic acid construct according to claim 3, wherein the polynucleotide encoding the MOPV nucleoprotein (NP) with weakened exonuclease activity is a polynucleotide encoding the MOPV NP, wherein one or more mutations are introduced relative to the sequence of the wild-type MOPV NP, resulting in partial or complete loss of the exonuclease activity of the NP.

5. The nucleic acid construct according to claim 3 or 4, wherein the GPC is derived from one of the following sand-borne viruses: Lassa virus (LASV), Lujo virus (LUJV), Machupo virus (MACV), Sabya virus (SABV), Chapare virus (CHAPV), Junin virus (JUNV), and Guanarito virus (GTOV), as well as Whitewater Arroyo virus.

6. The nucleic acid construct according to any one of claims 1 to 5, wherein the polynucleotide encoding at least one polypeptide or protein heterologous to MOPV: i. Having a size of at least 100 bp, particularly between 1000 bp and 2500 bp, especially having a size selected from the following: 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400 or 2500 bp, and / or ii. Contains nucleic acids encoding antigenic determinants or fragments thereof from human or animal pathogens, or nucleic acids derived from human or animal pathogens, and / or iii. A nucleic acid comprising an antigenic determinant, said antigenic determinant being CCHFV N ORF of SEQ ID NO: 52 or SEQ ID NO: 53, or a fragment thereof, or derived from, particularly codon-optimized to promote cellular expression in mammalian cells, CCHFV N ORF of SEQ ID NO: 52 or SEQ ID NO: 53, or a fragment thereof. iv. A nucleic acid comprising an antigenic determinant, said antigenic determinant being the GP38 sequence of IBAR10200 strain, or a fragment thereof, or derived from, particularly codon-optimized to promote cellular expression in mammalian cells, or v. A nucleic acid containing an antigenic determinant, said antigenic determinant being a Gc sequence of IBAR10200 strain, or a fragment thereof, or a Gc sequence derived from, particularly codon-optimized to promote cellular expression in mammalian cells, or vi. A nucleic acid containing an antigenic determinant, said antigenic determinant being a Gn sequence of strain IBAR10200, or a fragment thereof, or a Gn sequence derived from, particularly codon-optimized to promote cellular expression in mammalian cells, or vii. Contains a nucleic acid encoding an antigenic determinant, said antigenic determinant being a chimeric GcGn sequence of the IBAR10200 strain, or a fragment thereof, or a chimeric GcGn sequence derived from, and particularly codon-optimized to promote cellular expression in mammalian cells.

7. An expression cassette or vector comprising a nucleic acid construct according to any one of claims 1 to 6, particularly a vector as an expression vector, and more particularly a vector as a plasmid.

8. A eukaryotic cell comprising a nucleic acid construct, expression cassette, or vector according to any one of claims 1 to 7.

9. A method for expressing one or more polypeptides or proteins or fragments thereof heterologous to Mopea virus (MOPV) in eukaryotic host cells and / or producing recombinant attenuated live Mopea virus (MOPV) expressing one or more polypeptides or proteins or fragments thereof heterologous to MOPV, wherein the method comprises the following steps: a) Transfect the eukaryotic host cells using the following method: o The first plasmid contains a polynucleotide that serves as an expression cassette, encoding a DNA molecule that encodes the recombinant MOPV L fragment; o The second plasmid contains a polynucleotide that serves as an expression cassette, encoding a DNA molecule that encodes the recombinant MOPV S fragment; o An expression cassette for the MOPV L protein, wherein, in particular, the expression cassette is contained in a third plasmid; and o An expression cassette for the NP protein of Lassa virus or MOPV, wherein in particular the expression cassette is contained in a fourth plasmid; The first plasmid and / or the second plasmid comprises a nucleic acid construct according to any one of claims 1 to 6, which comprises a polynucleotide encoding at least one polypeptide or protein heterologous to MOPV, and b) Allows for the formation of ribonucleoproteins of recombinant MOPV, thereby enabling the expression of recombinant attenuated live virus particle assemblies, and simultaneously enabling the expression of at least one polypeptide or protein encoded by the polynucleotides of the first plasmid and / or the second plasmid; and c) Recover the expressed polypeptide or protein, and optionally recover the recombinant attenuated live Mopeia virus generated after step b).

10. The method of claim 9, wherein the first plasmid comprises a nucleic acid construct according to any one of claims 1, 2 or 6, encoding a recombinant L fragment of Mopeya virus (MOPV).

11. The method according to claim 9 or 10, wherein the second plasmid comprises a nucleic acid construct comprising a polynucleotide encoding a MOPV nucleoprotein (NP) having reduced exonuclease activity, particularly comprising an ORF of a MOPV nucleoprotein (NP) protein mutated by substitution of amino acid residues in the wild-type NP of Mopeya virus to have reduced exonuclease activity.

12. The method according to claim 9, 10, or 11, wherein the second plasmid comprises a nucleic acid construct according to any one of claims 3 to 6, encoding a recombinant S fragment of Mopea virus (MOPV), particularly a nucleic acid molecule encoding a recombinant chimeric S fragment of Mopea virus (MOPV), said fragment lacking the ORF of the glycoprotein precursor (GPC) of Mopea virus, and comprising the ORF of a GPC protein selected from the following New World arena viruses: Machupo virus (MACV), Sabya virus (SABV), Chapare virus (CHAPV), Junin virus (JUNV), Guanarito virus (GTOV), and Whitewater Arroyo virus, or the ORF of a GPC protein selected from the following Old World arena viruses: Lassa virus (LASV) and Lujo virus (LUJV).

13. The method according to any one of claims 9 to 12, wherein the first plasmid and the second plasmid each comprise a nucleic acid construct comprising a polynucleotide encoding a polypeptide or protein heterologous to MOPV.

14. The method according to any one of claims 9 to 13, wherein the eukaryotic host cell is a wild-type cell that stably expresses MOPV NP, particularly a wild-type VeroE6 cell that stably expresses MOPV NP.

15. A composition comprising viral particles obtained by the method according to any one of claims 9 to 14, particularly an immunogenic or vaccine composition, especially a composition that is immunogenic to at least one heterologous polypeptide or protein of MOPV, the polynucleotide sequence of which has been inserted into a plasmid comprising the same in the method according to any one of claims 9 to 14.

16. Virus particles obtained by the method according to any one of claims 9 to 14, or the composition according to claim 15, for use in: a. A means for inducing an immune response in a subject, particularly a protective immune response in a subject, especially against at least one heterologous polypeptide or protein of MOPV, the polynucleotide sequence of which has been inserted into a plasmid comprising the same in any one of claims 9 to 14; and / or b. As a medicine, particularly as a vaccine, especially for a condition caused or associated with at least one polypeptide or protein, or by an organism, particularly a pathogenic organism, the organism providing such a heterologous polypeptide or protein for MOPV, the polynucleotide sequence of which has been inserted into a plasmid comprising the same in any one of claims 9 to 14; and / or c. As a monovalent or multivalent, particularly bivalent, vaccine, especially for a disease caused or associated with at least one polypeptide or protein, or by an organism, particularly a pathogenic organism, the organism providing such a heterologous polypeptide or protein for MOPV, the polynucleotide sequence of which has been inserted into a plasmid comprising the same in any one of claims 9 to 14.

17. A set of nucleic acid constructs or expression cassettes or vectors containing them, wherein said set comprises at least: i. A nucleic acid construct or expression cassette or vector containing the same, encoding a recombinant L fragment of Mopeya virus (MOPV); and ii. A nucleic acid construct or expression cassette or vector containing the thereof, which encodes a recombinant S fragment of Mopeya virus (MOPV) that encodes a MOPV nucleoprotein (NP) with attenuated exonuclease activity. One or two nucleic acid constructs, expression cassettes, or vectors contain polynucleotides encoding polypeptides or proteins heterologous to MOPV, and when located on the S fragment, the latter differs from non-MOPV GPCs. in, Considering the 5' to 3' ends of the MOPV DNA fragment, the insertion position of the polynucleotide encoding at least one heterologous polypeptide or protein for MOPV in the nucleic acid construct, expression cassette, or vector is as follows: o On the MOPV L fragment, located between the 5' end of the MOPV Lpol protein and the 3' end of the MOPV Z protein; or o On the MOPV L fragment, located at the 5' end of the MOPV Lpol protein; or o is located at the 5' end of the MOPV NP in the MOPV S fragment, which has weakened exonuclease activity.

18. The group according to claim 17, wherein the nucleic acid construct or expression cassette or vector comprising it is defined as any one of claims 1 to 6.

19. Use of a set of nucleic acid constructs or expression cassettes or vectors comprising them as defined in any one of claims 17 to 18 for expressing one or more heterologous proteins or fragments thereof for Mopea virus (MOPV) in vitro or in vitro in eukaryotic host cells, and / or for generating recombinant attenuated live Mopea virus (MOPV) in vitro or in vitro in eukaryotic host cells.

20. Use of a set of nucleic acid constructs or expression cassettes or vectors comprising them as defined in any one of claims 17 to 18 in the method according to any one of claims 9 to 14.

21. Cell lines derived from said cell lines, wherein said cell lines are the VERO-NP cell lines deposited at CNCM on February 2, 2024, with accession number CNCM I-6034, or variant cell lines derived therefrom, which retain the characteristics of the parent I-6034 cell line.

Images