Method for artificial breeding of wild kelp

Abstract

The present application relates to the technical field of artificial breeding of seaweed, and discloses a wild kelp artificial breeding method, which comprises the following steps: screening high-temperature-resistant individuals from a wild population as seed kelp by using a molecular marker assisted screening technology, releasing and collecting spore water after the seed kelp is subjected to gradient salt reduction domestication treatment, inoculating the spore water into a breeding device coated with an adhesion promoter, sequentially performing photoperiod induction under red light and white light conditions, promoting gametophyte development to form young sporophytes, simultaneously adding diatom inhibitors and performing intermittent water flow stimulation on the young sporophytes for stage high-temperature stress training, and after the young seedlings cultivated to a release specification are subjected to temperature reduction training, the young seedlings are transported to a temporary sea area in a low-temperature and moisture state. The present application can precisely screen high-temperature-resistant germplasm by using a molecular marker, and integrates gradient salt reduction domestication, light quality regulation, high-temperature training and diatom inhibition technology, so that the high-temperature resistance, adhesion rate and release quality of kelp seedlings are significantly improved.

Description

Technical Field

[0001] This invention relates to the field of seaweed artificial seedling technology, and in particular to a method for artificially propagating wild kelp. Background Technology

[0002] Currently, the artificial breeding of kelp relies mainly on artificially bred varieties or randomly collected kelp from natural populations. There is a lack of precise screening methods for germplasm resources. Traditional seedlings are prone to whitening and rotting during the high temperatures of summer, which affects the success rate of seedling breeding and the benefits of aquaculture. Existing technologies lack methods for screening heat-resistant germplasm, making it impossible to efficiently identify and utilize superior genotypes from wild populations.

[0003] In the kelp spore release and attachment stage, traditional methods often involve releasing and collecting spores in a single process. This results in low spore viability, uneven attachment, and does not take into account the adaptation training of kelp seedlings in low-salt environments. The spores are easily affected by environmental fluctuations during the release process, leading to unstable spore quality and consequently affecting the subsequent seedling cultivation effect. Existing technologies have failed to systematically optimize the physiological induction process before spore release and lack methods to activate the osmotic pressure regulation mechanism of spore somatic cells.

[0004] During the young sporophyte cultivation stage, existing technologies generally employ constant light and temperature conditions, without fully considering the regulatory role of light quality and photoperiod on gametophyte development. This results in asynchronous gametophyte development and a low young sporophyte formation rate. Furthermore, traditional methods often rely on passive adaptation to high-temperature stress, lacking an active mechanism to induce heat tolerance training.

[0005] Diatom contamination is a long-standing technical challenge in kelp seedling cultivation. Traditional methods often employ chemical algaecides or physical cleaning, but these methods can easily damage or inhibit the growth of young sporophytes. In addition, poor water flow in the seedling ponds leads to uneven heat exchange and accumulation of metabolic waste, affecting the health of the seedlings. Current technologies have not yet established a comprehensive seedling management system that integrates high-temperature training, diatom inhibition, and water flow stimulation. Summary of the Invention

[0006] The purpose of this invention is to provide a method for the artificial propagation of wild kelp in order to solve the problems in the prior art.

[0007] To achieve the above objectives, the present invention adopts the following technical solution: a method for artificially propagating wild kelp, comprising the following steps: S1 uses molecular marker-assisted screening technology to select heat-resistant individuals from wild kelp populations as broodstock, which are then washed and air-dried. S2, after the kelp seed has been dried in the shade, it is released into seawater. The first release solution is discarded, fresh seawater is replaced and a gradient desalination and acclimatization treatment is carried out. Then, a second release is carried out and the second release solution is collected as spore water for seedling cultivation. S3, the spore water is inoculated onto the seedling device coated with an adhesion promoter, and vegetative growth is carried out under red light conditions and photoperiodic induction under white light conditions in turn to promote the development of gametophytes into young sporophytes; S4, the young sporophytes were subjected to phased high temperature stress training in the seedling pond, while diatom inhibitors were added and intermittent water flow stimulation was applied; S5 seedlings that have been cultivated to the specifications for shipment are cooled and hardened, and then transported to the sea temporary holding area for intermediate cultivation in a low-temperature and moisturized manner.

[0008] The beneficial effects of the technical solution provided by this invention include at least the following: This invention introduces molecular marker-assisted screening technology and, based on the positive correlation between HSP gene copy number and heat resistance trait, accurately screens heat-resistant kelp species from wild kelp populations. This method overcomes the limitations of traditional phenotypic selection and enables the identification and utilization of recessive superior genotypes, laying a genetic foundation for subsequent high-temperature seedling cultivation and effectively addressing the challenges of rising sea temperatures to seedling cultivation.

[0009] This invention introduces a spore collection method that combines gradient salt reduction acclimatization with secondary release. For the first time, it introduces low-salt adaptation training before spore release, activates the osmotic pressure regulation mechanism of spore somatic cells, significantly improves spore viability and synchronous release rate, and enhances the spore's adaptability to subsequent environmental fluctuations.

[0010] This invention achieves efficient transformation of gametophytes into young sporophytes through a photoperiod regulation strategy that uses red light to induce vegetative growth and white light to induce reproductive development. This significantly increases the attachment density and synchronous development rate of young sporophytes, fills the gap in the application of light quality regulation in kelp seedling cultivation, and improves seedling efficiency and uniformity.

[0011] This invention constructs a three-in-one seedling management system integrating phased high-temperature stress training, selective inhibition of diatoms, and intermittent water flow stimulation. Through progressive high-temperature training, the expression of heat shock proteins in young sporophytes is induced, solidifying their heat tolerance. Germanium dioxide is used to selectively inhibit rhomboid algae to avoid competition from other algae. Combined with water flow stimulation to simulate a natural tidal environment, heat exchange and metabolic waste removal are enhanced. This integrated technology significantly improves the stress resistance and quality of seedlings before they are delivered, shortens the seedling cycle, and reduces the risk of disease, and has significant industrial application value. Attached Figure Description

[0012] To more clearly illustrate the technical solutions and advantages in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0013] Figure 1 This is a flowchart of a method provided in an embodiment of the present invention. Detailed Implementation

[0014] To further illustrate the technical means and effects adopted by the present invention to achieve its intended purpose, the following, in conjunction with the accompanying drawings and preferred embodiments, details the specific implementation, structure, features, and effects of a method for artificially propagating wild kelp according to the present invention. In the following description, different "one embodiment" or "another embodiment" do not necessarily refer to the same embodiment. Furthermore, specific features, structures, or characteristics in one or more embodiments can be combined in any suitable form.

[0015] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0016] The following examples are for illustrative purposes only and are not intended to limit the scope of the invention.

[0017] The following description, in conjunction with the accompanying drawings, details a specific scheme for an artificial breeding method of wild kelp provided by the present invention.

[0018] Please see Figure 1 The diagram illustrates a method flowchart for the artificial propagation of wild kelp according to an embodiment of the present invention, the method comprising the following steps: S1 uses molecular marker-assisted screening technology to select heat-resistant individuals from wild kelp populations as broodstock, which are then washed and air-dried. S2, after the kelp seed has been dried in the shade, it is released into seawater. The first release solution is discarded, fresh seawater is replaced and a gradient desalination and acclimatization treatment is carried out. Then, a second release is carried out and the second release solution is collected as spore water for seedling cultivation. S3, the spore water is inoculated onto the seedling device coated with an adhesion promoter, and vegetative growth is carried out under red light conditions and photoperiodic induction under white light conditions in turn to promote the development of gametophytes into young sporophytes; S4, the young sporophytes were subjected to phased high temperature stress training in the seedling pond, while diatom inhibitors were added and intermittent water flow stimulation was applied; S5 seedlings that have been cultivated to the specifications for shipment are cooled and hardened, and then transported to the sea temporary holding area for intermediate cultivation in a low-temperature and moisturized manner.

[0019] In one embodiment of the present invention, molecular marker-assisted screening technology is used to screen heat-resistant individuals from wild kelp populations as broodstock, and the steps of washing and air-drying include: Using the single-copy trehalose synthase gene TPS in the kelp genome as an internal standard, the copy number of the heat shock protein HSP gene in known heat-resistant kelp varieties and common kelp varieties was detected by real-time quantitative PCR. The copy number ratio of HSP gene to TPS gene was calculated based on the detection results, and a positive correlation standard between HSP gene copy number and heat resistance trait was established. Genomic DNA was extracted from wild kelp individuals to be screened. The copy number of HSP gene in each individual was detected by the same real-time quantitative PCR technology. Based on the positive correlation between HSP gene copy number and heat resistance trait, individuals with HSP gene copy number more than twice the average level of the general population were selected as candidate heat-resistant kelp species. The sporangium development status of the selected heat-resistant candidates was tested, and individuals with well-developed sporangia were selected as the final kelp species. After washing with seawater to remove surface attachments, the kelp was air-dried.

[0020] The steps for establishing a positive correlation standard between HSP gene copy number and heat resistance trait include: Specific fluorescent quantitative PCR primers and TaqMan probes were designed based on the conserved region of the heat shock protein HSP gene, and internal standard primers and probes were designed based on the conserved region of the trehalose synthase TPS gene. Genomic DNA was extracted from kelp, serially diluted, and used as a template. Quantitative real-time PCR was performed using HSP gene primers and probes to establish a copy number standard curve for the HSP gene. At the same time, a standard curve for the TPS internal control gene was established using the same method. Genomic DNA was extracted from known heat-resistant kelp varieties and common kelp varieties, respectively. The initial template numbers of the HSP gene and TPS gene were simultaneously detected in the same real-time PCR reaction system. The absolute copy number of the HSP gene was calculated based on the known single copy number of the TPS gene. The association threshold between the HSP gene copy number and the heat resistance trait was determined by statistical analysis.

[0021] It should be noted that in this embodiment, a total of 100 kelp plants were collected from a wild kelp population in a certain coastal sea area, numbered W01 to W100. Known heat-resistant kelp varieties and known common kelp varieties without heat-resistant traits were used as control varieties.

[0022] The reagents and instruments to be prepared include: plant genomic DNA extraction kit, SYBR Green or TaqMan real-time PCR premix, real-time PCR instrument, specific primers and TaqMan probes.

[0023] First, establish standards for HSP gene copy number detection, including the selection of target genes: Target gene: Heat shock protein gene HSP (such as HSP70 or HSP90 family members), corresponding primer and probe design includes: HSP70-F: 5'- TGAAGGCTAACCGATCCACG -3'; HSP70-R: 5'-AGTCTTCACCTGCGTGTTCC-3'; HSP70-Probe: 5'-FAM-TGACCAGGAGACCAAGGACGCA-BHQ1 -3'; Internal reference gene: Trehalose synthase gene TPS. This gene is a single copy in the kelp genome and is suitable for absolute copy number quantification. The corresponding primer and probe design includes: TPS-F: 5'- GGACGAGCTGAAGAAGGTGA -3'; TPS-R: 5'- GGTGAAGTCGTCGAAGAACG -3'; TPS-Probe: 5'- HEX-CAACATCACCGCCAACCTCTCC-BHQ1 -3'; Genomic DNA was extracted from common kelp, which is known to lack heat resistance. After determining the concentration, it was serially diluted 10-fold. A typical dilution gradient example is: 100 ng / μL, 10 ng / μL, 1 ng / μL, 0.1 ng / μL. qPCR amplification was performed using primers / probes for HSP70 and TPS, respectively, and a standard curve was established for Ct value versus template concentration. Subsequently, genomic DNA was extracted from 10 known heat-resistant kelp and 10 known common kelp without heat resistance, respectively, and the initial template amounts of HSP70 and TPS were detected in the same qPCR reaction plate.

[0024] Based on the characteristic that TPS is a single copy, calculate the HSP70 copy number: HSP70 copy number = (HSP70 starting template size / TPS starting template size).

[0025] Assuming the statistical results show that the average copy number of heat-resistant kelp HSP70 is A±μ, and the average copy number of ordinary kelp without heat resistance is B±μ (where μ is the error between 0 and 1), if A≥2B (i.e. more than twice the average of the ordinary population), then ≥2B will be used as the threshold standard for screening heat-resistant candidate individuals.

[0026] Subsequently, approximately 50 mg of tender tissue was collected from 100 wild kelp individuals numbered W01 to W100. After grinding with liquid nitrogen, total DNA was extracted using a plant genomic DNA extraction kit and used as the test sample. The DNA was confirmed to be intact and undegraded by agarose gel electrophoresis and spectrophotometry.

[0027] The DNA samples to be tested were diluted to a uniform concentration (e.g., 20 ng / μL). Using the established standard curve and primer probes, the amount of HSP70 and TPS gene starting templates in each sample was detected, and the absolute copy number of HSP70 in each sample was calculated. Based on the detection and calculation results, individuals with HSP70 copy number ≥2B were screened and marked as candidate individuals.

[0028] The candidate individuals were visually inspected, with a focus on observing the color, ridges, and distribution density of the sporangium area (lower part of the leaf). The sporangium cross-section was observed using a microscope (10× or 20× magnification) to confirm whether the sporangium cells were plump, highly mature, and free from vacuolization or pathogen infection. Based on the results of molecular marker screening and sporangium development testing, individuals with well-developed sporangia, even distribution, and dark brown color were selected as the final kelp seed for this breeding project.

[0029] Place the selected kelp in clean seawater and gently brush the surface with a soft brush to remove attached mud, algae, and zooplankton. The washing time should be controlled within 5 minutes to avoid damaging the sporangia. After washing, hang the kelp in a cool, ventilated place with a temperature ≤18℃ and humidity of 70%~80% to air dry for 6~8 hours, until the surface moisture disappears and the kelp softens but is not completely dry, in order to stimulate the concentration and release of spores.

[0030] In one embodiment of the present invention, the steps of releasing the air-dried kelp seed into seawater, discarding the initial release solution, replacing it with fresh seawater and subjecting it to gradient desalination and acclimatization treatment, followed by a second release, and collecting the second release solution as spore water for seedling cultivation include: After the kelp has been dried, place it in seawater with a salinity of 25% and let it stand at 10-12℃ for 30-60 minutes to release the liquid. Collect and discard the first release liquid. The kelp seedlings that have completed the first release were placed in acclimatized seawater with decreasing salinity gradients, and maintained in each salinity gradient for 2-4 hours to induce the sporophyte cells to establish a low-salt osmotic pressure regulation mechanism. The kelp seedlings that have completed the gradient salinity reduction acclimatization were transferred to fresh seawater with a salinity of 25%. The spores were stimulated by raising the temperature to 15-18℃. The secondary release liquid was collected, filtered through a silk screen, and used as spore water for seedling cultivation.

[0031] The steps involved in placing the kelp seedlings that had completed their initial release into acclimatized seawater with decreasing salinity gradients for phased adaptation include: First-gradient adaptation: Place the kelp seed in seawater with a salinity of 22% for 2-4 hours to promote the sporophyte cells to initially sense the salinity change and initiate an osmotic pressure regulation response; Second-gradient adaptation: The kelp seed was transferred to seawater with a salinity of 20% and kept in it for 2-4 hours to induce the sporophyte cells to synthesize osmotic regulating substances; The third acclimatization step: The kelp seedlings are transferred to seawater with a salinity of 18% and kept in the water for 2-4 hours to complete the low-salinity environment adaptation training.

[0032] It should be noted that in this embodiment, natural seawater was treated by sedimentation and sand filtration, adjusted to a base salinity of 30%, and further adjusted to acclimatized seawater with the following salinity gradient decreasing: 25% acclimatized seawater: Take seawater with basic salinity and mix it with fresh water at a volume ratio of 5:1; 22% acclimatized seawater: 25% seawater and freshwater mixed at a volume ratio of 22:3; 20% acclimatized seawater: 25% seawater and freshwater mixed at a volume ratio of 4:1; 18% acclimatized seawater: 25% seawater and freshwater mixed at a volume ratio of 18:7; All seawater was filtered through a 0.45μm filter membrane before use, sterilized at 121℃ for 20 minutes, and then cooled for later use.

[0033] Take N 1000mL sterile beakers (N is the number of selected kelp species) and label them with the selected kelp species numbers. Add 800mL of 25% salinity seawater to each beaker and place the beakers in a constant temperature incubator with the temperature set at 11℃±0.5℃.

[0034] Place the air-dried kelp seedlings (approximately 30g per seedling) into their respective beakers, ensuring the sporangium area is completely submerged. Gently press with sterile tweezers to remove any attached air bubbles, and allow to stand for 45 minutes (the median range is 30-60 minutes). After 45 minutes, remove the kelp seedlings with sterile tweezers and temporarily place them in a sterile petri dish. Cover with a damp gauze to prevent drying. Discard all of the initial release solution. Rinse the beakers with sterile seawater and set aside for later use.

[0035] Prepare acclimatized seawater with salinities of 22%, 20%, and 18%, dispense 800 mL of each solution into sterile beakers, and place them in an 11°C incubator to equilibrate the temperature. The kelp seedlings that have completed the first release were transferred to 22% acclimatized seawater and kept at a constant temperature of 11°C for 3 hours (range 2-4 hours). A small amount of water was taken for microscopic observation. It was found that the sporangia were not obviously released and a small number of spores were moving slowly, indicating that they were adapting to the hypotonic environment. Three hours later, the kelp seed was transferred to 20% seawater and kept at a constant temperature of 11°C for 3 hours. A small amount of water was taken for microscopic observation. It was observed that the number of spores in the water increased slightly, and the spores moved at a slower speed but were still viable. Three hours later, the kelp was transferred to 18% seawater and kept at a constant temperature of 11°C for 3 hours. A small amount of water was taken for microscopic observation. It was observed that the number of spores in the water increased and the spores were more active than when the concentration was 20%, indicating that the low-salt adaptation had been completed.

[0036] In addition, after each gradient acclimatization, a small amount of kelp sporangium tissue was taken, prepared and examined under a microscope. If the sporangium cells showed no obvious plasmolysis and the cell structure was intact, it indicated that the acclimatization process did not cause damage. The entire acclimatization process lasted 9 hours (3 gradients × 3 hours) and was carried out in an environment simulating natural light and darkness.

[0037] Prepare 3 new beakers and add 800 mL of 25% sterilized seawater. Place the beakers in a constant temperature incubator and set the temperature to 16℃ (range 15~18℃). Remove the seed kelp that has completed gradient acclimatization from the 18% seawater and quickly transfer it to the 16℃ 25% seawater. Let it stand for 60 minutes to induce spore concentration and release in large quantities.

[0038] During the release process, observations were conducted. After about 10 minutes, the water began to become turbid and light brown. After about 30 minutes, the water turned distinctly brown, and microscopic examination revealed a large number of active zoospores. After about 60 minutes, the water turned dark brown, and the spore density reached its peak. At this point, the kelp seed was removed with sterile forceps, and the release solution was filtered through a 200-mesh sieve (75 μm pore size). The secondary release solutions from different kelp species were combined, with a total volume of about 2400 mL. One mL of this solution was used to assess spore viability by observing the movement under a microscope. If the proportion of zoospores was >85%, the viability was good and it could be used for subsequent inoculation. If the spore viability was <70%, it was recommended to release the kelp again or check the instruments and experimental environment.

[0039] The collected spore water (secondary release solution) should be temporarily stored at 4°C and used up within 12 hours. If short-term storage is required, 1% EDTA solution can be added to prevent spore aggregation.

[0040] In one embodiment of the present invention, the steps of inoculating spore water onto a seedling device coated with an adhesion promoter, and sequentially performing vegetative growth under red light conditions and photoperiodic induction under white light conditions to promote the development of gametophytes into young sporophytes include: The spore water is evenly inoculated onto the surface of the seedling device coated with an adhesion promoter by spraying. The seedling device is then left to stand in the dark at a temperature of 12-15℃ for 12-24 hours to allow the spores to attach and germinate into embryos. The seedlings with attached embryos were transferred to a red light source for cultivation. The light intensity was controlled at 20-30 μmol photons m⁻²·s⁻¹ and the temperature at 12-15℃. The gametophyte density was monitored regularly during the cultivation period. When the gametophyte density reaches a predetermined threshold, the light source is switched to white light, the light intensity is adjusted to 30~40 μmol photonsm⁻²·s⁻¹, the temperature is 12~15℃, and the photoperiod is controlled to be 10 hours of light and 14 hours of darkness, inducing the gametophytes to complete fertilization and develop into young sporophytes.

[0041] It should be noted that the spore water used in this embodiment is temporarily stored at 4°C and restored to 12°C before use. The seedling device is a seedling curtain woven from polyethylene rope (50cm long × 30cm wide) or a brown rope seedling device (3mm diameter brown rope, wrapped around the frame). The adhesion promoter is prepared as a 0.5% sodium alginate solution (w / v). After preparation, it is sterilized at 121°C for 20 minutes, cooled, and then evenly sprayed onto the surface of the seedling device. It is then allowed to air dry to form a coating layer. The coated seedling device is then irradiated with ultraviolet light for 30 minutes to ensure sterility.

[0042] This embodiment uses a constant temperature and light incubator, including a controllable LED light source and a quantum meter. The basic culture medium is filtered and sterilized seawater with added nutrients (N 6.0 mg / L, P 1.0 mg / L). Before use, it is filtered through a 0.22 μm filter membrane and equilibrated at 12°C.

[0043] In this embodiment, the target inoculation density of spore water is 0.090 mg DW m⁻¹ (dry weight per meter of seedling tray). The required volume of spore water is calculated based on the spore density. For example, if the spore density is 3.2 × 10⁻¹... 6 If the spore count is 1 / mL and the surface area of ​​each seedling tray is approximately 0.1 m², then approximately 9 × 10⁶ spores are needed. 6 Count, required spore water volume = 9 × 10 6 ÷3.2×10 6 ≈2.8 mL / meter. In this example, the total length of the seedling tray is 5 meters, so about 14 mL of spore water is required.

[0044] Take 14 mL of spore water and put it into a sterile sprayer (20 mL capacity, 0.3 mm nozzle diameter). Place the seedling tray coated with adhesion promoter on a sterile operating table. Keep the nozzle of the sterile sprayer 20 cm away from the surface of the seedling tray and spray evenly at a 45° angle. Gently turn the seedling tray during the spraying process to allow the spore water to penetrate into the internal fibers. After spraying, it is best to keep the surface of the seedling tray moist but not dripping water.

[0045] After inoculation, the seedling device was transferred to a sterile culture container. Basic culture medium was added to completely submerge the seedling device. The container was covered with a black light-blocking cloth to ensure complete protection from light. The incubator temperature was set to 13℃ (range 12~15℃), and the device was incubated statically for 18 hours (range 12~24 hours). Under dark conditions, the spores are not stimulated by light and can successfully complete attachment and germination to form embryos. After 18 hours, a small amount of seedling device fiber was taken and observed under a microscope. It was observed that the embryos had attached to the fiber surface, and were round or oval in shape, with a diameter of about 5~8μm. Ten fields of view were randomly counted. If the average attachment density was 42±5 embryos / mm², it met the requirements for subsequent culture.

[0046] After the seedlings have been left to stand in the dark, transfer them to new culture containers. Add fresh basal culture medium and set the light source of the incubator to a red LED (wavelength 660nm), with a light intensity of 25μmol photons m⁻²·s⁻¹ (range 20~30, calibrated with a photometer), a temperature of 13℃ (range 12~15℃), and a photoperiod of 24 hours of continuous illumination. Under these conditions, the incubation period is 14~21 days. During this period, the culture medium is changed every 7 days, and the seedlings are turned upside down once. Observe daily for any algal contamination and deal with it promptly if any is found. In addition, during the cultivation process, approximately 1 cm of fiber was cut from different parts of the seedling device twice a week, observed under a microscope, and randomly counted in 10 fields of view to calculate the average gamete density (number of gametes / mm²).

[0047] When the gametophyte density is ≥120 gametophytes / mm², switch the incubator light source to white LED (full spectrum, 400-700nm), with a light intensity of 35μmol photons m⁻²·s⁻¹ (range 30~40), a temperature of 13℃ (consistent with the red light stage), and a photoperiod of 08:00~18:00 daily (10 hours of light) followed by 18:00~08:00 the next day (14 hours of darkness), for 10~14 days. Typically, on the 3rd day after the switch, microscopic examination reveals that the female gametophyte forms an egg sac (containing an egg cell), and the male gametophyte forms a sperm sac. On the 5th day, the egg cell is released and combines with the sperm to form a zygote. On the 7th day, the zygote begins to divide and forms a young sporophyte (2-4 cell stage). On the 10th day, the young sporophyte further develops. Around the 14th day, the length of the young sporophyte reaches 150-200 μm, and it can enter the high-temperature stress training stage.

[0048] In one embodiment of the present invention, the step of subjecting young sporophytes to staged high-temperature stress training in a seedling bed includes: During the first two weeks of seedling cultivation, maintain the water temperature at 12-15℃ to allow the young sporophytes to establish their physiological and metabolic basis. During the third to fourth week of seedling cultivation, the water temperature was raised to 18-20℃ and maintained for 2-4 hours daily, while the rest of the time was maintained at 12-15℃ to induce the young sporophytes to synthesize heat shock proteins and initially establish heat tolerance. From the fifth week onwards, perform a heat shock treatment at 22°C once a week for 1 to 2 hours each time, and maintain the temperature at 12 to 15°C for the rest of the time to solidify the established heat tolerance.

[0049] In addition, the process of subjecting young sporophytes to phased high-temperature stress training in the seedling pond also includes the application of intermittent water flow stimulation: The water flow velocity in the seedling tank is controlled at 0.1~0.3 m / s, and water flow stimulation is carried out in a cycle of 3 hours, including 2 hours of static culture and 1 hour of flowing culture. During the phased high-temperature stress training, i.e. the third week of seedling cultivation and beyond, intermittent water flow stimulation and water temperature rise / heat shock treatment were carried out simultaneously to enhance heat exchange efficiency by utilizing water flow, while simulating the tidal environment of natural sea areas.

[0050] It should be noted that during the first two weeks of seedling cultivation, the water temperature in the incubator was set to 13℃ (range 12-15℃, midpoint), and intermittent water flow was applied. The cultivation period was 14 days (first two weeks). During this period, the water temperature was checked daily to ensure it remained stable at 13±0.5℃. Samples were taken every three days to observe the growth status of the young sporophytes and record changes in color and morphology. Some experimental results obtained in this example are as follows: Day 0 (initial): Sporophyte length 150~200μm, density 28 sporophytes / mm², Fv / Fm=0.72±0.03; Day 3: Sporophyte length 220~280μm, rhizoids elongated, Fv / Fm=0.73; Day 7: Sporophyte length 350~420μm, leaf differentiation begins, Fv / Fm=0.74; Day 10: Sporophyte length 500~600μm, leaf blades significantly widened, Fv / Fm=0.73; Day 14: Sporophyte length 750~850μm, density 32 sporophytes / mm² (a small number of new sporophytes), Fv / Fm=0.72.

[0051] Integration phase goals achieved: The young sporophytes have completed the establishment of basic metabolism, the chlorophyll fluorescence activity is stable, the average length reaches 800 μm, and they have preliminary stress tolerance, and can enter the next stage of high temperature induction training.

[0052] In this embodiment, the high-temperature induction training program is designed as follows: the base water temperature is 13℃ (maintained for 14 hours / day), high-temperature treatment is carried out from 14:00 to 17:00 every day, the water temperature is raised to 19℃ (range 18~20℃, take the median value) and maintained for 3 hours (range 2~4 hours), the culture cycle is 14 days (3rd to 4th week), the heating rate is about 2℃ / hour, the preheating starts at 11:00 every day, the actual heating time is about 3 hours to complete the heating, the water temperature is stabilized at 19±0.5℃ from 14:00 to 17:00 for 3 hours, the temperature is naturally cooled or assisted to 13℃ from 17:00 to 20:00, and the basic culture is maintained at 13℃ from 20:00 to 11:00 the next day; During the high-temperature induction training, a small number of young sporophytes were collected before each high-temperature treatment (13:30), immediately after treatment (17:30), and 4 hours after treatment (21:30). Total protein was extracted and HSP70 expression levels were detected. Some experimental results obtained in this example are as follows: Before treatment: HSP70 expression level was low (relative value 0.12); After treatment: HSP70 expression level increased significantly (relative value 0.68); Four hours after treatment: HSP70 expression continued to increase (relative value 0.85); The test results showed that daily high temperature induction effectively activated the synthesis of heat shock proteins. In addition, after 21 days of high temperature induction training (one week after training), the sporophyte length was 1.1~1.3 mm, and the Fv / Fm recovered to 0.71 after high temperature.

[0053] High-temperature induction training continued for 28 days (2 weeks after training): sporophyte length 1.8~2.2mm, Fv / Fm stable at 0.70~0.73; The leaves were observed to be bright brown with no whitening or tip ulceration. 500 sporophytes were randomly counted, and the complete whitening rate (i.e. mortality rate) was <3%. The test results showed that the young sporophytes had initially established heat tolerance, and their photosynthetic activity recovered well after high-temperature treatment with no cumulative damage. They can enter the next stage of high-temperature curing training.

[0054] In this embodiment, the high-temperature curing training program is designed as follows: the base water temperature is 13℃ (maintained for 6 days / week), and heat shock treatment is carried out every Friday from 14:00 to 15:30, each time for 1.5 hours (range 1~2 hours), and the cultivation cycle is from the 5th week to the time of delivery (8th~9th week). The heat shock treatment procedure includes: preheating starting at 11:00, with a heating rate of approximately 3℃ / hour, reaching 22℃ at 13:30; maintaining a stable water temperature of 22±0.5℃ from 14:00 to 15:30 for 1.5 hours; and then naturally or assisted cooling to 13℃ from 15:30 to 17:30. After the heat shock, the water is maintained at 13℃ until the following Friday. Some experimental results obtained in this example are as follows: After the first treatment in week 5 (day 35), the relative expression level of HSP70 was 0.92, which was 9.2 times higher than the baseline value (0.10). 24 hours after treatment, Fv / Fm recovered to 0.71 (0.73 before treatment). After the second treatment in week 6 (day 42), the relative value of HSP70 expression was 0.95, maintaining a high level. 12 hours after treatment, Fv / Fm recovered to 0.70 (0.72 before treatment). After the third treatment in week 7 (day 49), the relative value of HSP70 expression was 0.93, indicating that tolerance had been solidified. Fv / Fm decreased by only 5% after treatment and fully recovered within 4 hours.

[0055] In addition, during the high-temperature curing training, on day 35 (early week 5): the sporophyte length was 2.5~3.0 mm and the density was 35 sporophytes / mm²; on day 42 (week 6): the sporophyte length was 3.5~4.2 mm and the leaf width was 1.0~1.2 mm; on day 49 (week 7): the sporophyte length was 5.0~6.0 mm and the density stabilized at 33 sporophytes / mm²; and on day 56 (week 8): the sporophyte length was 7.0~8.5 mm, reaching the specifications for delivery (2~3 cm, i.e., 20~30 mm).

[0056] In one embodiment of the present invention, the process of subjecting young sporophytes to staged high-temperature stress training in a seedling pond also includes the step of adding diatom inhibitors: Based on the selective inhibition effect of rhomboid algae and kelp larvae, germanium dioxide solutions with a concentration of 5-15 mg / L were prepared. During the phased high temperature stress training period, that is, from the third week of seedling cultivation onwards, germanium dioxide solution was evenly added to the seedling pond water to inhibit the photosynthesis of rhomboid algae. Change the seawater in the nursery pond every 5-7 days and add germanium dioxide solution again.

[0057] It should be noted that germanium dioxide forms germanic acid in water, which can competitively inhibit the silica transporter protein of diatoms. Diatoms need silica to build their cell walls (siliceous shells). Germanic acid has a similar structure to silica and can block the absorption of silicon. Brown algae such as kelp do not need silica to build their cell walls, so they are not sensitive to germanium dioxide and have a selective inhibitory effect. A germanium dioxide solution of 5-15 mg / L can effectively inhibit the growth of common diatoms such as Rhizophora natans. At the same time, a germanium dioxide solution of <20 mg / L has no obvious toxicity to kelp larvae. In this embodiment, an intermediate concentration of 10 mg / L was selected as the working concentration.

[0058] In one embodiment of the present invention, the step of cooling and hardening off seedlings cultivated to the required size for shipment, followed by low-temperature and moisturizing transportation to a marine temporary holding area for intermediate cultivation, includes: The growth status of seedlings in the seedling rearing pond is monitored. Seedlings with a sporophyte length of 2-3 cm, a bright brown color, no white rot at the tip, and no attached algae are selected as seedlings to be released from the warehouse. At the same time, the water temperature in the marine temporary rearing area is monitored. The release procedure is started when the natural sea water temperature stabilizes and drops below 19℃. The water temperature in the seedling nursery where the seedlings to be shipped out is gradually reduced from the basic cultivation temperature to 10℃ at a rate of 1-2℃ per day, so that the seedlings enter a semi-dormant state and complete the cooling hardening process. After the seedlings have completed the cooling process, they are removed from the seedling pond and sealed. The sealed seedling bags are then placed in a cold storage and heat preservation box for transportation. During transportation, the temperature inside the box is maintained between 4 and 8°C until the seedlings arrive at the temporary holding area at sea.

[0059] It should be noted that, in this embodiment, the seedling specifications inspection upon leaving the warehouse includes: randomly selecting 3 sampling points from each seedling device, measuring the length of 10 young sporophytes at each sampling point (using a ruler or vernier caliper to measure from the base of the pseudoroot to the tip of the leaf), observing the color with the naked eye, and checking with a microscope whether there is white rot at the tip and whether there is any algae attached to the surface, in accordance with the standard color chart. If the seedlings in the seedling incubator are 2.2-3.5 cm long (average 2.8 cm), have a bright brown color, and occasionally have slightly lighter color but no disease spots, no white rot at the tips, and occasionally a small number of rhomboid algae (<0.1×10³ cells / cm²), then the seedling incubator is considered to meet the release standard.

[0060] The above-described embodiments are only used to illustrate the technical solutions of this application, and are not intended to limit them. Although this application has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of this application, and should all be included within the protection scope of this application.

Claims

1. A method for artificially propagating wild kelp, characterized in that, The method includes: S1 uses molecular marker-assisted screening technology to select heat-resistant individuals from wild kelp populations as broodstock, which are then washed and air-dried. S2, after the kelp seed has been dried in the shade, it is released into seawater. The first release solution is discarded, fresh seawater is replaced and a gradient desalination and acclimatization treatment is carried out. Then, a second release is carried out and the second release solution is collected as spore water for seedling cultivation. S3, the spore water is inoculated onto the seedling device coated with an adhesion promoter, and vegetative growth is carried out under red light conditions and photoperiodic induction under white light conditions in turn to promote the development of gametophytes into young sporophytes; S4, the young sporophytes were subjected to phased high temperature stress training in the seedling pond, while diatom inhibitors were added and intermittent water flow stimulation was applied; S5 seedlings that have been cultivated to the required specifications for shipment are cooled and hardened, and then transported to a temporary sea-based rearing area for intermediate cultivation under low temperature and humidity conditions.

2. The method for artificially propagating wild kelp according to claim 1, characterized in that: The step of using molecular marker-assisted screening technology to select heat-resistant individuals from wild kelp populations as broodstock, followed by washing and air-drying, includes: Using the single-copy trehalose synthase gene TPS in the kelp genome as an internal standard, the copy number of the heat shock protein HSP gene in known heat-resistant kelp varieties and common kelp varieties was detected by real-time quantitative PCR. The copy number ratio of HSP gene to TPS gene was calculated based on the detection results, and a positive correlation standard between HSP gene copy number and heat resistance trait was established. Genomic DNA was extracted from wild kelp individuals to be screened. The copy number of the HSP gene in each individual was detected using the same real-time quantitative PCR technology. Based on the positive correlation between the HSP gene copy number and the heat resistance trait, individuals with HSP gene copy numbers more than twice the average level of the general population were selected as candidate heat-resistant kelp species. The sporangium development status of the selected heat-resistant candidates was tested, and individuals with well-developed sporangia were selected as the final kelp species. After washing with seawater to remove surface attachments, the kelp was air-dried.

3. The method for artificially propagating wild kelp according to claim 2, characterized in that: The steps for establishing the positive correlation standard between HSP gene copy number and heat resistance trait include: Specific fluorescent quantitative PCR primers and TaqMan probes were designed based on the conserved region of the heat shock protein HSP gene, and internal standard primers and probes were designed based on the conserved region of the trehalose synthase TPS gene. Genomic DNA was extracted from kelp, serially diluted, and used as a template. Quantitative real-time PCR was performed using HSP gene primers and probes to establish a copy number standard curve for the HSP gene. At the same time, a standard curve for the TPS internal control gene was established using the same method. Genomic DNA was extracted from known heat-resistant kelp varieties and common kelp varieties, respectively. The initial template numbers of the HSP gene and TPS gene were simultaneously detected in the same real-time PCR reaction system. The absolute copy number of the HSP gene was calculated based on the known single copy number of the TPS gene. The association threshold between the HSP gene copy number and the heat resistance trait was determined by statistical analysis.

4. The method for artificially propagating wild kelp according to claim 1, characterized in that: The steps of releasing the air-dried kelp seed into seawater, discarding the initial release solution, replacing it with fresh seawater and subjecting it to gradient desalination and acclimatization treatment, followed by a second release, and collecting the second release solution as spore water for seedling cultivation include: After the kelp has been dried, place it in seawater with a salinity of 25% and let it stand at 10-12℃ for 30-60 minutes to release the liquid. Collect and discard the first release liquid. The kelp seedlings that have completed the first release were placed in acclimatized seawater with decreasing salinity gradients, and maintained in each salinity gradient for 2-4 hours to induce the sporophyte cells to establish a low-salt osmotic pressure regulation mechanism. The kelp seedlings that have completed the gradient salinity reduction acclimatization were transferred to fresh seawater with a salinity of 25%. The spores were stimulated by raising the temperature to 15-18℃. The secondary release liquid was collected, filtered through a silk screen, and used as spore water for seedling cultivation.

5. The method for artificially propagating wild kelp according to claim 4, characterized in that: The step of placing the kelp seedlings that have completed their initial release into acclimatized seawater with decreasing salinity gradients for phased adaptation includes: First-gradient adaptation: Place the kelp seed in seawater with a salinity of 22% for 2-4 hours to promote the sporophyte cells to initially sense the salinity change and initiate an osmotic pressure regulation response; Second-gradient adaptation: The kelp seed was transferred to seawater with a salinity of 20% and kept in it for 2-4 hours to induce the sporophyte cells to synthesize osmotic regulating substances; The third acclimatization step: The kelp seedlings are transferred to seawater with a salinity of 18% and kept in the water for 2-4 hours to complete the low-salinity environment adaptation training.

6. The method for artificially propagating wild kelp according to claim 1, characterized in that: The steps of inoculating spore water onto a seedling device coated with an adhesion promoter, and sequentially performing vegetative growth under red light and photoperiodic induction under white light to promote the development of gametophytes into young sporophytes include: The spore water is evenly inoculated onto the surface of a seedling device coated with an adhesion promoter by spraying. The seedling device is then left to stand in the dark at a temperature of 12-15℃ for 12-24 hours to allow the spores to attach and germinate into embryos. The seedlings with attached embryos were transferred to a red light source for cultivation. The light intensity was controlled at 20-30 μmol photons m⁻²·s⁻¹ and the temperature at 12-15℃. The gametophyte density was monitored regularly during the cultivation period. When the gametophyte density reaches a predetermined threshold, the light source is switched to white light, the light intensity is adjusted to 30~40 μmol photons m⁻²·s⁻¹, the temperature is 12~15℃, and the photoperiod is controlled to be 10 hours of light and 14 hours of darkness, inducing the gametophytes to complete fertilization and develop into young sporophytes.

7. The method for artificially propagating wild kelp according to claim 1, characterized in that: The steps for subjecting young sporophytes to staged high-temperature stress training in the seedling pond include: During the first two weeks of seedling cultivation, maintain the water temperature at 12-15℃ to allow the young sporophytes to establish their physiological and metabolic basis. During the third to fourth week of seedling cultivation, the water temperature was raised to 18-20℃ and maintained for 2-4 hours daily, while the rest of the time was maintained at 12-15℃ to induce the young sporophytes to synthesize heat shock proteins and initially establish heat tolerance. From the fifth week onwards, perform a heat shock treatment at 22°C once a week for 1 to 2 hours each time, and maintain the temperature at 12 to 15°C for the rest of the time to solidify the established heat tolerance.

8. The method for artificially propagating wild kelp according to claim 7, characterized in that: The process of subjecting young sporophytes to phased high-temperature stress training in the seedling pond also includes the step of adding diatom inhibitors: Based on the selective inhibition effect of rhomboid algae and kelp larvae, germanium dioxide solutions with a concentration of 5-15 mg / L were prepared. During the phased high-temperature stress training period, i.e. the third week of seedling cultivation and thereafter, the germanium dioxide solution was uniformly added to the seedling pond water to inhibit the photosynthesis of rhomboid algae. Change the seawater in the nursery pond every 5-7 days and add germanium dioxide solution again.

9. The method for artificially propagating wild kelp according to claim 7, characterized in that: The process of subjecting young sporophytes to phased high-temperature stress training in the seedling pond also includes the step of applying intermittent water flow stimulation. The water flow velocity in the seedling tank is controlled at 0.1~0.3 m / s, and water flow stimulation is carried out in a cycle of 3 hours, including 2 hours of static culture and 1 hour of flowing culture. During the phased high-temperature stress training, i.e. the third week of seedling cultivation and beyond, intermittent water flow stimulation and water temperature rise / heat shock treatment were carried out simultaneously to enhance heat exchange efficiency by utilizing water flow, while simulating the tidal environment of natural sea areas.

10. The method for artificially propagating wild kelp according to claim 1, characterized in that: The steps of cooling and hardening off seedlings cultivated to the required size for shipment, followed by low-temperature and moisturizing transportation to a temporary marine rearing area for intermediate cultivation, include: The growth status of seedlings in the seedling rearing pond is monitored. Seedlings with a sporophyte length of 2-3 cm, a bright brown color, no white rot at the tip, and no attached algae are selected as seedlings to be released from the warehouse. At the same time, the water temperature in the marine temporary rearing area is monitored. The release procedure is started when the natural sea water temperature stabilizes and drops below 19℃. The water temperature in the seedling nursery where the seedlings to be shipped out is gradually reduced from the basic cultivation temperature to 10℃ at a rate of 1-2℃ per day, so that the seedlings enter a semi-dormant state and complete the cooling hardening process. After the seedlings have completed the cooling process, they are removed from the seedling pond and sealed. The sealed seedling bags are then placed in a cold storage and heat preservation box for transportation. During transportation, the temperature inside the box is maintained between 4 and 8°C until the seedlings arrive at the temporary holding area at sea.

Images