Imidazolyl acid responsive biomimetic lipid compound, and preparation method and application thereof

Abstract

The present application relates to a kind of imidazole base acid response type biomimetic lipid compound and its preparation method and application, imidazole base acid response type biomimetic lipid structure is designed to imitate natural phospholipid, different alkyl chain length dimethylamino is modified on 2 position of imidazole ring, and 1-N and 3-N of imidazole ring are respectively modified by aldehyde group and hydrazine group, form the imidazole base biomimetic lipid with acid response function.The imidazole base acid response type biomimetic lipid molecule can be crosslinked self-assembly by forming acyl hydrazone bond, and can be further mixed with therapeutic drug and other lipid accessories, can be prepared to obtain drug-loaded lipid nanoparticle that therapeutic drug is loaded in;Formed drug-loaded lipid nanoparticle can effectively cross blood-brain barrier, better realize the brain delivery of loaded therapeutic drug;Under acidic microenvironment of brain glioma, formed drug-loaded lipid nanoparticle releases loaded therapeutic drug selectively by acid response of acyl hydrazone bond, realizes brain-targeted delivery.

Description

Technical Field

[0001] This invention belongs to the field of drug delivery technology, and in particular relates to an imidazole amino acid-responsive biomimetic lipid compound, its preparation method, and its application. Background Technology

[0002] Malignant glioma (GBM), the most common intracranial malignant tumor, is characterized by its high invasiveness, high recurrence rate, and extremely poor prognosis, resulting in a very low 5-year survival rate. The acidic microenvironment of GBM is one of its core biological characteristics and a key factor driving malignant progression. This acidic environment primarily stems from the abnormal metabolic patterns and disordered microcirculatory system of GBM cells: GBM cells proliferate extremely rapidly, exhibiting metabolic activity far exceeding that of normal brain tissue, and even under adequate oxygen supply, they still favor anaerobic glycolysis (the Warburg effect), continuously producing large amounts of acidic metabolites such as lactic acid and pyruvate. Simultaneously, the distorted and abnormally permeable angiogenesis of the tumor leads to uneven blood perfusion and obstructed reflux, preventing the timely elimination of acidic metabolites through the circulatory system. This results in the continuous accumulation of these metabolites in the tumor, lowering the microenvironment pH to an acidic range of 6.0–6.8. This acidic characteristic exhibits a clear spatial gradient, with the core region of the tumor, where blood supply is poorest and metabolism is most vigorous, having a pH below 6.0, while the peripheral regions gradually approach the pH of normal brain tissue. An acidic microenvironment can further exacerbate tumor invasion, metastasis, and treatment resistance by activating invasion-related enzymes and inhibiting immune cell function, creating a vicious cycle.

[0003] Acid-responsive drug delivery systems, based on their specific response to the acidic microenvironment of tumor cells (GBM), can effectively improve the therapeutic efficacy of traditional drugs. This is mainly because these systems utilize pH-sensitive carriers (such as protonated polymers and acid-sensitive Schiff base carriers), which maintain structural stability under normal physiological conditions (pH 7.35–7.45), preventing premature drug leakage. Upon entering the acidic GBM microenvironment, the carrier undergoes protonation or hydrolysis of acid-sensitive bonds, rapidly releasing the loaded drug and significantly increasing drug concentration at the tumor site, effectively addressing the off-target effects of traditional chemotherapy drugs. Acid-responsive drug delivery systems can effectively kill occult tumor cells, thereby inhibiting tumor recurrence and metastasis, providing a new pathway for precision treatment of GBM.

[0004] However, current representative acid-responsive drug delivery systems generally suffer from technical bottlenecks such as poor plasma stability or poor acid responsiveness, leading to safety concerns due to premature drug release or poor efficacy due to low drug release rates. Furthermore, most acid-responsive drug delivery systems struggle to effectively cross the blood-brain barrier (BBB). Therefore, there is an urgent need to develop drug delivery systems with good plasma stability, high acid responsiveness, and the ability to cross the BBB, ultimately achieving precise clinical treatment of GBM. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides an imidazole acid-responsive biomimetic lipid compound, its preparation method, and its applications. Drug-loaded lipid nanoparticles composed of this imidazole acid-responsive biomimetic lipid compound can not only effectively cross the blood-brain barrier but also exhibit highly sensitive acid-responsive drug release in the acidic microenvironment of gliomas, achieving effective killing of glioma cells and significantly improving the efficacy of the original drug.

[0006] The technical solution adopted in this invention is: an imidazole amino acid-responsive biomimetic lipid compound, the structure of which is shown in Formula 14;

[0007] Equation 14;

[0008] Where R' is C9~C 18 A straight-chain saturated or straight-chain unsaturated hydrocarbon group, where R" is C9~C9. 18 The straight-chain saturated or straight-chain unsaturated hydrocarbon groups, where R' and R" are the same group or different groups;

[0009] m is an integer from 1 to 5, and n is an integer from 3 to 9;

[0010] X - It is an anionic group, specifically I - ,Br - Cl - BF4 - or PF6 - .

[0011] Preferably, R' and R" are C 13 ~C 17 Straight-chain alkyl, monoalkenyl, or diene-chain compounds.

[0012] Preferably, R' and R" are one or both of the following structures:

[0013]

[0014] Preferably, m is 1, 2 or 3, and n is 3, 4 or 5.

[0015] Preferably, X - For Br - or Cl - .

[0016] A method for preparing drug-loaded lipid nanoparticles involves removing the hydrazine protecting group from an imidazolic acid-responsive biomimetic lipid compound, mixing it with cholesterol and a therapeutic drug, and then subjecting it to cross-linking polymerization. The mixture then self-assembles with the cholesterol and the therapeutic drug to form drug-loaded lipid nanoparticles. Specifically, the acetone protecting group of the imidazolic acid-responsive biomimetic lipid compound hydrazine is first removed using a deprotecting agent, then it is mixed with cholesterol in an organic phase at a molar ratio of (1-3):1. Finally, the lipid nanoparticles are prepared using a thin-film hydration method or a microfluidic system.

[0017] Preferably, the method includes the following steps:

[0018] Step V01: Dissolve the imidazole amino acid responsive biomimetic lipid compound in an organic solvent, add a deprotecting agent to remove the hydrazide protecting group of the imidazole amino acid responsive biomimetic lipid compound, then add cholesterol and dissolve it completely. Remove all organic solvent containing the protecting group by nitrogen blowing or rotary evaporation to obtain a mixture of deprotected imidazole amino acid responsive biomimetic lipid compound and cholesterol.

[0019] Step V02: The deprotected imidazole amino acid-responsive biomimetic lipid compound obtained in step V01 and cholesterol are mixed with the therapeutic drug in a binary cosolvent composed of an organic solvent and a weakly acidic buffer. The deprotected imidazole amino acid-responsive biomimetic lipid compound crosslinks and polymerizes in the binary cosolvent, and then self-assembles with cholesterol and the therapeutic drug to prepare crude drug-loaded lipid nanoparticles loaded with the therapeutic drug.

[0020] Step V03: The crude drug-loaded lipid nanoparticles obtained in step V02 are dialyzed to remove small molecules, organic solvent components and buffer salt components, to obtain drug-loaded lipid nanoparticles in which therapeutic drugs are loaded.

[0021] Preferably, the therapeutic drug is one or more of small molecule chemical drugs, polypeptide drugs, and small nucleic acid drugs.

[0022] Preferably, the small molecule chemical drug is one or more of synthetic small molecule chemical drugs and natural product drugs;

[0023] Preferably, the polypeptide drug is one or more of natural active polypeptides and chemically synthesized polypeptides;

[0024] Preferably, the small nucleic acid drug is one or more of ASO, siRNA, snRNA, shRNA, and miRNA.

[0025] Drug-loaded lipid nanoparticles prepared by the above-described method.

[0026] Application of drug-loaded lipid nanoparticles in the preparation of drugs targeting glioma.

[0027] Preferably, drug-loaded lipid nanoparticles are used as a drug delivery system for the preparation of drugs targeting gliomas;

[0028] Preferably, the drug-loaded lipid nanoparticle delivery system is capable of crossing the blood-brain barrier;

[0029] Preferably, the drug-loaded lipid nanoparticle delivery system is able to release the loaded therapeutic drug in response to the acidic microenvironment of glioma, thereby achieving brain-targeted delivery.

[0030] The advantages and positive effects of this invention are as follows: the hydrophilic imidazole ring nitrogen atoms of the imidazole acid-responsive biomimetic lipid compound are modified with aldehyde and hydrazide groups, respectively. Therefore, intermolecular cross-linking can be achieved through the formation of acylhydrazone bonds to self-assemble into drug-loaded lipid nanoparticles. The acylhydrazone bonds of these drug-loaded lipid nanoparticles are highly stable in the plasma environment and will not leak the loaded therapeutic drug; however, in the acidic microenvironment of gliomas, the acylhydrazone bonds are effectively hydrolyzed, thereby triggering highly sensitive acid-responsive drug release and achieving selective drug delivery in brain tissue. Furthermore, the imidazole acid-responsive biomimetic lipid compound possesses a dimethylamino functional group, which can improve blood-brain barrier permeability, facilitating the delivery of drug-loaded lipid nanoparticles composed of imidazole acid-responsive biomimetic lipid compounds across the blood-brain barrier, further enhancing brain-targeted delivery function. Its brain-targeted delivery efficiency is significantly superior to the LNPs delivery system composed of the representative ionizable cationic lipid Dlin-MC3-DMA.

[0031] Imidazole acid-responsive biomimetic lipid compounds are the first innovative biomimetic lipid materials that can form drug-loaded lipid nanoparticles through cross-linking and self-assembly, trigger acid response mechanisms for selective drug release in the tumor microenvironment, and cross the blood-brain barrier. The nanomedicine carriers composed of these compounds belong to a new generation of biomimetic brain-targeted delivery systems, providing a new strategy for achieving brain-targeted delivery of different types of anti-tumor drugs. Attached Figure Description

[0032] Figure 1 The diagram shows the general structural formula of imidazole amino acid-responsive biomimetic lipid compounds and the structural schematic diagram of a drug delivery system for lipid nanoparticles based on imidazole amino acid-responsive biomimetic lipid compounds.

[0033] Figure 2 Transmission electron microscopy (TEM) images of the lipid nanoparticles prepared in Example 3 and Comparative Example 1; where A: LNPs-1(dA5Z15Z) ij B: Comparative Example 1 (D-Lin-MC3-DMA / Chol.);

[0034] Figure 3The real-time dynamic change trend of transmembrane resistance (TEER) in an in vitro blood-brain barrier model mediated by lipid nanoparticles prepared in Example 3 and Comparative Example 1 is shown; where A: LNPs-1(dA5Z15Z) ij 18Hz3-JCl / Chol.), LNPs-15(dA3Z ij 2 18Hz3-JCl / Chol.), LNPs-25(dA5Z18Z ij / lm 18Hz 2-JCl / Chol.) and Comparative Example 1 (D-Lin-MC3-DMA / Chol.); B: LNPs-4 (dA4Z) 2 15Hz3-JCl / Chol.), LNPs-10(dA5Z15Z ij 15Hz 1-JCl / Chol.) and Comparative Example 1 (D-Lin-MC3-DMA / Chol.);

[0035] Figure 4 PTX@dA5Z15Z labeled with the fluorescent probe AF594 in Example 14 ij 18Hz 3-JCl / Chol.、CLTX@dA5Z15Z ij 18Hz 3-JCl / Chol. with miR-329@dA5Z15Z ij Delivery efficiency of 18Hz 3-JCl / Chol. across the in vitro blood-brain barrier model. Figure 4 A is a graph showing the relationship between cytotoxicity and time; Figure 4 B is PTX@dA5Z15Z ij The fluorescence intensity of 18Hz 3-JCl / Chol. changes over time; Figure 4 C is CLTX@dA5Z15Z ij The fluorescence intensity of 18Hz 3-JCl / Chol. changes over time; Figure 4 D is miR-329@dA5Z15Z ij The fluorescence intensity of 18Hz 3-JCl / Chol. changes over time;

[0036] Figure 5 The PTX@LNPs-1 (PTX@dA5Z15Z) prepared in Example 5 ij The brain drug delivery effects of 18Hz3-JCl / Chol. and PTX@D-Lin-MC3-DMA / Chol. prepared in Comparative Example 2 were compared; where A: brain tissue-plasma concentration ratio (B / P ratio); B: relative tumor proliferation rate (T / C ratio).

[0037] Figure 6The CLTX@LNPs-1 (CLTX@dA5Z15Z) prepared in Example 6 ij The brain drug delivery effects of 18Hz3-JCl / Chol. and CLTX@D-Lin-MC3-DMA / Chol. prepared in Comparative Example 3; where A: brain tissue-plasma concentration ratio (B / P ratio); B: relative tumor proliferation rate (T / C ratio);

[0038] Figure 7 The miR-329@LNPs-1 (miR-329@dA5Z15Z) prepared in Example 7 ij The brain drug delivery effects of 18Hz3-JCl / Chol. and miR-329@D-Lin-MC3-DMA / Chol. prepared in Comparative Example 4 were compared; where A: brain tissue-plasma concentration ratio (B / P ratio); B: relative tumor proliferation rate (T / C ratio). Detailed Implementation

[0039] The embodiments of the present invention will now be described with reference to the accompanying drawings.

[0040] This invention relates to an imidazole acid-responsive biomimetic lipid compound, its preparation method, and its applications. The imidazole acid-responsive biomimetic lipid structure is designed to mimic natural phospholipids. Flexible long lipid chains are linked to the 4 and 5 positions of the imidazole ring via ether bonds, forming hydrophobic tails. Simultaneously, aldehyde and hydrazide groups are modified at the 1-N and 3-N positions of the imidazole ring, respectively, and dimethylamino groups of varying alkyl chain lengths are modified at the 2 position, forming hydrophilic heads. The imidazole acid-responsive biomimetic lipid exhibits highly biomimetic structural features, low cytotoxicity, and can self-assemble through cross-linking of its aldehyde and hydrazide groups. It can also be used with cholesterol to construct lipid nanoparticle delivery systems for crossing the blood-brain barrier to deliver various types of anti-glioma drugs, such as small molecules, peptides, or small nucleic acids, to the brain.

[0041] The structure of the imidazole amino acid-responsive biomimetic lipid compound is shown in Formula 14.

[0042] Equation 14;

[0043] Among them, X - It is an anionic group, specifically I - ,Br - Cl - BF4 - or PF6 - R' and R" are each independently selected from chains of length C9~C 18 The linear saturated or linear unsaturated hydrocarbon group, where R' and R" are the same or different groups; m is an integer from 1 to 5, and n is an integer from 3 to 9. In some embodiments of the present invention, X -Br is preferred - or Cl - m is preferably 1, 2, or 3, and n is preferably 3, 4, or 5; R' and R" are each independently selected from chains of length C. 13 ~C 17 Straight-chain alkyl, monoalkenyl, or diene-chain compounds.

[0044] The preparation method of imidazole amino acid-responsive biomimetic lipid compounds, as shown in Formula 14, is as follows:

[0045] Step S01: React the compound shown in Formula 1 with a protecting agent containing the protecting group PG-I to obtain the intermediate shown in Formula 2;

[0046] ;

[0047] Organic base B and organic catalyst C are added to an anhydrous organic solvent A containing the compound shown in Formula 1, followed by the addition of protective agent I. The mixture is stirred under nitrogen protection, and after the reaction is complete, the intermediate shown in Formula 2 is obtained by separation. The anhydrous organic solvent A can be dichloromethane (DCM), acetonitrile (ACN), or tetrahydrofuran (THF), etc.; the protective agent I can be benzyloxycarbonyl chloride (CbzCl) or ditert-butyl dicarbonate ((Boc)2O), etc.; the organic base B can be triethylamine (TEA) or N,N-diisopropylethylamine (DIPEA), etc.; and the organic catalyst C can be 4-dimethylaminopyridine (DMAP) or 4-pyrrolidinylpyridine (4-PPy), etc.

[0048] Step S02: The intermediate shown in Formula 2 is reacted with a protecting agent containing the protecting group PG-II to obtain the intermediate shown in Formula 3;

[0049] ;

[0050] The intermediate shown in Formula 2 is dissolved in anhydrous organic solvent B. Under nitrogen protection, organic base B is added first, followed by the slow addition of protecting group II and stirring at 0°C. After the reaction is completed, the intermediate shown in Formula 3 is obtained by separation. The anhydrous organic solvent B can be N,N-dimethylformamide (DMF) or dichloromethane (DCM), etc.; the protecting agent II can be tert-butyldiphenylchlorosilane (TBDPSCl), tert-butyldimethylchlorosilane (TBSCl), or triphenylchloromethane (TrtCl), etc.

[0051] Step S03: React the intermediate shown in Formula 3 with the compound shown in Formula 4 under anaerobic and strongly alkaline conditions to obtain the intermediate shown in Formula 5.

[0052] ;

[0053] Under nitrogen protection, a strong base A is slowly added to an anhydrous organic solvent C containing the intermediate shown in Formula 3, and the mixture is kept at this temperature while stirring. Subsequently, the compound shown in Formula 4 is slowly added under the same temperature and stirring, followed by a slow gradient increase in temperature to -20°C with continued stirring. After the reaction is complete, the intermediate shown in Formula 5 is obtained by separation. The anhydrous organic solvent C can be tetrahydrofuran (THF) or N,N-dimethylformamide (DMF); the strong base A can be NaH or potassium hexamethyldisilamide (KHMDS), etc.

[0054] Step S04: Under certain conditions, remove the protecting group PG-I of the intermediate shown in Formula 5 to obtain the intermediate shown in Formula 6;

[0055] ;

[0056] The intermediate shown in Formula 5 is dissolved in anhydrous organic solvent D. After complete dissolution, deprotecting agent A is added. After the reaction is completed at room temperature, the intermediate shown in Formula 6 is obtained by separation. The anhydrous organic solvent D can be dichloromethane (DCM), tetrahydrofuran (THF), or dioxane (Diox), etc.; the deprotecting agent A can be trifluoroacetic acid (TFA) or hydrochloric acid, etc.

[0057] Step S05: The intermediate shown in Formula 6 and the compound shown in Formula 7 are subjected to an etherification reaction under certain conditions to obtain the intermediate shown in Formula 8.

[0058] ;

[0059] Under nitrogen protection, organic base B and activator A are added sequentially to an anhydrous organic solvent E containing the intermediate shown in Formula 6, and the mixture is stirred at 0°C. Then, the compound shown in Formula 7 and inorganic base A are added, and the mixture is stirred until homogeneous. The temperature is then raised to 40°C and stirred continuously. After the reaction is complete, the intermediate shown in Formula 8 is obtained by separation. The anhydrous organic solvent E can be dichloromethane (DCM) or acetonitrile (ACN), etc.; the activator A can be methanesulfonyl chloride (MsCl) or p-toluenesulfonyl chloride (TsCl), etc.; and the inorganic base A can be K2CO3 or Cs2CO3, etc.

[0060] Step S06: Under certain conditions, remove the protecting group PG-II of the intermediate shown in Formula 8 to obtain the intermediate shown in Formula 9;

[0061] ;

[0062] The intermediate shown in Formula 8 is dissolved in anhydrous organic solvent F. After complete dissolution, deprotecting agent B is slowly added under nitrogen protection and stirred at room temperature. After the reaction is completed, the intermediate shown in Formula 9 is obtained by separation. The anhydrous organic solvent F can be tetrahydrofuran (THF), dichloromethane (DCM), or acetonitrile (ACN), etc.; the deprotecting agent B can be tetrabutylammonium fluoride (TBAF) or triethylamine hydrogen fluoride (Et3N·3HF), etc.

[0063] Step S07: The intermediate shown in Formula 9 and the compound shown in Formula 7' are subjected to an etherification reaction under certain conditions to obtain the intermediate shown in Formula 10.

[0064] ;

[0065] Under nitrogen protection, organic base B and activator A were added sequentially to an anhydrous organic solvent E containing the intermediate shown in Formula 9, and the mixture was stirred at 0°C. Subsequently, the compound shown in Formula 7' and inorganic base A were added, and the mixture was stirred until homogeneous. The temperature was then raised to 40°C and stirred continuously. After the reaction was completed, the intermediate shown in Formula 10 was obtained by separation.

[0066] Step S08: The intermediate shown in Formula 10 is reacted with the compound shown in Formula 11 to obtain the intermediate shown in Formula 12.

[0067] ;

[0068] Under nitrogen protection, an organic base B is added to an anhydrous organic solvent G containing the intermediate shown in Formula 10. After stirring until homogeneous, the compound shown in Formula 11 is slowly added and stirred at 0°C. The mixture is then slowly raised to room temperature and stirred continuously. After the reaction is complete, the intermediate shown in Formula 12 is obtained by separation. The anhydrous organic solvent G can be acetonitrile (ACN), N,N-dimethylformamide (DMF), or tetrahydrofuran (THF), etc.

[0069] Step S09: The intermediate shown in Formula 12 is acidified with HX and then reacted with the compound shown in Formula 13 to form a salt, thereby obtaining the imidazole amino acid-responsive biomimetic lipid compound shown in Formula 14.

[0070] ;

[0071] Under nitrogen protection at 0°C, the intermediate shown in Formula 12 is dissolved in anhydrous organic solvent H. After complete dissolution, hydrogen halide HX is slowly added and stirred until homogeneous. Then, the compound shown in Formula 13 is slowly added while maintaining 0°C. After thorough stirring, the mixture is slowly raised to room temperature and stirred continuously. After the reaction is complete, the compound shown in Formula 14 is obtained by separation. The anhydrous organic solvent H can be acetonitrile (ACN), acetone, or dichloromethane (DCM), etc.; HX can be HCl or HBr, etc.

[0072] Furthermore, unless otherwise defined, all terms used in this invention (including technical and scientific terms) have their ordinary meanings as understood by those skilled in the art. The letters "A," "B," "C," "D," and "E" appearing in this invention are codes for reagents or solvents, used only to distinguish similar reagents or solvents, and do not indicate or imply the relative importance or order of the reagents or solvents represented. Moreover, the reagents or solvents represented by the letters "A," "B," "C," "D," and "E" used in this invention can be interchanged where appropriate. It should be noted that all terms used in this invention are merely for describing specific embodiments and are not intended to limit the invention.

[0073] In some embodiments of the present invention, in the structure of Formula 14, R' and R" are the same group or different groups. When R' and R" are different groups, they can be groups with the same carbon chain length or groups with different carbon chain lengths; preferably, R' and R" are each independently selected from groups with a chain length of C 13 ~C 17 Straight-chain alkyl, monoalkenyl, or dienyl; specifically, it may be one or two of the following structural formulas:

[0074]

[0075] The carbon chain length and unsaturation of R' and R" can modulate the biomimetic and self-assembly polymorphism of imidazole amino acid-responsive biomimetic lipid compounds, thereby affecting their biocompatibility and the stability of the drug-loaded lipid nanoparticles they form, thus improving their drug loading and delivery efficiency.

[0076] In some embodiments of the present invention, m in Formula 14 is preferably 1, 2, or 3. The value of m is the length of the hydrazide arm modified on the 3-N of the imidazole ring in the imidazole acid-responsive biomimetic lipid compound, which directly affects the intermolecular cross-linking self-assembly function and indirectly affects the stability, drug loading, and acid response performance of drug-loaded lipid nanoparticles composed of imidazole acid-responsive biomimetic lipid compounds.

[0077] In some embodiments of the present invention, n in Formula 14 is preferably 3, 4, or 5. The value of n is the length of the flexible lipid chain between the dimethylamino group and the imidazole ring in the hydrophilic structure of the imidazole-responsive biomimetic lipid compound, which directly affects the affinity of the dimethylamino group for the blood-brain barrier tight junction functional protein, thus determining the blood-brain barrier permeability. This, in turn, affects the drug delivery efficiency of drug-loaded lipid nanoparticles composed of imidazole-responsive biomimetic lipid compounds across the blood-brain barrier.

[0078] In some embodiments of the present invention, the imidazole amino acid-responsive biomimetic lipid compound may be one of the following formulas:

[0079]

[0080] Bio-mimetic imidazolium-based lipids (BILs) are a class of ionizable imidazolium lipids with biomimetic structural features and functions. The imidazolium ring, as a histidine side chain, is widely found in peptides and proteins, with a pKa of approximately 6.0. It exhibits significant buffering capacity and demonstrates superior pH responsiveness in endosomes and lysosomes compared to commercially available ionizable aminocationic lipids (such as ALC-0315), showcasing excellent endosome escape capabilities and drug delivery potential. Furthermore, the chemical modifiability of the imidazolium ring helps improve drug loading rates and targeted delivery efficiency. This invention leverages the multi-modifiability of the hydrophilic imidazolium ring, combined with the flexible, long-chain hydrophobic structure of natural phospholipids, the lipid self-assembly molecular arrangement mechanism, and lipophilic groups possessing blood-brain barrier permeability, to achieve a biomimetic design of molecular fragment splicing. Amphoteric lipid molecular backbone was formed by splicing the flexible long chains of natural phospholipids with the 4 and 5 positions of the imidazole ring via ether bonds. Short-chain aldehyde and hydrazide groups were then spliced ​​onto the 1-N and 3-N positions of the imidazole ring via alkylation and acylation strategies, respectively, forming the "left and right cross-linked wings" of the molecular backbone. Alkylation at the 2 position of the imidazole ring introduced a dimethylamino group, serving as a crucial binding site for the blood-brain barrier, forming a class of imidazole ring-based bio-mimeticimidazolium-based lipids (ArBILs) that can cross-link and self-assemble, exhibiting acid responsiveness to the tumor microenvironment. In the ArBIL structure, the aldehyde and hydrazide groups of the "left and right cross-linked wings" can form hydrazone bonds with adjacent hydrazide and aldehyde groups, respectively, for cross-linking and self-assembly. These hydrazide groups then further self-assemble with cholesterol in an aqueous phase to form lipid nanoparticles (LNPs). In the lipid bilayer of ArBILs-based LNPs, the adjustable length of the acylhydrazone crosslinking arms provides flexible space for loading drugs with different structures, significantly improving drug loading capacity. Furthermore, the acylhydrazone crosslinking arms are located on the hydrophilic side, making them highly stable in the plasma environment (pH 7.35–7.45) after entering the bloodstream, preventing premature drug release. Upon contact with the slightly acidic environment of the glioma extracellular matrix (pH ~6.8), the acylhydrazone bond and imidazole undergo partial protonation, facilitating uptake by glioma cells. Once inside the endosomes (pH 5.0–6.0) and lysosomes (pH 4.5–5.0), due to their high acid sensitivity and proton sponge effect, the acylhydrazone crosslinking arms rapidly hydrolyze and escape from the endosomes, releasing the loaded drug into the cytoplasm to exert its therapeutic effect.

[0081] Furthermore, the present invention also relates to a drug-loaded lipid nanoparticle, which is formed by cross-linking polymerization of an imidazole amino acid-responsive biomimetic lipid compound of Formula 14 or its pharmaceutically acceptable solvate after removing the hydrazine protecting group; it also includes cholesterol and a therapeutic drug. The therapeutic drug is one or more of small molecule chemical drugs, peptide drugs, and small nucleic acid drugs. The small molecule chemical drug is one or more of synthetic small molecule chemical drugs and natural product drugs; the peptide drug is one or more of natural active peptides and chemically synthesized peptides; the small nucleic acid drug is one or more of ASO, siRNA, snRNA, shRNA, and miRNA.

[0082] In this invention, the term "solvent" refers to a complex formed by the imidazole-responsive biomimetic lipid compound shown in Formula 14 and a solvent (e.g., ethanol or water). For example, the term "hydrate" refers to the case where the solvent in the aforementioned term "solvent" is water. Furthermore, the imidazole-responsive biomimetic lipid compound shown in Formula 14 can be separated in solvate form, and any solvate is included within the scope of protection of this invention.

[0083] The acetone protecting group of the imidazole amino acid-responsive biomimetic lipid compound acylhydrazine shown in Formula 14 can be removed by first removing the protecting agent, then mixed with cholesterol in an organic phase at a molar ratio of (1~3):1, and finally prepared in an aqueous phase by thin film hydration or microfluidic system to obtain the above lipid nanoparticles (LNPs).

[0084] Furthermore, these LNPs can be used as delivery systems to load different types of drugs for targeted drug delivery. In this invention, the acetone protecting group of the imidazole acid-responsive biomimetic lipid compound acylhydrazine of Formula 14 is first removed by a deprotecting agent, and then mixed with cholesterol and a therapeutic drug. The drug-loaded lipid nanoparticles containing the therapeutic drug are then prepared using a thin-film hydration method or a microfluidic system.

[0085] The method for preparing the above-mentioned drug-loaded lipid nanoparticles based on imidazole amino acid-responsive biomimetic lipid compounds includes the following steps:

[0086] Step V01: Dissolve the imidazole-responsive biomimetic lipid compound in an organic solvent, add a deprotecting agent to remove the hydrazide protecting group of the imidazole-responsive biomimetic lipid compound, then mix it with cholesterol in a certain molar ratio and dissolve it in an organic solvent. Remove all organic solvent containing the protecting group by nitrogen blowing or rotary evaporation to obtain a mixture of the deprotected imidazole-responsive biomimetic lipid compound and cholesterol. The molar ratio is (1~3):1, preferably (1.5~2.5):1; the organic solvent can form an azeotrope with acetone or is a low-boiling-point solvent, preferably dichloromethane / acetonitrile (3:1, v / v) or dichloromethane / ethanol (4:1, v / v); the deprotecting agent is an acidic deprotecting agent, preferably a dioxane solution of p-toluenesulfonic acid (p-TsOH) or hydrochloric acid.

[0087] Step V02: The deprotected imidazole amino acid-responsive biomimetic lipid compound and cholesterol obtained in Step V01 are mixed with a therapeutic drug in a binary cosolvent composed of an organic solvent and a buffer solution. The mixture self-assembles at a specific temperature, and crude drug-loaded lipid nanoparticles loaded with the therapeutic drug are prepared by thin-film hydration or a microfluidic system. The organic solvent is a water-miscible solvent that is easily removed by dialyzing, preferably tetrahydrofuran (THF), acetonitrile (ACN), or ethanol; the buffer solution provides a stable pH of 5.0–6.0, preferably an acetate-sodium acetate buffer (pH 5.5) or a MES buffer (pH 6.0); the volume fraction of the organic solvent in the binary cosolvent is 20%–40%, preferably 22%–35%; the self-assembly temperature is 40–50°C, preferably 45°C.

[0088] Step V03: The crude drug-loaded lipid nanoparticles obtained in step V02 are dialyzed to remove small molecules, organic solvent components, and buffer salt components, yielding drug-loaded lipid nanoparticles in which the therapeutic drug is loaded, such as... Figure 1 As shown. The dialysate is either PBS buffer (pH 7.4) or pure water, preferably PBS buffer (pH 7.4).

[0089] In imidazole acid-responsive biomimetic lipid compounds (ArBILs), the introduction of dimethylamino groups with varying alkyl chain lengths at the 2-position of the imidazole ring can effectively trigger the opening of tight junctions at the blood-brain barrier, improving its permeability. This enables drug-loaded lipid nanoparticles based on ArBILs to effectively cross the blood-brain barrier and deliver drugs to the brain, facilitating the preparation of brain-targeted drugs. Furthermore, in the acidic microenvironment of gliomas, the dimethylamino group can sensitively capture protons, forming a structure that is easily taken up by tumor cells and escapes from the endosome, achieving acid-responsive drug delivery.

[0090] The imidazole amino acid-responsive biomimetic lipid compounds shown in Formula 14, while containing dimethylamino groups, differ significantly in structure from representative ionizable cationic lipids in existing delivery technologies such as Dlin-MC3-DMA. ArBILs not only possess highly biomimetic structural features, exhibiting good biocompatibility and low cytotoxicity, but the drug-loaded lipid nanoparticles composed of them also possess blood-brain barrier permeability and acid responsiveness—functions not found in Dlin-MC3-DMA and its derivatives. Furthermore, ArBIL-based drug-loaded lipid nanoparticles have a broad drug loading spectrum, enabling their widespread use in preparing brain-targeted drug delivery systems and formulations capable of crossing the blood-brain barrier. The brain-targeted delivery efficiency of ArBIL-based LNPs delivery systems is significantly superior to that of LNPs delivery systems composed of ionizable cationic lipids such as Dlin-MC3-DMA.

[0091] The present invention will now be described with reference to the accompanying drawings. Experimental methods not specifically described in the accompanying drawings are performed according to the relevant product instructions. Unless otherwise specified, the instruments, reagents, and consumables used in the embodiments can be purchased from commercial companies. It should be noted that, unless otherwise defined, the technical or scientific terms used in this invention should have the ordinary meaning understood by those skilled in the art.

[0092] Example 1: Imidazole amino acid-responsive biomimetic lipid compound dA5Z15Z ij Synthesis of 18Hz3-JCl

[0093] dA5Z15Z ij The synthesis process of 18Hz3-JCl is shown in the following equation:

[0094]

[0095] The specific synthesis process is as follows:

[0096] (1) Preparation of 1-N-Boc-4,5-dihydroxymethylimidazolium (I-1)

[0097] 128 mg (1.0 mmol, 1.0 eq.) of 4,5-dihydroxymethylimidazolium (I-0) was dissolved in 4.0 mL of anhydrous dichloromethane. Under nitrogen protection, 121 mg of triethylamine (1.2 mmol, 1.2 eq.) and 12 mg of 4-dimethylaminopyridine (0.1 mmol, 0.1 eq.) were added sequentially. After mixing thoroughly at 0 °C, 1.0 mL of anhydrous dichloromethane solution of di-tert-butyl dicarbonate (1.05 mmol, 1.05 eq.) was slowly added dropwise. The mixture was stirred at 0 °C for 1 h. After the starting material I-0 was basically eliminated by TLC, the mixture was raised to room temperature and stirred for 2 h until the reaction was complete. The reaction solution was quenched with saturated ammonium chloride solution, the organic phase was collected, washed with saturated sodium chloride solution, dried with anhydrous sodium sulfate, and then collected as a white solid I-1 (217 mg, 0.95 mmol) by filtration and concentration, with a yield of 95.0%.

[0098] (2) Preparation of 1-N-Boc-4-[(tert-butyldiphenylsiloxy)methyl]-5-hydroxymethylimidazolium (I-2)

[0099] 217 mg (0.95 mmol, 1.0 eq.) of 1-N-Boc-4,5-dihydroxymethylimidazolium (I-1) was added to 4.8 mL of anhydrous dichloromethane under nitrogen protection. After complete dissolution, the solution was incubated at 0 °C for 10 min. Then, 147 mg of N,N-diisopropylethylamine (1.14 mmol, 1.2 eq.) was added. After stirring until homogeneous, 1.5 mL of a dilute solution of tert-butyldiphenylchlorosilane in anhydrous dichloromethane (0.97 mmol, 1.02 eq.) was slowly added dropwise. The solution was stirred at 0 °C for 4 h, and the reaction was monitored by TLC until complete. The reaction solution was quenched with ice water, the organic phase was collected, washed with saturated sodium chloride solution, dried with anhydrous sodium sulfate, and then collected as a colorless oily crude product by filtration and concentration. The crude product was then separated and purified by column chromatography (ethyl acetate: petroleum ether = 1:4) to obtain colorless solid I-2 (401 mg, 0.86 mmol), with a yield of 90.5%.

[0100] (3) Preparation of 1-N-Boc-2-[7-(dimethylamino)heptyl]-4-[(tert-butyldiphenylsiloxy)methyl]-5-hydroxymethylimidazolium (I-3)

[0101] 401 mg (0.86 mmol, 1.0 eq.) of 1-N-Boc-4-[(tert-butyldiphenylsiloxy)methyl]-5-hydroxymethylimidazolium (I-2) was dissolved in 2.7 mL of anhydrous tetrahydrofuran under nitrogen protection. The solution was cooled to -78 °C, stirred until homogeneous, and kept at this temperature for 15 min. Then, 3.0 mL of anhydrous tetrahydrofuran dilute solution of hexamethyldisilamide potassium (0.94 mmol, 1.1 eq.) was slowly added dropwise, and the mixture was stirred at -78 °C for 1.5 h. Under this temperature-controlled condition, 2.8 mL of anhydrous tetrahydrofuran dilute solution of 1-bromo-7-(dimethylamino)heptane (0.90 mmol, 1.05 eq.) was slowly added dropwise, and the mixture was stirred for 2 h. The temperature was then gradually increased to -20 °C and stirred for 1 h. The reaction was monitored by TLC until complete. The reaction solution was quenched with saturated ammonium chloride solution at -20℃, and the organic phase was collected after being heated to room temperature. The organic phase was washed with saturated sodium chloride solution, dried with anhydrous sodium sulfate, and then collected as a yellow oily crude product by filtration and concentration. The crude product was then separated and purified by column chromatography (ethyl acetate: petroleum ether = 1:3) to obtain yellow solid I-3 (443 mg, 0.73 mmol), with a yield of 84.9%.

[0102] (4) Preparation of 2-[7-(dimethylamino)heptyl]-4-[(tert-butyldiphenylsiloxy)methyl]-5-hydroxymethylimidazolium (I-4)

[0103] 443 mg (0.73 mmol, 1.0 eq.) of 1-N-Boc-2-[7-(dimethylamino)heptyl]-4-[(tert-butyldiphenylsiloxy)methyl]-5-hydroxymethylimidazolium (I-3) was dissolved in 2.0 mL of anhydrous dichloromethane. Then, 1.6 mL of anhydrous trifluoroacetic acid (7.3 mmol, 10.0 eq.) was slowly added dropwise. The mixture was stirred at room temperature for 2 h. After the reaction was completed by TLC monitoring, the reaction solution was diluted with 5 mL of dichloromethane and then slowly neutralized with saturated sodium bicarbonate solution. The organic phases were combined and washed with saturated sodium chloride solution. After drying with anhydrous sodium sulfate, the mixture was filtered and concentrated to collect the solid crude product I-4 (360 mg, 0.71 mmol), with a yield of 97.3%.

[0104] (5) Preparation of 2-[7-(dimethylamino)heptyl]-4-[(tert-butyldiphenylsiloxy)methyl]-5-[((Z)-octadec-9-en-1-yl)oxy)methyl]-1H-imidazolium (I-5)

[0105] 360 mg (0.71 mmol, 1.0 eq.) of 2-[7-(dimethylamino)heptyl]-4-[(tert-butyldiphenylsiloxy)methyl]-5-hydroxymethylimidazolium (I-4) was added to 3.0 mL of anhydrous dichloromethane under nitrogen protection and stirred at 0 °C for 10 min until fully dissolved. Then, 72 mg of triethylamine (0.71 mmol, 1.0 eq.) was added and stirred until homogeneous. Finally, 0.5 mL of a dilute solution of methanesulfonyl chloride in anhydrous dichloromethane (0.71 mmol, 1.0 eq.) was slowly added dropwise and stirred at 0 °C for 30 min. After the reaction was monitored by TLC until complete and no excess methanesulfonyl chloride or triethylamine remained, 3.5 mL of anhydrous dichloromethane solution of oleyl alcohol (0.85 mmol, 1.2 eq.) was added directly, followed by 148 mg (1.07 mmol, 1.5 eq.) of dried triethylamine. Potassium carbonate powder was mixed thoroughly and heated to 40°C with constant stirring. The reaction was monitored by TLC until complete. The reaction solution was quenched with ice water, ethyl acetate was added to collect the organic phase, and the mixture was washed with saturated sodium chloride solution. After drying with anhydrous sodium sulfate, the crude product was collected by filtration and concentration. The crude product was then purified by column chromatography (ethyl acetate: petroleum ether = 1:6) to obtain a yellow solid I-5 (432 mg, 0.57 mmol), with a yield of 80.3%.

[0106] (6) Preparation of 2-[7-(dimethylamino)heptyl]-4-hydroxymethyl-5-[((Z)-octadec-9-en-1-yl)oxy)methyl]-1H-imidazolium (I-6)

[0107] 432 mg (0.57 mmol, 1.0 eq.) of 2-[7-(dimethylamino)heptyl]-4-[(tert-butyldiphenylsiloxy)methyl]-5-[((Z)-octadec-9-en-1-yl)oxy)methyl]-1H-imidazolium (I-5) was added to 2.0 mL of anhydrous tetrahydrofuran under nitrogen protection and stirred at room temperature until fully dissolved. Then, 0.8 mL of a dilute solution of tetrabutylammonium fluoride in anhydrous tetrahydrofuran (0.68 mmol, 1.2 eq.) was slowly added dropwise. The mixture was stirred at room temperature for 2 h, and the reaction was monitored by TLC until complete. The reaction solution was quenched with deionized water, the organic phase was collected, washed with saturated sodium chloride solution, dried with anhydrous sodium sulfate, and then filtered and concentrated to collect a colorless oily crude product. The product was then separated and purified by column chromatography (ethyl acetate: petroleum ether = 1:3) to obtain a colorless solid I-6 (281 mg, 0.54 mmol), with a yield of 94.9%.

[0108] (7) Preparation of 2-[7-(dimethylamino)heptyl]-4-[(pentadecanoxy)methyl]-5-[((Z)-octadec-9-en-1-yl)oxy)methyl]-1H-imidazolium (I-7)

[0109] 281 mg (0.54 mmol, 1.0 eq.) of 2-[7-(dimethylamino)heptyl]-4-hydroxymethyl-5-[((Z)-octadec-9-en-1-yl)oxy)methyl]-1H-imidazolium (I-6) was added to 2.0 mL of anhydrous dichloromethane under nitrogen protection and stirred at 0 °C for 10 min until fully dissolved. Then, 55 mg of triethylamine (0.54 mmol, 1.0 eq.) was added and stirred until homogeneous. Finally, 0.7 mL of a dilute solution of methanesulfonyl chloride in anhydrous dichloromethane (0.54 mmol, 1.0 eq.) was slowly added dropwise and stirred at 0 °C for 30 min. After the reaction was monitored by TLC until complete and no excess methanesulfonyl chloride or triethylamine remained, 2.7 mL of anhydrous dichloromethane solution of 1-pentadecanol (0.65 mmol, 1.2 eq.) was added directly, followed by 112 mg (0.81 mmol, 1.2 eq.) of dried triethylamine. 1.5 eq.) of potassium carbonate powder was stirred until homogeneous, heated to 40°C, and stirred continuously at a constant temperature. The reaction was monitored by TLC until complete. The reaction solution was quenched with ice water, ethyl acetate was added to collect the organic phase, and the mixture was washed with saturated sodium chloride solution. After drying with anhydrous sodium sulfate, the crude product was collected by filtration and concentration. The crude product was then purified by column chromatography (ethyl acetate: petroleum ether = 1:10) to obtain a pale yellow solid I-7 (314 mg, 0.43 mmol), with a yield of 79.6%.

[0110] (8) Preparation of 1-(3-oxopropyl)-2-[7-(dimethylamino)heptyl]-4-[(pentadecanoxy)methyl]-5-[((Z)-octadec-9-en-1-yl)oxy)methyl]-1H-imidazolium (I-8)

[0111] 314 mg (0.43 mmol, 1.0 eq.) of 2-[7-(dimethylamino)heptyl]-4-[(pentadecanoxy)methyl]-5-[((Z)-octadec-9-en-1-yl)oxy)methyl]-1H-imidazolium (I-7) was added to 2.4 mL of anhydrous acetonitrile under nitrogen protection and stirred at 0 °C for 10 min until fully dissolved. 62 mg of N,N-diisopropylethylamine (0.48 mmol, 1.1 eq.) was added and stirred until homogeneous. Then, 0.5 mL of anhydrous acetonitrile solution of 3-bromopropionaldehyde (0.46 mmol, 1.05 eq.) was slowly added dropwise and stirred at 0 °C for 1 h. After that, the temperature was slowly raised to room temperature and stirred for another 2 h. The reaction was monitored by TLC until complete. The reaction solution was quenched with ice water, ethyl acetate was added to collect the organic phase, and the mixture was washed with saturated sodium chloride solution. After drying with anhydrous sodium sulfate, the crude product was collected by vacuum concentration to obtain a yellow oily product. The crude product was then separated and purified by column chromatography (ethyl acetate: petroleum ether = 1:4) to obtain a pale yellow solid I-8 (291 mg, 0.37 mmol), with a yield of 86.0%.

[0112] (9) Preparation of 1-(3-oxopropyl)-2-[7-(dimethylammonium)heptyl]-3-[7-(2-isopropylhydrazyl)-7-oxoheptanoyl]-4-[(pentadecanoxy)methyl]-5-[((Z)-octadec-9-en-1-yl)oxy)methyl]-1H-imidazol-3-onium dichloride (dA5Z15Z) ij 18Hz3-JCl)

[0113] 291 mg (0.37 mmol, 1.0 eq.) of 1-(3-oxopropyl)-2-[7-(dimethylamino)heptyl]-4-[(pentadecanoxy)methyl]-5-[((Z)-octadec-9-en-1-yl)oxy)methyl]-1H-imidazolium (I-8) was added to 2.1 mL of anhydrous acetonitrile at 0 °C under light protection and nitrogen atmosphere. After complete dissolution, 0.6 mL of anhydrous HCl dioxane solution (0.37 mmol, 1.0 eq.) was slowly added dropwise while stirring at 0 °C for 15 min. Then, 1.0 mL of anhydrous acetonitrile solution of 7-(2-isopropylhydrazyl)-7-oxoheptanoyl chloride (0.39 mmol, 1.05 eq.) was slowly added dropwise while stirring at 0 °C for 1 h. The mixture was then slowly brought to room temperature and stirred for 2 h. The reaction was monitored by TLC until complete. The reaction solution was concentrated under reduced pressure at ≤30℃ to 1 / 3 of its original volume. Then, anhydrous diethyl ether, five times the volume of the concentrated solution, was slowly added dropwise while stirring until all the solid precipitated. After filtration, the solid was washed three times with ice-cold anhydrous diethyl ether. The collected solid was then dried under vacuum in the dark at room temperature for 4-5 hours to obtain the white solid product dA5Z15Z. ij18Hz3-JCl (337 mg, 0.32 mmol), yield 86.5%.

[0114] The prepared imidazole amino acid-responsive biomimetic lipid compound dA5Z15Z ij Characterized by 18Hz 3-JCl (compound 1) and high-resolution mass spectrometry (HRMS) [M-2Cl]. 2+ : C 60 H 113 N5O5 2+ Theoretical value of m / z: 491.9371, measured value: 491.9369.

[0115] The proton NMR results are as follows:

[0116] 1 H NMR (400 MHz, CDCl3) δ 9.75 (t, J=2.0, 1H), 8.10-7.60 (br s, 2H), 5.35-5.31 (m, 2H), 4.48-4.40 (m, 4H), 3.96 (t, J=7.0, 2H), 3.47-3.41 (m, 4H),2.92 (s, 6H), 2.86 (t, J=7.5, 2H), 2.63 (t, J=7.0, 2H), 2.27 (t, J=7.4, 2H),2.07 (s, 6H), 2.04-1.98 (m, 4H), 1.75-1.52 (m, 14H), 1.42-1.20 (br m, 56H), 0.89 (t, J=7.0, 6H).

[0117] The carbon spectrum results are as follows:

[0118] 13 C NMR (100 MHz, CDCl3) δ 200.8, 174.5, 173.2, 155.2, 145.8, 142.3,129.9, 129.7, 128.7, 124.2, 72.1, 70.5, 67.2, 66.8, 43.0, 34.0, 31.9, 23.0-30.0 (m), 22.7, 20.1, 14.1.

[0119] Example 2: Synthesis and characterization of imidazole amino acid-responsive biomimetic lipid compounds 2-27

[0120] dA3Z was synthesized according to the method in Example 1. 2 15Hz 1-JCl, dA4Z 215Hz2-JCl, dA4Z 2 15Hz 3-JCl, dA4Z 2 15Hz 3-JBr, dA5Z 2 15Hz 3-JCl, dA3Z ij 2 15Hz 3-JCl, dA4Z ij 2 15Hz 3-JCl, dA5Z ij 2 15Hz3-JCl, dA5Z15Z ij 15Hz1-JCl, dA5Z15Z ij 15Hz 3-JCl, dA4Z 2 18Hz2-JCl, dA4Z 2 18Hz 3-JCl, dA5Z 2 18Hz 3-JCl, dA3Z ij 2 18Hz 3-JCl, dA4Z ij 2 18Hz 3-JCl, dA5Z ij 2 18Hz 3-JCl, dA3Z15Z ij 18Hz1-JCl, dA4Z15Z ij 18Hz1-JCl, dA4Z15Z ij 18Hz2-JCl, dA4Z15Z ij 18Hz3-JCl, dA3Z18Z ij / lm 18Hz1-JCl, dA3Z18Z ij / lm 18Hz2-JCl, dA4Z18Z ij / lm 18Hz2-JCl, dA5Z18Z ij / lm 18Hz2-JCl, dA5Z18Z ij / lm 18Hz 3-JCl and dA5Z ij 18Z ij / lm 18Hz3-JCl (Imidazole amino acid responsive biomimetic lipid compounds 2~27).

[0121] The above-mentioned compound synthesis method is the same as dA5Z15Z ijSimilar to 18Hz3-JCl (compound 1), the difference lies in that in step (3), 1-bromo-7-(dimethylamino)heptane can be replaced with 1-bromo-5-(dimethylamino)pentane or 1-bromo-6-(dimethylamino)hexane; in step (5), oleyl alcohol and in step (7), 1-pentadecanol can be replaced with 1-fatty alcohols with different chain lengths and different degrees of saturation; in step (9), 7-(2-isopropylhydrazyl)-7-oxohepanoyl chloride can be replaced with 5-(2-isopropylhydrazyl)-5-oxopentanoyl chloride, 6-(2-isopropylhydrazyl)-6-oxohexanoyl chloride or 7-(2-isopropylhydrazyl)-7-oxohepanoyl bromide. The reactants, reaction conditions and yields used in steps (3), (5), (7) and (9) of the above imidazole acid-responsive biomimetic lipid compounds are shown in Table 1. The reaction conditions for the remaining steps are the same as in Example 1.

[0122] Table 1

[0123]

[0124] The imidazole amino acid-responsive biomimetic lipid compounds 2-27 synthesized in Table 1 were characterized, and the 1H NMR spectra are as follows:

[0125] dA3Z 2 15Hz1-JCl (Compound 2):

[0126] 1 H NMR (400 MHz, CDCl3) δ 9.75 (s, 1H), 8.5-9.5 (br s, 3H), 4.35-4.45(s, 4H), 4.05-4.15 (t, J=7.2 Hz, 2H), 3.45-3.55 (t, J=6.8 Hz, 4H), 3.05-3.15(t, J=7.5 Hz, 2H), 2.75-2.85 (t, J=7.5 Hz, 2H), 2.60-2.65 (s, 3H), 2.50-2.55(t, J=7.2 Hz, 2H), 2.30-2.40 (t, J=7.0 Hz, 4H), 1.90-2.00 (m, 10H), 1.40-1.70(m, 10H), 1.20-1.40 (br m, 48H), 0.86-0.90 (t, J=6.8 Hz, 6H).

[0127] dA4Z 215Hz2-JCl (Compound 3):

[0128] 1 1H NMR (400 MHz, CDCl3) δ 9.77 (t, J = 2.1 Hz, 1H), 9.06 (br s, 1H), 8.29 (br m, 2H), 4.42 (t, J = 5.0 Hz, 2H), 4.36 (t, J = 5.0 Hz, 2H), 4.13 (t, J = 7.1 Hz, 2H), 3.52 (t, J = 6.8 Hz, 2H), 3.49 (t, J = 6.8 Hz, 2H), 2.97 (t, J = 7.5 Hz, 2H), 2.81 (br d, J = 5.1 Hz, 3H), 2.74 (t, J = 7.4 Hz, 2H), 2.56 (td, J = 7.2, 2.1 Hz, 2H), 2.34 (t, J = 7.3 Hz, 2H), 2.28 (t, J = 7.3 Hz, 2H), 1.92 (s, 6H), 1.57-1.67 (m, 12H), 1.21-1.41 (br m, 54H), 0.88 (t, J = 6.8 Hz, 6H).

[0129] dA4Z 2 15Hz3-JCl (Compound 4):

[0130] 1¹H NMR (400 MHz, CDCl₃) δ 9.78 (t, J = 2.0 Hz, 1H), 9.04 (br s, 1H), 8.31 (br d, J = 5.2 Hz, 2H), 4.41 (t, J = 5.0 Hz, 2H), 4.37 (t, J = 5.0 Hz, 2H), 4.14 (t, J = 7.1 Hz, 2H), 3.52 (t, J = 6.8 Hz, 2H), 3.50 (t, J = 6.8 Hz, 2H), 2.98 (t, J = 7.5 Hz, 2H), 2.82 (br d, J = 5.2 Hz, 3H), 2.75 (t, J = 7.4 Hz, 2H), 2.57 (td, J = 7.2, 2.0 Hz, 2H), 2.35 (t, J = 7.3 Hz, 2H), 2.29 (t, J = 7.3 Hz, 2H), 1.93 (s, 6H), 1.56-1.68 (m, 12H), 1.21-1.41 (br m, 56H), 0.88 (t, J = 6.8 Hz, 6H).

[0131] dA4Z 2 15Hz3-JBr (Compound 5):

[0132] 1¹H NMR (400 MHz, CDCl₃) δ 9.77 (t, J = 2.0 Hz, 1H), 9.07 (br s, 1H), 8.34 (br d, J = 5.1 Hz, 2H), 4.43 (t, J = 5.0 Hz, 2H), 4.39 (t, J = 5.0 Hz, 2H), 4.15 (t, J = 7.1 Hz, 2H), 3.53 (t, J = 6.8 Hz, 2H), 3.51 (t, J = 6.8 Hz, 2H), 2.99 (t, J = 7.5 Hz, 2H), 2.83 (br d, J = 5.1 Hz, 3H), 2.76 (t, J = 7.4 Hz, 2H), 2.57 (td, J = 7.2, 2.0 Hz, 2H), 2.36 (t, J = 7.3 Hz, 2H), 2.30 (t, J = 7.3 Hz, 2H), 1.94 (s, 6H), 1.57-1.69 (m, 12H), 1.21-1.42 (br m, 56H), 0.88 (t, J = 6.8 Hz, 6H).

[0133] dA5Z 2 ¹⁵Hz 3-JCl (Compound 6):

[0134] 1 ¹H NMR (400 MHz, CDCl₃) δ 9.78 (t, J = 2.0 Hz, 1H), 9.02 (br s, 1H), 8.26 (d, J = 5.3 Hz, 2H), 4.40 (t, J = 5.0 Hz, 4H), 4.13 (t, J = 7.1 Hz, 2H), 3.51 (t, J = 6.8 Hz, 4H), 2.96 (t, J = 7.5 Hz, 2H), 2.81 (d, J = 5.3 Hz, 3H), 2.74 (t, J = 7.4 Hz, 2H), 2.56 (td, J = 7.2, 2.0 Hz, 2H), 2.34 (t, J = 7.3 Hz, 2H), 2.28 (t, J = 7.3 Hz, 2H), 1.93 (s, 6H), 1.58-1.66 (m, 8H), 1.38-1.46 (m, 4H), 1.21-1.35 (br m, 58H), 0.88 (t, J = 6.8 Hz, 6H).

[0135] dA3Z ij 2 15Hz3-JCl (Compound 7):

[0136] 1 H NMR (400 MHz, CDCl3) δ 9.77 (t, J = 2.0 Hz, 1H), 9.05 (br s, 1H), 8.29 (br d, J = 5.2 Hz, 2H), 5.34-5.39 (m, 2H), 5.29-5.34 (m, 2H), 4.42 (t, J= 5.0 Hz, 2H), 4.38 (t, J = 5.0 Hz, 2H), 4.14 (t, J = 7.1 Hz, 2H), 3.52 (t, J= 6.8 Hz, 2H), 3.50 (t, J = 6.8 Hz, 2H), 2.97 (t, J = 7.5 Hz, 2H), 2.82 (br d, J = 5.2 Hz, 3H), 2.75 (t, J = 7.4 Hz, 2H), 2.57 (td, J = 7.2, 2.0 Hz, 2H), 2.35 (t, J = 7.3 Hz, 2H), 2.29 (t, J = 7.3 Hz, 2H), 2.01-2.07 (m, 8H), 1.93 (s, 6H), 1.57-1.67 (m, 12H), 1.21-1.41 (br m, 38H), 0.88 (t, J = 6.8 Hz, 6H).

[0137] dA4Z ij 2 15Hz3-JCl (Compound 8):

[0138] 1H NMR (400 MHz, CDCl3) δ 9.78 (t, J = 2.0 Hz, 1H), 9.03 (br s, 1H), 8.27 (br d, J = 5.2 Hz, 2H), 5.33-5.38 (m, 2H), 5.30-5.34 (m, 2H), 4.41 (t, J = 5.0 Hz, 2H), 4.38 (t, J = 5.0 Hz, 2H), 4.13 (t, J = 7.1 Hz, 2H), 3.52 (t, J = 6.8 Hz, 2H), 3.50 (t, J = 6.8 Hz, 2H), 2.97 (t, J = 7.5 Hz, 2H), 2.81 (br d, J = 5.2 Hz, 3H), 2.74 (t, J = 7.4 Hz, 2H), 2.56 (td, J = 7.2, 2.0 Hz, 2H), 2.34 (t, J = 7.3 Hz, 2H), 2.29 (t, J = 7.3 Hz, 2H), 2.00-2.07 (m, 8H), 1.93 (s, 6H), 1.56-1.67 (m, 12H), 1.21-1.41 (br m, 40H), 0.88 (t, J = 6.8 Hz, 6H).

[0139] dA5Z ij 2 15Hz3-JCl (compound 9):

[0140] 11H NMR (400 MHz, CDCl3) δ 9.77 (t, J = 2.0 Hz, 1H), 9.01 (br s, 1H), 8.25 (d, J = 5.3 Hz, 2H), 5.32-5.37 (m, 2H), 5.30-5.34 (m, 2H), 4.40 (t, J = 5.0 Hz, 4H), 4.13 (t, J = 7.1 Hz, 2H), 3.51 (t, J = 6.8 Hz, 4H), 2.96 (t, J = 7.5 Hz, 2H), 2.80 (d, J = 5.3 Hz, 3H), 2.73 (t, J = 7.4 Hz, 2H), 2.56 (td, J = 7.2, 2.0 Hz, 2H), 2.33 (t, J = 7.3 Hz, 2H), 2.28 (t, J = 7.3 Hz, 2H), 2.00-2.06 (m, 8H), 1.93 (s, 6H), 1.57-1.66 (m, 8H), 1.37-1.45 (m, 4H), 1.21-1.35 (br m, 42H), 0.88 (t, J = 6.8 Hz, 6H).

[0141] dA5Z15Z ij 15Hz1-JCl (Compound 10):

[0142] 11H NMR (400 MHz, CDCl3) δ 9.79 (t, J = 2.0 Hz, 1H), 9.06 (br s, 1H), 8.30 (br d, J = 5.2 Hz, 2H), 5.33-5.38 (m, 2H), 4.43 (t, J = 5.0 Hz, 2H), 4.36 (t, J = 5.0 Hz, 2H), 4.14 (t, J = 7.1 Hz, 2H), 3.53 (t, J = 6.8 Hz, 2H), 3.50 (t, J = 6.8 Hz, 2H), 2.98 (t, J = 7.5 Hz, 2H), 2.82 (br d, J = 5.2 Hz, 3H), 2.76 (t, J = 7.4 Hz, 2H), 2.57 (td, J = 7.2, 2.0 Hz, 2H), 2.38 (t, J = 7.3 Hz, 2H), 2.31 (t, J = 7.3 Hz, 2H), 2.01-2.07 (m, 4H), 1.94 (s, 6H), 1.90 (quint, J = 7.3 Hz, 2H), 1.57-1.68 (m, 10H), 1.21-1.41 (br m, 44H), 0.88 (t, J = 6.8 Hz, 6H).

[0143] dA5Z15Z ij dA5Z15Z-3JCl (Compound 11):

[0144] 11H NMR (400 MHz, CDCl3) δ 9.76 (t, J = 2.0 Hz, 1H), 9.04 (br s, 1H), 8.28 (br d, J = 5.2 Hz, 2H), 5.32-5.37 (m, 2H), 4.42 (t, J = 5.0 Hz, 2H), 4.35 (t, J = 5.0 Hz, 2H), 4.13 (t, J = 7.1 Hz, 2H), 3.52 (t, J = 6.8 Hz, 2H), 3.49 (t, J = 6.8 Hz, 2H), 2.97 (t, J = 7.5 Hz, 2H), 2.81 (br d, J = 5.2 Hz, 3H), 2.75 (t, J = 7.4 Hz, 2H), 2.56 (td, J = 7.2, 2.0 Hz, 2H), 2.35 (t, J = 7.3 Hz, 2H), 2.30 (t, J = 7.3 Hz, 2H), 2.00-2.06 (m, 4H), 1.93 (s, 6H), 1.64-1.70 (m, 4H), 1.56-1.63 (m, 8H), 1.38-1.44 (quint, J = 7.3 Hz, 2H), 1.21-1.40 (br m, 48H), 0.88 (t, J = 6.8 Hz, 6H).

[0145] dA4Z 2 18Hz2-JCl (Compound 12):

[0146] 1¹H NMR (400 MHz, CDCl₃) δ 9.77 (t, J = 2.0 Hz, 1H), 8.98 (br s, 1H), 8.22 (d, J = 5.3 Hz, 2H), 4.39 (t, J = 5.0 Hz, 4H), 4.12 (t, J = 7.1 Hz, 2H), 3.50 (t, J = 6.8 Hz, 4H), 2.95 (t, J = 7.5 Hz, 2H), 2.79 (d, J = 5.3 Hz, 3H), 2.72 (t, J = 7.4 Hz, 2H), 2.55 (td, J = 7.2, 2.0 Hz, 2H), 2.33 (t, J = 7.3 Hz, 2H), 2.27 (t, J = 7.3 Hz, 2H), 1.92 (s, 6H), 1.56-1.65 (m, 12H), 1.36-1.43 (m, 4H), 1.20-1.34 (br m, 62H), 0.88 (t, J = 6.8 Hz, 6H).

[0147] dA4Z 2 ¹⁸Hz ³-JCl (Compound 13):

[0148] 1 ¹H NMR (400 MHz, CDCl₃) δ 9.77 (t, J = 2.0 Hz, 1H), 8.96 (br s, 1H), 8.20 (d, J = 5.3 Hz, 2H), 4.39 (t, J = 5.0 Hz, 4H), 4.12 (t, J = 7.1 Hz, 2H), 3.50 (t, J = 6.8 Hz, 4H), 2.95 (t, J = 7.5 Hz, 2H), 2.78 (d, J = 5.3 Hz, 3H), 2.72 (t, J = 7.4 Hz, 2H), 2.55 (td, J = 7.2, 2.0 Hz, 2H), 2.32 (t, J = 7.3 Hz, 2H), 2.27 (t, J = 7.3 Hz, 2H), 1.92 (s, 6H), 1.55-1.65 (m, 12H), 1.35-1.42 (m, 4H), 1.20-1.33 (br m, 64H), 0.88 (t, J = 6.8 Hz, 6H).

[0149] dA5Z2 18Hz3-JCl (compound 14):

[0150] 1 ¹H NMR (400 MHz, CDCl₃) δ 9.77 (t, J = 2.0 Hz, 1H), 8.94 (br s, 1H), 8.18 (d, J = 5.3 Hz, 2H), 4.38 (t, J = 5.0 Hz, 4H), 4.12 (t, J = 7.1 Hz, 2H), 3.49 (t, J = 6.8 Hz, 4H), 2.94 (t, J = 7.5 Hz, 2H), 2.78 (d, J = 5.3 Hz, 3H), 2.71 (t, J = 7.4 Hz, 2H), 2.55 (td, J = 7.2, 2.0 Hz, 2H), 2.32 (t, J = 7.3 Hz, 2H), 2.26 (t, J = 7.3 Hz, 2H), 1.92 (s, 6H), 1.55-1.64 (m, 12H), 1.35-1.42 (m, 4H), 1.20-1.33 (br m, 66H), 0.88 (t, J = 6.8 Hz, 6H).

[0151] dA3Z ij 2 18Hz3-JCl (compound 15):

[0152] 11H NMR (400 MHz, CDCl3) δ 9.78 (t, J = 2.0 Hz, 1H), 9.00 (br s, 1H), 8.24 (d, J = 5.3 Hz, 2H), 5.33-5.38 (m, 2H), 5.30-5.34 (m, 2H), 4.41 (t, J = 5.0 Hz, 2H), 4.37 (t, J = 5.0 Hz, 2H), 4.13 (t, J = 7.1 Hz, 2H), 3.52 (t, J = 6.8 Hz, 2H), 3.50 (t, J = 6.8 Hz, 2H), 2.96 (t, J = 7.5 Hz, 2H), 2.80 (d, J = 5.3 Hz, 3H), 2.73 (t, J = 7.4 Hz, 2H), 2.56 (td, J = 7.2, 2.0 Hz, 2H), 2.34 (t, J = 7.3 Hz, 2H), 2.28 (t, J = 7.3 Hz, 2H), 2.00-2.06 (m, 8H), 1.93 (s, 6H), 1.56-1.66 (m, 12H), 1.36-1.43 (m, 4H), 1.20-1.34 (br m, 46H), 0.88 (t, J = 6.8 Hz, 6H).

[0153] dA4Z ij 2 18Hz3-JCl (Compound 16):

[0154] 1¹H NMR (400 MHz, CDCl₃) δ 9.79 (t, J = 2.0 Hz, 1H), 8.98 (br s, 1H), 8.22 (d, J = 5.3 Hz, 2H), 5.32-5.37 (m, 2H), 5.30-5.34 (m, 2H), 4.40 (t, J = 5.0 Hz, 2H), 4.37 (t, J = 5.0 Hz, 2H), 4.12 (t, J = 7.1 Hz, 2H), 3.51 (t, J = 6.8 Hz, 2H), 3.49 (t, J = 6.8 Hz, 2H), 2.95 (t, J = 7.5 Hz, 2H), 2.79 (d, J = 5.3 Hz, 3H), 2.72 (t, J = 7.4 Hz, 2H), 2.55 (td, J = 7.2, 2.0 Hz, 2H), 2.33 (t, J = 7.3 Hz, 2H), 2.28 (t, J = 7.3 Hz, 2H), 2.00-2.06 (m, 8H), 1.92 (s, 6H), 1.55-1.65 (m, 12H), 1.35-1.42 (m, 4H), 1.20-1.33 (br m, 48H), 0.88 (t, J = 6.8 Hz, 6H).

[0155] dA5Z ij 2 18Hz3-JCl (Compound 17):

[0156] 11H NMR (400 MHz, CDCl3) δ 9.78 (t, J = 2.0 Hz, 1H), 8.96 (br s, 1H), 8.20 (d, J = 5.3 Hz, 2H), 5.32-5.36 (m, 2H), 5.30-5.34 (m, 2H), 4.40 (t, J = 5.0 Hz, 2H), 4.37 (t, J = 5.0 Hz, 2H), 4.12 (t, J = 7.1 Hz, 2H), 3.51 (t, J = 6.8 Hz, 2H), 3.49 (t, J = 6.8 Hz, 2H), 2.95 (t, J = 7.5 Hz, 2H), 2.78 (d, J = 5.3 Hz, 3H), 2.72 (t, J = 7.4 Hz, 2H), 2.55 (td, J = 7.2, 2.0 Hz, 2H), 2.32 (t, J = 7.3 Hz, 2H), 2.27 (t, J = 7.3 Hz, 2H), 1.99-2.05 (m, 8H), 1.92 (s, 6H), 1.55-1.64 (m, 12H), 1.35-1.42 (m, 4H), 1.20-1.33 (br m, 50H), 0.88 (t, J = 6.8 Hz, 6H).

[0157] dA3Z15Z ij 18Hz1-JCl (Compound 18):

[0158] 11H NMR (400 MHz, CDCl3) δ 9.76 (t, J = 2.0 Hz, 1H), 9.07 (br s, 1H), 8.30 (br d, J = 5.2 Hz, 2H), 5.33-5.38 (m, 2H), 4.43 (t, J = 5.0 Hz, 2H), 4.36 (t, J = 5.0 Hz, 2H), 4.14 (t, J = 7.1 Hz, 2H), 3.53 (t, J = 6.8 Hz, 2H), 3.50 (t, J = 6.8 Hz, 2H), 2.98 (t, J = 7.5 Hz, 2H), 2.82 (br d, J = 5.2 Hz, 3H), 2.76 (t, J = 7.4 Hz, 2H), 2.57 (td, J = 7.2, 2.0 Hz, 2H), 2.38 (t, J = 7.3 Hz, 2H), 2.31 (t, J = 7.3 Hz, 2H), 2.01-2.07 (m, 4H), 1.94 (s, 6H), 1.57-1.68 (m, 10H), 1.21-1.41 (br m, 50H), 0.88 (t, J = 6.8 Hz, 6H).

[0159] dA4Z15Z ij 18Hz1-JCl (Compound 19):

[0160] 1<text>H NMR (400 MHz, CDCl3) δ 9.78 (t, J=2.4 Hz, 1H), 9.10-9.30 (br s, 1H), 8.20-8.60 (br s, 2H), 5.33-5.38 (m, 2H), 4.41 (t, J=5.1 Hz, 2H), 4.34 (t, J=5.1 Hz, 2H), 4.13 (t, J=7.0 Hz, 2H), 3.52 (t, J=6.8 Hz, 2H), 3.49 (t, J=6.8 Hz, 2H), 2.96 (t, J=7.6 Hz, 2H), 2.81 (br s, 3H), 2.76 (t, J=7.4 Hz, 2H), 2.56 (td, J=7.2, 2.4 Hz, 2H), 2.32 (t, J=7.3 Hz, 4H), 2.01-2.06 (m, 4H), 1.93 (s, 6H), 1.63-1.68 (m, 4H), 1.52-1.58 (m, 4H), 1.20-1.45 (br m, 54H), 0.88 (t, J=6.8 Hz, 6H).< / text>

[0161] dA4Z15Z ij <text>18Hz2-JCl (Compound 20):< / text>

[0162] 11H NMR (400 MHz, CDCl3) δ 9.76 (t, J = 2.3 Hz, 1H), 9.02-9.18 (br s, 1H), 8.15-8.45 (br d, J = 5.0 Hz, 2H), 5.31-5.39 (m, 2H), 4.42 (t, J = 5.1 Hz, 2H), 4.35 (t, J = 5.1 Hz, 2H), 4.14 (t, J = 7.1 Hz, 2H), 3.53 (t, J = 6.8 Hz, 2H), 3.50 (t, J = 6.8 Hz, 2H), 2.97 (t, J = 7.5 Hz, 2H), 2.81 (br d, J = 5.0 Hz, 3H), 2.77 (t, J = 7.3 Hz, 2H), 2.57 (td, J = 7.2, 2.3 Hz, 2H), 2.33 (t, J = 7.3 Hz, 4H), 2.02-2.08 (m, 4H), 1.94 (s, 6H), 1.65-1.70 (m, 4H), 1.53-1.59 (m, 4H), 1.22-1.42 (br m, 56H), 0.88 (t, J = 6.8 Hz, 6H).

[0163] dA4Z15Z ij 18Hz3-JCl (Compound 21):

[0164] 1¹H NMR (400 MHz, CDCl₃) δ 9.79 (t, J = 2.3 Hz, 1H), 9.08 (br s, 1H), 8.28 (br d, J = 5.1 Hz, 2H), 5.32-5.40 (m, 2H), 4.42 (t, J = 5.0 Hz, 2H), 4.35 (t, J = 5.0 Hz, 2H), 4.14 (t, J = 7.1 Hz, 2H), 3.53 (t, J = 6.8 Hz, 2H), 3.50 (t, J = 6.8 Hz, 2H), 2.97 (t, J = 7.5 Hz, 2H), 2.82 (br d, J = 5.1 Hz, 3H), 2.77 (t, J = 7.3 Hz, 2H), 2.57 (td, J = 7.2, 2.3 Hz, 2H), 2.35 (t, J = 7.3 Hz, 2H), 2.30 (t, J = 7.3 Hz, 2H), 2.02-2.08 (m, 4H), 1.94 (s, 6H), 1.63-1.70 (m, 8H), 1.22-1.42 (br m, 58H), 0.88 (t, J = 6.8 Hz, 6H).

[0165] dA3Z18Z ij / lm 18Hz1-JCl (Compound 22):

[0166] 11H NMR (400 MHz, CDCl3) δ 9.77 (t, J = 2.3 Hz, 1H), 9.06 (br s, 1H), 8.29 (br d, J = 5.1 Hz, 2H), 5.30-5.43 (m, 4H), 4.43 (t, J = 5.0 Hz, 2H), 4.34 (t, J = 5.0 Hz, 2H), 4.14 (t, J = 7.1 Hz, 2H), 3.54 (t, J = 6.8 Hz, 2H), 3.49 (t, J = 6.8 Hz, 2H), 2.97 (t, J = 7.5 Hz, 2H), 2.82 (br d, J = 5.1 Hz, 3H), 2.72-2.80 (m, 4H), 2.57 (td, J = 7.2, 2.3 Hz, 2H), 2.35 (t, J = 7.3 Hz, 2H), 2.30 (t, J = 7.3 Hz, 2H), 2.01-2.08 (m, 4H), 1.94 (s, 6H), 1.62-1.71 (m, 8H), 1.22-1.42 (br m, 52H), 0.88 (t, J = 6.8 Hz, 6H).

[0167] dA3Z18Z ij / lm 18Hz2-JCl (Compound 23):

[0168] 11H NMR (400 MHz, CDCl3) δ 9.79 (t, J = 2.3 Hz, 1H), 9.04 (br s, 1H), 8.27 (br d, J = 5.1 Hz, 2H), 5.30-5.42 (m, 4H), 4.42 (t, J = 5.0 Hz, 2H), 4.34 (t, J = 5.0 Hz, 2H), 4.14 (t, J = 7.1 Hz, 2H), 3.53 (t, J = 6.8 Hz, 2H), 3.49 (t, J = 6.8 Hz, 2H), 2.97 (t, J = 7.5 Hz, 2H), 2.81 (br d, J = 5.1 Hz, 3H), 2.74-2.79 (m, 4H), 2.57 (td, J = 7.2, 2.3 Hz, 2H), 2.34 (t, J = 7.3 Hz, 2H), 2.30 (t, J = 7.3 Hz, 2H), 2.00-2.07 (m, 4H), 1.94 (s, 6H), 1.58-1.68 (m, 8H), 1.22-1.42 (br m, 54H), 0.88 (t, J = 6.8 Hz, 6H).

[0169] dA4Z18Z ij / lm 18Hz2-JCl (compound 24):

[0170] 11H NMR (400 MHz, CDCl3) δ 9.78 (t, J = 2.1 Hz, 1H), 9.12 (br s, 1H), 8.32 (br d, J = 5.2 Hz, 2H), 5.36-5.42 (m, 2H), 5.30-5.35 (m, 2H), 4.44 (t, J = 5.0 Hz, 2H), 4.32 (t, J = 5.0 Hz, 2H), 4.15 (t, J = 7.1 Hz, 2H), 3.54 (t, J = 6.8 Hz, 2H), 3.48 (t, J = 6.8 Hz, 2H), 2.98 (t, J = 7.5 Hz, 2H), 2.83 (br d, J = 5.2 Hz, 3H), 2.77 (quint, J = 7.2 Hz, 2H), 2.73 (t, J = 7.4 Hz, 2H), 2.58 (td, J = 7.2, 2.1 Hz, 2H), 2.36 (t, J = 7.3 Hz, 2H), 2.29 (t, J = 7.3 Hz, 2H), 2.03-2.09 (m, 2H), 1.98-2.03 (m, 2H), 1.95 (s, 6H), 1.59-1.69 (m, 8H), 1.22-1.42 (br m, 56H), 0.88 (t, J = 6.8 Hz, 6H).

[0171] dA5Z18Z ij / lm 18Hz2-JCl (compound 25):

[0172] 1¹H NMR (400 MHz, CDCl₃) δ 9.78 (t, J = 2.2 Hz, 1H), 9.08 (br s, 1H), 8.30 (br d, J = 5.0 Hz, 2H), 5.37-5.42 (m, 2H), 5.29-5.34 (m, 2H), 4.43 (t, J = 5.1 Hz, 2H), 4.33 (t, J = 5.1 Hz, 2H), 4.14 (t, J = 7.0 Hz, 2H), 3.53 (t, J = 6.8 Hz, 2H), 3.49 (t, J = 6.8 Hz, 2H), 2.97 (t, J = 7.6 Hz, 2H), 2.82 (br d, J = 5.0 Hz, 3H), 2.76 (quint, J = 7.1 Hz, 2H), 2.72 (t, J = 7.3 Hz, 2H), 2.57 (td, J = 7.2, 2.2 Hz, 2H), 2.35 (t, J = 7.3 Hz, 2H), 2.29 (t, J = 7.3 Hz, 2H), 2.04-2.09 (m, 2H), 1.99-2.04 (m, 2H), 1.94 (s, 6H), 1.58-1.68 (m, 8H), 1.22-1.42 (br m, 58H), 0.88 (t, J = 6.8 Hz, 6H).

[0173] dA5Z18Z ij / lm dA5Z18Z with 18 3-bond J-coupling to Cl (Compound 26):

[0174] 11H NMR (400 MHz, CDCl3) δ 9.78 (t, J = 2.1 Hz, 1H), 9.03 (br s, 1H), 8.26 (br d, J = 5.2 Hz, 2H), 5.38-5.43 (m, 2H), 5.28-5.33 (m, 2H), 4.44 (t, J= 5.1 Hz, 2H), 4.31 (t, J = 5.1 Hz, 2H), 4.13 (t, J = 7.0 Hz, 2H), 3.54 (t, J= 6.8 Hz, 2H), 3.47 (t, J = 6.8 Hz, 2H), 2.97 (t, J = 7.6 Hz, 2H), 2.81 (br d, J = 5.2 Hz, 3H), 2.76 (quint, J = 7.2 Hz, 2H), 2.71 (t, J = 7.4 Hz, 2H), 2.56 (td, J = 7.2, 2.1 Hz, 2H), 2.34 (t, J = 7.3 Hz, 2H), 2.27 (t, J = 7.3Hz, 2H), 2.03-2.08 (m, 2H), 1.97-2.02 (m, 2H), 1.93 (s, 6H), 1.56-1.66 (m, 8H), 1.21-1.41 (br m, 60H), 0.88 (t, J = 6.8 Hz, 6H).

[0175] dA5Z ij 18Z ij / lm 18Hz3-JCl (Compound 27):

[0176] 1H NMR (400 MHz, CDCl3) δ 9.78 (t, J = 2.2 Hz, 1H), 9.05 (br s, 1H), 8.28 (br d, J = 5.1 Hz, 2H), 5.38-5.43 (m, 2H), 5.33-5.38 (m, 2H), 5.28-5.33(m, 2H), 4.44 (t, J = 5.0 Hz, 2H), 4.32 (t, J = 5.0 Hz, 2H), 4.14 (t, J = 7.1Hz, 2H), 3.54 (t, J = 6.8 Hz, 2H), 3.48 (t, J = 6.8 Hz, 2H), 2.97 (t, J = 7.5Hz, 2H), 2.82 (br d, J = 5.1 Hz, 3H), 2.75-2.79 (m, 4H), 2.57 (td, J = 7.2,2.2 Hz, 2H), 2.35 (t, J = 7.3 Hz, 2H), 2.29 (t, J = 7.3 Hz, 2H), 2.01-2.08(m, 8H), 1.94 (s, 6H), 1.57-1.67 (m, 8H), 1.21-1.42 (br m, 52H), 0.88 (t, J =6.8 Hz, 6H).

[0177] Example 3: Preparation of LNPs based on imidazole amino acid-responsive biomimetic lipid compounds

[0178] Lipid nanoparticles (LNPs) were prepared by mixing the imidazole amino acid-responsive biomimetic lipid compounds 1-27 synthesized in Examples 1 and 2 with cholesterol.

[0179] First, the dA5Z15Z prepared in Example 1 was subjected to thin-film hydration. ij LNPs-1 were prepared by mixing 18Hz3-JCl (compound 1) with Chol.

[0180] dA5Z15Z ij 18Hz 3-JCl was completely dissolved in an organic mixed solvent of dichloromethane / acetonitrile (3:1, v / v), and a solution of 1.0 M hydrochloric acid in dioxane was added. The mixture was stirred at 5 °C for 1.5 h, and TLC was monitored until deprotection was complete. Afterwards, Chloro-3-JCl was added at a molar ratio of 1.7:1 (dA5Z15Z). ij18Hz3-JCl / Chol.) was added to the system and dissolved completely. After removing the organic solvent (containing acetone protecting groups) by rotary evaporation at 35°C, a semi-transparent film of mixed lipids was formed on the inner wall of the container. Subsequently, a small amount of anhydrous dichloromethane was added again to dissolve the semi-transparent film of mixed lipids, and rotary evaporation was again performed at 35°C to remove the organic solvent containing trace impurities, forming a deprotected dA5Z15Z layer on the inner wall of the container. ij A semi-transparent lipid membrane composed of 18Hz3-JCl and Chol. was prepared. An equal volume of the binary co-solvent (tetrahydrofuran / acetic acid-sodium acetate buffer (pH 5.5), 3:7 (v / v)) was added to a container, and the membrane was incubated at 45°C for 5 min, followed by vortexing for 1–3 min to fully hydrate the lipid membrane. This hydration process was repeated 22 times to obtain a turbid crude solution of lipid nanoparticles. After dialyzing with PBS buffer (pH 7.4), a solution based on dA5Z15Z was obtained. ij A lipid nanoparticle (LNPs-1) delivery system of 18Hz3-JCl and Chol.

[0181] Secondly, following the method described above, LNPs were prepared using each imidazole amino acid-responsive biomimetic lipid compound (compounds 2-27) from Table 1 and Chol. as raw materials. dA5Z15Z ij By replacing 18Hz3-JCl with compounds 2~27 in Table 1, and keeping other conditions unchanged, LNPs-2~LNPs-27 were prepared.

[0182] Comparative Example 1:

[0183] The imidazole amino acid-responsive biomimetic lipid compound dA5Z15Z from Example 3 was used. ij By replacing 18Hz3-JCl with the cationic lipid compound D-Lin-MC3-DMA (CAS:1224606-06-7) for drug delivery, and keeping other conditions unchanged, the LNPs of Comparative Example 1 can be obtained.

[0184] Example 4: Physicochemical and cytotoxic characterization of LNPs

[0185] The physicochemical properties and cytotoxicity of LNPs-1 to LNPs-27 prepared in Example 3 and LNPs prepared in Comparative Example 1 were characterized respectively.

[0186] (1) Physicochemical properties

[0187] The morphology of the prepared LNPs-1 to LNPs-27 and the LNPs of Comparative Example 1 were characterized by transmission electron microscopy (TEM). Figure 2 As shown, LNPs-1(dA5Z15Z) ijBoth LNPs (18Hz3-JCl / Chol.) and LNPs (D-Lin-MC3-DMA / Chol.) of Comparative Example 1 exhibited relatively complete spherical vesicle morphology with no significant changes. The structures of LNPs-2 to LNPs-27 were similar to those of LNPs-1, also possessing complete spherical vesicle structures.

[0188] In addition, the average particle size and zeta potential of LNPs-1 to LNPs-27 and the LNPs of Comparative Example 1 were characterized by nanoflow cytometry (NanoFCM) and zeta potential analyzer (ZetaPALS), respectively. The characterization results are shown in Table 2.

[0189] Table 2

[0190]

[0191]

[0192] As shown in Table 2, the average particle size of LNPs-1 to LNPs-27 ranges from 131.0 to 140.9 nm, and the median zeta potential ranges from 32.0 to 37.8 mV. In contrast, the average particle size of the LNPs in Comparative Example 1 is 187.2 nm, and the median zeta potential is 19.6 mV. Compared with the LNPs based on imidazole amino acid-responsive biomimetic lipid compounds, the average particle size of the LNPs in Comparative Example 1 is significantly larger, and the median zeta potential is significantly lower.

[0193] (2) Cytotoxicity

[0194] The cytotoxicity of LNPs-1 to LNPs-27 and the LNPs in Comparative Example 1 was further evaluated using the MTT assay in human glioma cells U-118MG. U-118MG cells were cultured in DMEM medium containing 10% fetal bovine serum and seeded at a density of 3000 cells / well in 96-well plates, incubated for 24 h at 5% CO2 and 37°C. Then, different concentrations of various LNPs were added to each well, resulting in a final concentration of 1 × 10⁻⁶. 7 LNPs / mL, 5×10 7 LNPs / mL, 1×10 8 LNPs / mL, 5×10 8 LNPs / mL, 1×10 9 LNPs / mL, 2×10 9 LNPs / mL and 5×10 9LNPs were added at a concentration of 1 / mL, and incubation continued for 24 h. Afterward, 5 mg / mL MTT reagent was added to each well, and incubation continued for 4 h. The culture medium was then discarded, and 150 μL of DMSO was added to each well. After shaking for 10 min, the absorbance of each well was measured at 570 nm using a microplate reader. U-118MG cells without added LNPs were used as a negative control, and cell viability was calculated. If cell viability was greater than 80%, this type of LNP was considered non-cytotoxic.

[0195] The test results are shown in Table 2. No significant cytotoxicity was observed in LNPs-1 to LNPs-27 and the LNPs in Comparative Example 1.

[0196] Example 5: Preparation of drug-loaded LNPs based on imidazole acid-responsive biomimetic lipid compounds loaded with small molecule drugs

[0197] The imidazole amino acid-responsive biomimetic lipid compounds 1-27 synthesized in Examples 1 and 2 were mixed with Chol. to load small molecule chemical drugs, forming drug-loaded LNPs.

[0198] First, the dA5Z15Z prepared in Example 1 was subjected to thin-film hydration. ij 18Hz3-JCl (compound 1) was mixed with Chol to prepare drug-loaded LNPs loaded with the antitumor small molecule drug paclitaxel (PTX, CAS:33069-62-4).

[0199] dA5Z15Z ij 18Hz 3-JCl was completely dissolved in an organic mixed solvent of dichloromethane / acetonitrile (3:1, v / v), and a solution of 1.0 M hydrochloric acid in dioxane was added. The mixture was stirred at 5 °C for 1.5 h, and TLC was monitored until deprotection was complete. Afterwards, Chloro-3-JCl was added at a molar ratio of 2.2:1 (dA5Z15Z). ij 18Hz3-JCl / Chol.) was added to the system and dissolved completely. After removing the organic solvent (containing acetone protecting groups) by rotary evaporation at 35°C, a semi-transparent film of mixed lipids was formed on the inner wall of the container. Subsequently, a small amount of anhydrous dichloromethane was added again to dissolve the semi-transparent film of mixed lipids, and rotary evaporation was again performed at 35°C to remove the organic solvent containing trace impurities, forming a deprotected dA5Z15Z layer on the inner wall of the container. ij A semi-transparent lipid film composed of 18Hz 3-JCl and Chol. PTX was fully dissolved in a binary co-solvent (tetrahydrofuran / acetic acid-sodium acetate buffer (pH 5.5), 3:7 (v / v)) at a molar ratio of 2.2:1 (dA5Z15Z). ij18Hz 3-JCl / PTX was added to the container, and the mixture was incubated at 45°C for 5 min, followed by vortexing for 1–3 min to fully hydrate the lipid film. This hydration process was repeated 30 times to obtain a turbid crude solution of drug-loaded lipid nanoparticles. After purification by dialysis with PBS buffer (pH 7.4), dA5Z15Z-based products were obtained. ij 18Hz 3-JCl and Chol. loaded PTX LNPs: PTX@dA5Z15Z ij 18Hz3-JCl / Chol. (PTX@LNPs-1).

[0200] Secondly, following the above method, drug-loaded LNPs were prepared using each imidazole amino acid-responsive biomimetic lipid compound (compounds 2-27) from Table 1 and Chol. as raw materials. dA5Z15Z ij Replace 18Hz3-JCl with compounds 2~27 in Table 1, and keep other conditions unchanged to prepare PTX@LNPs-2~PTX@LNPs-27.

[0201] Comparative Example 2:

[0202] The imidazole amino acid-responsive biomimetic lipid compound dA5Z15Z from Example 5 ij By replacing 18Hz3-JCl with the cationic lipid compound D-Lin-MC3-DMA, and keeping other conditions unchanged, drug-loaded LNPs loaded with PTX, as in Comparative Example 2, were obtained: PTX@D-Lin-MC3-DMA / Chol.

[0203] Example 6: Preparation of drug-loaded LNPs based on imidazole acid-responsive biomimetic lipid compounds loaded with peptide drugs

[0204] The imidazole amino acid-responsive biomimetic lipid compounds 1-27 synthesized in Examples 1 and 2 were mixed with Chol. to load peptide drugs, forming drug-loaded LNPs.

[0205] First, the dA5Z15Z prepared in Example 1 was processed using a high-throughput microfluidic system. ij 18Hz3-JCl (compound 1) was mixed with Chol to prepare drug-loaded LNPs loaded with chlortoxin (CLTX, CAS:163515-35-3), a natural active polypeptide drug for the treatment of glioma.

[0206] dA5Z15Z ij18Hz 3-JCl was completely dissolved in an organic mixed solvent of dichloromethane / acetonitrile (3:1, v / v), and a solution of 1.0 M hydrochloric acid in dioxane was added. The mixture was stirred at 5 °C for 1.5 h, and TLC was monitored until deprotection was complete. Afterwards, Chloro-3-JCl was added at a molar ratio of 2.2:1 (dA5Z15Z). ij 18Hz3-JCl / Chol.) was added to the system and dissolved completely. After removing the organic solvent (containing acetone protecting groups) by rotary evaporation at 35°C, a semi-transparent film of mixed lipids was formed on the inner wall of the container. Subsequently, a small amount of anhydrous dichloromethane was added again to dissolve the semi-transparent film of mixed lipids, and rotary evaporation was again performed at 35°C to remove the organic solvent containing trace impurities, forming a deprotected dA5Z15Z layer on the inner wall of the container. ij A semi-transparent binary lipid film composed of 18Hz3-JCl and Chol. was formed. Tetrahydrofuran was then added to the container to completely dissolve the semi-transparent binary lipid film, forming a deprotected dA5Z15Z. ij A binary lipid organic phase composed of 18Hz3-JCl and Chloro. was formed; CLTX was dissolved in acetate-sodium acetate buffer (pH 5.5) to form the aqueous phase of the drug. The molar ratio was 17:1 (dA5Z15Z). ij A crude solution of drug-loaded lipid nanoparticles (18Hz 3-JCl / CLTX) was prepared by rapidly mixing the binary lipid organic phase and the drug aqueous phase at a flow rate ratio of 1:3 and a volume ratio of 1:3 using an automated high-throughput microfluidic system at 45 °C through a microfluidic chip at a mixing rate of 12 mL / min. This yielded a solution of CLTX-loaded lipid nanoparticles. After purification by dialysis with PBS buffer (pH 7.4), dA5Z15Z-based nanoparticles were obtained. ij 18Hz 3-JCl and Chol. Loaded CLTX LNPs: CLTX@ dA5Z15Z ij 18Hz3-JCl / Chol. (CLTX@LNPs-1).

[0207] Secondly, following the above method, drug-loaded LNPs were prepared using each imidazole amino acid-responsive biomimetic lipid compound (compounds 2-27) from Table 1 and Chol. as raw materials. dA5Z15Z ij 18Hz3-JCl was replaced with compounds 2~27 in Table 1, and other conditions remained unchanged to prepare CLTX@LNPs-2~CLTX@LNPs-27.

[0208] Comparative Example 3:

[0209] The imidazole amino acid-responsive biomimetic lipid compound dA5Z15Z from Example 5 ijBy replacing 18Hz3-JCl with the cationic lipid compound D-Lin-MC3-DMA, and keeping other conditions unchanged, drug-loaded LNPs loaded with CLTX, as in Comparative Example 3, were obtained: CLTX@D-Lin-MC3-DMA / Chol.

[0210] Example 7: Preparation of drug-loaded LNPs based on imidazole acid-responsive biomimetic lipid compounds loaded with small nucleic acid drugs

[0211] The imidazole amino acid-responsive biomimetic lipid compounds 1-27 synthesized in Examples 1 and 2 were mixed with Chol. to load small nucleic acid drugs, forming drug-loaded LNPs.

[0212] First, the dA5Z15Z prepared in Example 1 was processed using a high-throughput microfluidic system. ij 18Hz3-JCl (compound 1) was mixed with Chol to prepare drug-loaded LNPs loaded with the anti-glioma small nucleic acid drug miR-329 (sequence AACACACCUGGUUAACCUCU UU, SEQ ID No. 1).

[0213] dA5Z15Z ij 18Hz 3-JCl was completely dissolved in an organic mixed solvent of dichloromethane / acetonitrile (3:1, v / v), and a solution of 1.0 M hydrochloric acid in dioxane was added. The mixture was stirred at 5 °C for 1.5 h, and TLC was monitored until deprotection was complete. Afterwards, Chloro-3-JCl was added at a molar ratio of 2.2:1 (dA5Z15Z). ij 18Hz3-JCl / Chol.) was added to the system and dissolved completely. After removing the organic solvent (containing acetone protecting groups) by rotary evaporation at 35°C, a semi-transparent film of mixed lipids was formed on the inner wall of the container. Subsequently, a small amount of anhydrous dichloromethane was added again to dissolve the semi-transparent film of mixed lipids, and rotary evaporation was again performed at 35°C to remove the organic solvent containing trace impurities, forming a deprotected dA5Z15Z layer on the inner wall of the container. ij A semi-transparent binary lipid film composed of 18Hz3-JCl and Chol. was formed. Tetrahydrofuran was then added to the container to completely dissolve the semi-transparent binary lipid film, forming a deprotected dA5Z15Z. ij A binary lipid organic phase composed of 18Hz3-JCl and Chol. was formed; miR-329 was dissolved in acetate-sodium acetate buffer (pH 5.5) to form the aqueous phase of the drug. The molar ratio was 13:1 (dA5Z15Z). ijA crude solution of drug-loaded lipid nanoparticles (18Hz 3-JCl / miR-329) was prepared by rapidly mixing the binary lipid organic phase and the drug aqueous phase at a flow rate ratio of 1:3 and a volume ratio of 1:3 using an automated high-throughput microfluidic system at 45 °C through a microfluidic chip at a mixing rate of 12 mL / min. This yielded a solution of drug-loaded lipid nanoparticles containing miR-329. After purification by dialysis with PBS buffer (pH 7.4), dA5Z15Z-based nanoparticles were obtained. ij 18Hz 3-JCl and Chol. loaded miR-329 LNPs: miR-329@ dA5Z15Z ij 18Hz3-JCl / Chol. (miR-329@LNPs-1).

[0214] Secondly, following the above method, drug-loaded LNPs were prepared using each imidazole amino acid-responsive biomimetic lipid compound (compounds 2-27) from Table 1 and Chol. as raw materials. dA5Z15Z ij Replacing 18Hz3-JCl with compounds 2~27 from Table 1, and keeping other conditions unchanged, yielded miR-329@LNPs-2~miR-329@LNPs-27.

[0215] Comparative Example 4:

[0216] The imidazole amino acid-responsive biomimetic lipid compound dA5Z15Z from Example 5 ij By replacing 18Hz3-JCl with the cationic lipid compound D-Lin-MC3-DMA, and keeping other conditions unchanged, drug-loaded LNPs loaded with miR-329, as described in Comparative Example 4, were obtained: miR-329@D-Lin-MC3-DMA / Chol.

[0217] Example 8: Encapsulation efficiency characterization of LNPs delivery system loaded with small molecule drugs

[0218] 1% Triton X-100 was added to each group of drug-loaded LNPs in Example 5 and Comparative Example 2, and the mixture was incubated in PBS buffer at 25°C for 15 min to release the PTX encapsulated in the drug-loaded LNPs. The PTX content encapsulated in PTX@LNPs-1~PTX@LNPs-27 in Example 5 and PTX@D-Lin-MC3-DMA / Chol. in Comparative Example 2 was determined by HPLC, and the encapsulation efficiency of PTX by each group of drug-loaded LNPs was calculated. The results are shown in Table 3.

[0219] Table 3

[0220]

[0221] As shown in Table 3, the encapsulation efficiency of PTX by PTX@LNPs-1 to PTX@LNPs-27 in Example 5 ranges from 45.9% to 84.5%. Among them, based on dA5Z15Z... ij Drug-loaded LNPs in 18Hz 3-JCl: PTX@LNPs-1 achieved the highest encapsulation efficiency for PTX (84.5%). In contrast, the encapsulation efficiency of PTX@D-Lin-MC3-DMA / Chol. in Comparative Example 2 was only 30.5%, far lower than the encapsulation efficiency of PTX@LNPs-1~PTX@LNPs-27 for PTX.

[0222] Example 9: Encapsulation efficiency characterization of LNPs delivery system loaded with peptide drugs

[0223] 1% Triton X-100 was added to each group of drug-loaded LNPs in Example 6 and Comparative Example 3, and the mixture was incubated in PBS buffer at 25°C for 15 min to release the CLTX encapsulated by the drug-loaded LNPs. The CLTX content encapsulated in CLTX@LNPs-1~CLTX@LNPs-27 in Example 6 and CLTX@D-Lin-MC3-DMA / Chol. in Comparative Example 3 was determined by HPLC, and the encapsulation efficiency of CLTX by each group of drug-loaded LNPs was calculated. The results are shown in Table 3.

[0224] As shown in Table 3, the encapsulation efficiency of CLTX@LNPs-1 to CLTX@LNPs-27 for CLTX in Example 6 ranges from 53.0% to 81.1%. Among them, based on dA5Z15Z... ij Drug-loaded LNPs in 18Hz 3-JCl: CLTX@LNPs-1 achieved the highest encapsulation efficiency for CLTX (81.1%). In contrast, the encapsulation efficiency of CLTX@D-Lin-MC3-DMA / Chol. in Comparative Example 3 was only 19.7%, far lower than the encapsulation efficiency of PTX by CLTX@LNPs-1~CLTX@LNPs-27.

[0225] Example 10: Encapsulation efficiency characterization of LNPs delivery system loaded with small nucleic acid drugs

[0226] First, miR-329 was labeled with 5-carboxyfluorescein (5-FAM), denoted as (5-FAM)-miR-329. Examples 7 and 4 were repeated to prepare drug-loaded LNPs containing (5-FAM)-miR-329. The content of (5-FAM)-miR-329 encapsulated in each group of drug-loaded LNPs was then determined by fluorescence spectrophotometry (excitation / emission wavelengths: 488 nm / 525 nm). The encapsulation efficiency of miR-329 in each group of drug-loaded LNPs in Examples 7 and 4 was calculated, and the results are shown in Table 3.

[0227] As shown in Table 3, the encapsulation efficiency of miR-329 by miR-329@LNPs-1 to miR-329@LNPs-27 in Example 7 ranges from 60.4% to 85.5%. Among them, based on dA5Z15Z... ij The drug-loaded LNPs in 18Hz 3-JCl: miR-329@LNPs-1 achieved the highest encapsulation efficiency for miR-329 (85.5%). In contrast, the encapsulation efficiency of miR-329@D-Lin-MC3-DMA / Chol. in Comparative Example 4 was only 43.7%, far lower than the encapsulation efficiency of miR-329@LNPs-1 to miR-329@LNPs-27 for miR-329.

[0228] Example 11: Regulation of transmembrane resistance in a blood-brain barrier model by imidazole amino acid-responsive biomimetic lipid compounds

[0229] This embodiment characterizes the dynamic regulation of transmembrane resistance in an in vitro blood-brain barrier model by using LNPs-1 to LNPs-27 prepared in Example 3 and LNPs prepared in Comparative Example 1 as delivery systems.

[0230] HCMEC / D3 immortalized human brain microvascular endothelial cells were cultured in ECM medium containing 5% fetal bovine serum and seeded at a density of 50,000 cells / well in Transwell chambers. TM Collagen-coated polycarbonate membrane (0.4 µm pore size and 0.33 cm² growth area) in No. 3413 Costar. 2 Replace the medium with fresh ECM medium containing 5% fetal bovine serum and continue culturing for 2-3 days. Then replace the medium with DMEM / F12 serum-free medium containing 550 nM hydrocortisone and continue culturing for two more days at 5% CO2 and 37°C until the HCMEC / D3 cell monolayers fuse to form a barrier model.

[0231] The transmembrane resistance (TEER) of the HCMEC / D3 cell barrier formed above was measured using a CellZscope II real-time cell dynamics analyzer (nanoAnalytic, Germany). The test module and serum-free DMEM / F12 medium containing 550 nM hydrocortisone were preheated at 5% CO2 and 37°C for 1 h. 1.2 mL of DMEM / F12 serum-free medium was added to each metal chamber of the test module. After transferring the transwell chambers to the metal chambers of the test module, the TEER in each transwell chamber was measured at a rate of one chamber / min under 5% CO2 and 37°C. The results showed that the TEER of each chamber was greater than 300 Ω·cm.2 This indicates that the fused HCMEC / D3 cell monolayer possesses barrier function, and the in vitro blood-brain barrier model has been successfully constructed, which can be used for experiments on the dynamic regulation of the blood-brain barrier.

[0232] The LNPs-1 to LNPs-27 prepared in Example 3 and the LNPs prepared in Comparative Example 1 were added to each Transwell cell, and the TEER of each cell was measured according to the above method. The real-time changes within 24 hours were observed. The maximum amplitude of TEER downregulation, the corresponding time, and the recovery window for each group were recorded, as shown in Table 4. Among them, LNPs-1 (dA5Z15Z) ij 18Hz3-JCl / Chol.), LNPs-4(dA4Z 2 15Hz3-JCl / Chol.), LNPs-10(dA5Z15Z ij 15Hz1-JCl / Chol.), LNPs-15(dA3Z ij 2 18Hz3-JCl / Chol.), LNPs-25(dA5Z18Z ij / lm Real-time dynamic changes of TEER mediated by 18Hz 2-JCl / Chol. and Comparative Example 1 (D-Lin-MC3-DMA / Chol.) are as follows: Figure 3 As shown.

[0233] Table 4

[0234]

[0235] (*The TEER recovery window is the time interval when the TEER recovery level is ≥95%)

[0236] Table 4 shows that LNPs-1 to LNPs-27 prepared in Example 3 all mediated the downregulation of TEER in the in vitro blood-brain barrier model constructed from HCMEC / D3 cells, with the TEER reduction ranging from 35.2% to 55.8%. Among them, LNPs-1 (dA5Z15Z) ij In the 18Hz 3-JCl / Chol.-mediated model, the TEER showed a maximum decrease of 55.8% (maximum value) at 4.5 h. In other LNP-mediated models, the maximum TEER decrease occurred within 4–6 h. In contrast, no significant downregulation of TEER was observed after LNP-mediated modeling in Comparative Example 1. Table 4 shows that LNPs-1 to LNPs-27, composed of imidazole amino acid-responsive biomimetic lipid compounds prepared in Examples 1 and 2, can dynamically regulate the TEER in the in vitro blood-brain barrier model, thus possessing the potential to dynamically regulate the degree of blood-brain barrier opening in vivo.

[0237] In addition, LNPs-1(dA5Z15Z) in Table 4 ij 18Hz3-JCl / Chol.), LNPs-4(dA4Z 2 15Hz3-JCl / Chol.), LNPs-10(dA5Z15Z ij 15Hz1-JCl / Chol.), LNPs-15(dA3Z ij 2 18Hz3-JCl / Chol.), LNPs-25(dA5Z18Z ij / lm Real-time dynamic changes in TEER mediated by 18Hz 2-JCl / Chol., such as Figure 3 As shown in the figure, all LNPs mediated the downregulation of TEER in the in vitro blood-brain barrier model constructed from HCMEC / D3 cells, and the TEER level was almost completely restored within 24 h, with the TEER recovery window ranging from 3.6 to 5.9 h (Table 4). In contrast, no significant downregulation of TEER was observed in the in vitro blood-brain barrier model mediated by D-Lin-MC3-DMA / Chol. in Comparative Example 1.

[0238] In summary, it can be demonstrated that the LNPs-1 to LNPs-27 delivery system, composed of imidazole amino acid-responsive biomimetic lipid compounds 1 to 27, can mediate the largest reduction in TEER (35.2% to 55.8%) in the extracorporeal blood-brain barrier model within 4 to 6 hours, and can regulate TEER to essentially return to pre-mediation levels within 3.6 to 5.9 hours. Among these, the imidazole amino acid-responsive biomimetic lipid compound dA5Z15Z... ij LNPs-1(dA5Z15Z) composed of 18Hz 3-JCl and Chol. ij Under the mediation of 18Hz 3-JCl / Chol., TEER showed a maximum decrease of 55.8% (maximum value) at 4.5 h, and basically recovered to the pre-mediation level within 3.6 h.

[0239] Example 12: Regulation of blood-brain barrier permeability in a model by imidazole amino acid-responsive biomimetic lipid compounds

[0240] Based on the results of Example 11, this example characterizes the dynamic regulatory effect of LNPs-1 to LNPs-27 prepared in Example 3 and LNPs prepared in Comparative Example 1 as delivery systems on the permeability of an in vitro blood-brain barrier model.

[0241] An in vitro blood-brain barrier model based on HCMEC / D3 immortalized human brain microvascular endothelial cells was constructed according to the method described in Example 11 (the culture medium was replaced with phenol red-free DMEM / F12 serum-free medium). Subsequently, the TEER of each compartment was characterized as greater than 300 Ω·cm using a CellZscope II real-time cell dynamics analyzer. 2 This indicates that the in vitro blood-brain barrier model has been successfully constructed.

[0242] Following the method described in Example 11, LNPs-1~LNPs-27 prepared in Example 3 and LNPs prepared in Comparative Example 1 were added to each Transwell chamber. After 5 h, 300 µL of phenol red-free DMEM / F12 serum-free medium containing 15 µg / mL fluorescein sodium (SF, CAS: 518-47-8) was added to each chamber. After 30 min, the concentration of SF in each metal chamber of the test module was measured at Ex / Em: 488 / 525 nm using a microplate reader (FLUOstarOmega, BMG Labtech), and the flow rate (ΔQ) of SF was calculated based on the volume of medium in the metal chamber. The result was obtained using the following formula:

[0243]

[0244] (ΔQ / Δt: mass flow rate of SF, µg / s; C) d (0): Initial concentration of SF in the Transwell chamber, µg / mL; S: Membrane growth area within the Transwell chamber, cm² 2 )

[0245] Calculate the apparent permeability (P) of SF across the in vitro blood-brain barrier model. app (Table 4) characterizes the dynamic regulatory effect of LNPs-1 to LNPs-27 prepared in Example 3 and LNPs prepared in Comparative Example 1 on the permeability of the in vitro blood-brain barrier model.

[0246] Table 4 shows that the apparent permeation rates of SF across the in vitro blood-brain barrier model mediated by LNPs-1 to LNPs-27 ranged from 2.98 to 4.10 cm / s. Among them, LNPs-1 (dA5Z15Z...) ij Under 18Hz 3-JCl / Chol. mediation, the apparent permeation rate of SF reached a maximum of 4.10 cm / s. In contrast, the apparent permeation rate of SF mediated by LNPs prepared in Comparative Example 1 was 0.04 cm / s (D-Lin-MC3-DMA / Chol.), which is much lower than the results mediated by LNPs-1 to LNPs-27.

[0247] Combined with the results shown in Example 11, it is shown that the LNPs-1 to LNPs-27 delivery system composed of imidazole amino acid-responsive biomimetic lipid compounds prepared in Examples 1 and 2 can downregulate the TEER of the in vitro blood-brain barrier model, improve the permeability of the in vitro blood-brain barrier model, and mediate the recovery of barrier function to the pre-mediation level within a short time window, thus possessing the potential to dynamically and reversibly regulate the opening of the blood-brain barrier in vivo.

[0248] Example 13: Plasma stability of drug-loaded LNPs based on imidazole amino acid-responsive biomimetic lipid compounds

[0249] Based on the screening results in Examples 8-10, if and only if dA5Z15Z ij When 18Hz 3-JCl and Chol. are combined with PTX, CLTX, and miR-329 to form drug-loaded LNPs, the maximum encapsulation efficiency is observed. In this embodiment, PTX@dA5Z15Z is used. ij 18Hz 3-JCl / Chol. was added to rat plasma, and the plasma concentration of PTX was evaluated based on dA5Z15Z at different time points. ij Plasma stability of drug-loaded LNPs of 18Hz3-JCl and Chol.

[0250] PTX@dA5Z15Z was processed using ultrapure water. ij Dilute 18Hz 3-JCl / Chol to prepare a working solution with a drug concentration of 50 μM for test sample preparation. SD rat plasma was divided into two groups. 490 μL of each group was incubated at 37℃ for 5 min, then 10 μL of working solution was added and vortexed to mix (final drug concentration 1 μM). The mixture was incubated at 37℃ for 24 h. At time points of 0, 0.0833, 0.25, 1, 2, 4, 8, 12, 18, and 24 h, 50 μL of drug-containing plasma samples were collected and placed in EP tubes containing 350 μL of ice-cold acetonitrile containing the internal standard (ethoxybenzamide). The samples were vortexed for 2 min to inactivate the drug, centrifuged at 12,000 rpm for 10 min at 4℃, and 100 μL of the supernatant was collected and mixed with 100 μL of ultrapure water. The mixture was vortexed again for 3 min and centrifuged at 3,000 g for 10 min at 4℃ before analysis. Three parallel experiments were set up for each time point. PTX@dA5Z15Z was quantitatively determined by LC-MS / MS (Waters Acquity I UPLC XEVO TQ-S). ij The plasma concentrations of PTX at various time points after the addition of 18Hz3-JCl / Chol were shown in Table 5.

[0251] Table 5

[0252]

[0253] As shown in Table 5, based on dA5Z15Z ij The drug-loaded LNPs of 18Hz3-JCl and Chol. showed no significant drug release from 0 to 24 h, with the maximum average drug release percentage not exceeding 5%, thus demonstrating plasma stability.

[0254] Example 14: Acid-responsive drug release from drug-loaded LNPs based on imidazole acid-responsive biomimetic lipid compounds

[0255] (1) Fluorescent labeling of drug-loaded LNPs

[0256] Following the preparation method in Example 5, the fluorescent probe (Alexa Fluor 594, AF594) and PTX were simultaneously dissolved in a binary co-solvent (tetrahydrofuran / acetic acid-sodium acetate buffer (pH 5.5), 3:7 (v / v)), with other conditions remaining unchanged, to prepare AF594-labeled PTX@dA5Z15Z. ij 18Hz 3-JCl / Chol., designated as PTX / AF594 @dA5Z15Z ij 18Hz3-JCl / Chol.

[0257] Following the preparation method in Example 6, AF594 and CLTX were simultaneously dissolved in acetate-sodium acetate buffer (pH 5.5), with other conditions remaining unchanged, to prepare AF594-labeled CLTX@dA5Z15Z. ij 18Hz 3-JCl / Chol., denoted as CLTX / AF594@dA5Z15Z ij 18Hz3-JCl / Chol.

[0258] Following the preparation method in Example 7, AF594 and miR-329 were simultaneously dissolved in acetate-sodium acetate buffer (pH 5.5), and other conditions remained unchanged to prepare AF594-labeled miR-329@dA5Z15Z. ij 18Hz 3-JCl / Chol., denoted as miR-329 / AF594@dA5Z15Z ij 18Hz3-JCl / Chol.

[0259] (2) In vitro delivery efficiency of drug-loaded LNPs

[0260] An in vitro blood-brain barrier-glioma co-culture model (in vitro blood-brain barrier model) consisting of HCMEC / D3 cells and U-118MG cells was constructed to evaluate the delivery efficiency of the three fluorescently labeled drug-loaded LNPs prepared in (1) across the in vitro blood-brain barrier model.

[0261] First, HCMEC / D3 cells were cultured in ECM medium containing 5% fetal bovine serum at a concentration of 5 × 10⁶ cells / day. 4 Cells were seeded at a density per well in Transwell chambers. TM Collagen-coated polycarbonate membrane (0.4 µm pore size and 0.33 cm² growth area) in No. 3413 Costar. 2 Replace the medium with fresh ECM medium containing 5% fetal bovine serum and continue culturing for 2-3 days. Then replace the medium with DMEM / F12 serum-free medium containing 550 nM hydrocortisone and continue culturing for two more days at 5% CO2 and 37°C until the HCMEC / D3 cell monolayers fuse to form a barrier model.

[0262] The transmembrane resistance (TEER) of the HCMEC / D3 cell barrier formed above was measured using a CellZscope II real-time cell dynamics analyzer (nanoAnalytic, Germany). The test module and serum-free DMEM / F12 medium containing 550 nM hydrocortisone were preheated at 5% CO2 and 37°C for 1 h. 1.2 mL of DMEM / F12 serum-free medium was added to each metal chamber of the test module. After transferring the transwell chambers to the metal chambers of the test module, the TEER in each transwell chamber was measured at a rate of one chamber / min under 5% CO2 and 37°C. The results showed that the TEER of each chamber was greater than 300 Ω·cm. 2 This indicates that the fused HCMEC / D3 cell monolayer possesses barrier function, and the in vitro blood-brain barrier model has been successfully constructed, which can be used for experiments evaluating the in vitro delivery efficiency of drug-loaded LNPs.

[0263] U-118MG cells were cultured in DMEM medium containing 10% fetal bovine serum at a concentration of 1.5 × 10⁶ cells / year. 4 Cells were seeded at a density per well in 24-well plates and cultured for 24 h. The Transwell chambers containing the in vitro blood-brain barrier model constructed from HCMEC / D3 cells were then transferred to the wells of the 24-well plates. PTX / AF594@dA5Z15Z was then injected. ij 18Hz 3-JCl / Chol. (100 nmol PTX) was added to each Transwell chamber, and the cells were cultured for another 24 h at 5% CO2 and 37°C. Two parallel experiments were set up, with untreated U-118MG cells as a blank control. The survival rate of U-118MG cells at 4, 8, 12, 18, and 24 h was calculated using the MTT assay. The results are as follows: Figure 4As shown in Figure A; another group was characterized by flow cytometry of the fluorescence signal intensity of AF594 in U-118 MG cells at 4, 8, and 12 h, and the results are as follows. Figure 4 As shown in B. Furthermore, SVG p12 human astrocytes were used instead of U-118MG cells, with a seeding density of 2.0 × 10⁶ cells in 24-well plates. 4 Cells / well, other conditions unchanged, served as the negative control group for the aforementioned in vitro hematoma barrier model. Similarly, the fluorescence signal intensity of AF594 in SVG p12 cells at 4, 8, and 12 h was characterized by flow cytometry. Figure 4 B).

[0264] Calculate CLTX / AF594@dA5Z15Z using the same method described above. ij The survival rates of U-118MG cells at 4, 8, 12, 18, and 24 h after the addition of 18Hz 3-JCl / Chol. (90 nmol) to each Transwell chamber are shown in the following figures. Figure 4 As shown in Figure A; the fluorescence signal intensity of AF594 in U-118 MG cells and SVG p12 cells at 4, 8, and 12 h was characterized by flow cytometry, and the results are as follows. Figure 4 As shown in C.

[0265] Calculate miR-329 / AF594@dA5Z15Z using the same method described above. ij The survival rates of U-118MG cells at 4, 8, 12, 18, and 24 h after the addition of 18Hz 3-JCl / Chol. (22 nmol) to each Transwell chamber are shown in the following figures. Figure 4 As shown in Figure A; the fluorescence signal intensity of AF594 in U-118 MG cells and SVG p12 cells at 4, 8, and 12 h was characterized by flow cytometry, and the results are as follows. Figure 4 As shown in D.

[0266] Depend on Figure 4 As can be seen from A, adding PTX / AF594@dA5Z15Z... ij Following 18 Hz 3-JCl / Chol. (100 nmol PTX), the mean survival rate of U-118MG cells decreased over time, reaching only 22.5% at 24 h. This demonstrates that PTX / AF594@dA5Z15Z ij 18Hz3-JCl / Chol. can deliver PTX to glioma cells across the blood-brain barrier in a model. Figure 4In B, the fluorescence signal intensity of AF594 in U-118 MG cells increased over time (AF594 was quenched and showed no signal under encapsulation conditions), reaching 323.9, 994.5, and 2291.8 at 4, 8, and 12 h, respectively. This indicates the presence of PTX / AF594@dA5Z15Z. ij 18Hz3-JCl / Chol. After crossing the blood-brain barrier and being taken up by U-118MG cells, AF594 from PTX / AF594@dA5Z15Z ij 18Hz 3-JCl / Chol. Fast release. Reference Figure 4 In A, the mean survival rates of U-118MG cells at 4, 8, and 12 h were 95.0%, 59.9%, and 35.0%, respectively, demonstrating that PTX and AF594 were released almost synchronously. In contrast, the fluorescence signal intensities of AF594 in SVG p12 cells at 4, 8, and 12 h were 92.1, 103.3, and 121.6, respectively, all significantly lower than those in U-118MG cells, further indicating that PTX / AF594 is released if and only if PTX / AF594@dA5Z15Z ij After being taken up by U-118MG cells, 18Hz3-JCl / Chol. triggers an acid response mechanism, thereby releasing PTX and AF594.

[0267] Depend on Figure 4 As can be seen from A, adding CLTX / AF594@dA5Z15Z... ij After 18 Hz 3-JCl / Chol. (90 nmol), with Figure 4 Similar results were observed in A, with the mean survival rate of U-118MG cells decreasing over time, reaching only 12.5% ​​at 24 h, demonstrating that CLTX / AF594@dA5Z15Z ij 18Hz3-JCl / Chol. can deliver chloramphenicol CLTX to glioma cells across the blood-brain barrier in a model. Figure 4 In C, the fluorescence signal intensity of AF594 in U-118 MG cells was also found to increase over time, reaching 398.1, 1052.7, and 2945.8 at 4, 8, and 12 h, respectively. This indicates the presence of CLTX / AF594@dA5Z15Z. ij 18Hz3-JCl / Chol. After crossing the blood-brain barrier and being taken up by U-118MG cells, AF594 from CLTX / AF594@dA5Z15Z ij 18Hz 3-JCl / Chol. Fast release. Reference Figure 4In A, the mean survival rates of U-118MG cells at 4, 8, and 12 h were 97.1%, 48.2%, and 21.7%, respectively, demonstrating that CLTX and AF594 were released almost synchronously. In contrast, the fluorescence signal intensities of AF594 in SVG p12 cells at 4, 8, and 12 h were 104.8, 132.1, and 144.5, respectively, all significantly lower than those in U-118MG cells, further indicating that CLTX / AF594@dA5Z15Z is released if and only if... ij After 18Hz3-JCl / Chol. is taken up by U-118MG cells, it triggers an acid response mechanism, thereby releasing CLTX and AF594.

[0268] Depend on Figure 4 As can be seen from A, adding miR-329 / AF594@dA5Z15Z... ij After 18 Hz 3-JCl / Chol. (22 nmol), with Figure 4 Similar results were observed in A, with the mean survival rate of U-118MG cells decreasing over time, reaching only 19.6% at 24 h, demonstrating that miR-329 / AF594@dA5Z15Z ij 18Hz3-JCl / Chol. can deliver the small nucleic acid miR-329 to glioma cells across the blood-brain barrier in a model. Figure 4 In D, the fluorescence signal intensity of AF594 in U-118 MG cells was also found to increase over time, reaching 426.7, 1284.2, and 2259.5 at 4, 8, and 12 h, respectively, indicating miR-329 / AF594@dA5Z15Z. ij 18Hz3-JCl / Chol. After crossing the blood-brain barrier and being taken up by U-118MG cells, AF594 from miR-329 / AF594@dA5Z15Z ij Rapid release at 18 Hz in 3-JCl / Chol. (Reference) Figure 4 In A, the mean survival rates of U-118MG cells at 4, 8, and 12 h were 93.6%, 50.9%, and 32.7%, respectively, demonstrating that miR-329 and AF594 were released almost synchronously. In contrast, the fluorescence signal intensities of AF594 in SVG p12 cells at 4, 8, and 12 h were 100.4, 95.8, and 106.6, respectively, all significantly lower than those in U-118MG cells, further indicating that miR-329 / AF594@dA5Z15Z is released if and only if miR-329 / AF594@dA5Z15Z. ij After being taken up by U-118MG cells, 18Hz3-JCl / Chol. releases miR-329 and AF594 due to the triggering of an acid response mechanism.

[0269] Example 15: Imidazole amino acid-responsive biomimetic lipid compound dA5Z15Z ij 18Hz 3-JCl PTX@LNPs-1 delivery efficacy in the brain at the in vivo level

[0270] This embodiment further evaluates the imidazole amino acid-responsive biomimetic lipid compound dA5Z15Z. ij 18Hz 3-JCl drug-loaded lipid nanoparticles PTX@LNPs-1 (PTX@dA5Z15Z) ij 18Hz3- JCl / Chol.) brain delivery effects at the in vivo level.

[0271] U-118MG cell suspension (1×10⁻⁶) was implanted into the brains of immunodeficient female nude mice with an average weight of approximately 25 g at 4-8 weeks of age. 6 (cells / mL), after 1-2 weeks of growth, a tumor volume of approximately 100-150 mm was obtained. 3 An immunodeficient mouse model was established. These mice were randomly divided into three groups of three. PTX@LNPs-1 and PTX@D-Lin-MC3-DMA / Chol. (Comparative Example 2) were injected via tail vein (dose 10 mg / kg, injection volume 200 μL), while the control group received an equal volume of physiological saline. Brain tissue was harvested at 4, 8, 12, 18, and 24 h post-injection. The free PTX content in brain tissue and the total PTX content in plasma were quantitatively determined by LC-MS / MS at each time point. The brain tissue-to-plasma concentration ratio (B / P ratio) was calculated for each group. The results are shown below. Figure 5 As shown in Figure A. The above experiment was repeated, except that mouse brain tissue was removed one week after injection. Tumor weights were compared between groups, and the relative tumor proliferation rate (T / C ratio) was calculated. The results are shown below. Figure 5 As shown in B.

[0272] Depend on Figure 5 As shown in Figure A, after tail vein injection of PTX@LNPs-1 into a mouse model, the average B / P ratios at 4, 8, 12, 18, and 24 h were approximately 0.8, 1.4, 1.6, 1.8, and 2.2, respectively. In contrast, after tail vein injection of PTX@D-Lin-MC3-DMA / Chol. in Comparative Example 2, the average B / P ratios at all time points did not exceed 0.5, significantly lower than that of PTX@LNPs-1. This indicates that the imidazole amino acid-responsive biomimetic lipid compound dA5Z15Z... ij The drug-loaded LNPs of 18Hz3-JCl significantly improved the blood-brain barrier permeability of PTX and the brain tissue distribution in mouse models, with a brain delivery effect far superior to that of Comparative Example 2.

[0273] Figure 5In Case B, one week after tail vein injection of PTX@LNPs-1, the average T / C ratio was 0.36, indicating an average relative tumor inhibition rate of 64%. In contrast, one week after tail vein injection of PTX@D-Lin-MC3-DMA / Chol in Comparative Case 2, the average T / C ratio was 0.88, indicating an average relative tumor inhibition rate of 12%. This demonstrates that at the same PTX dose, the pharmacodynamics of PTX@LNPs-1 delivering PTX to the brain are significantly superior to those of the drug-loaded LNPs in Comparative Case 2. Figure 5 The results shown in A are consistent.

[0274] Example 16: Imidazole amino acid-responsive biomimetic lipid compound dA5Z15Z ij CLTX@LNPs-1 delivery efficacy at the in vivo level in the brain using 18Hz 3-JCl

[0275] This embodiment further evaluates the imidazole amino acid-responsive biomimetic lipid compound dA5Z15Z. ij 18Hz 3-JCl drug-loaded lipid nanoparticles CLTX@LNPs-1 (CLTX@dA5Z15Z) ij 18Hz 3-JCl / Chol.) brain delivery effects at the in vivo level.

[0276] U-118MG cell suspension (1×10⁻⁶) was implanted into the brains of immunodeficient female nude mice with an average weight of approximately 25 g at 4-8 weeks of age. 6 (cells / mL), after 1-2 weeks of growth, a tumor volume of approximately 100-150 mm was obtained. 3 An immunodeficient mouse model was established. These mice were randomly divided into three groups of three. CLTX@LNPs-1 and CLTX@D-Lin-MC3-DMA / Chol. (Comparative Example 3) were injected via tail vein (dose 5 mg / kg, injection volume 200 μL), while the control group received an equal volume of physiological saline. Brain tissue was harvested at 4, 8, 12, 18, and 24 h post-injection. The free CLTX content in brain tissue and the total CLTX content in plasma were quantitatively determined by LC-MS / MS at each time point. The brain tissue-to-plasma concentration ratio (B / P ratio) was calculated for each group. The results are shown below. Figure 6 As shown in Figure A. The above experiment was repeated, except that mouse brain tissue was removed one week after injection. Tumor weights were compared between groups, and the relative tumor proliferation rate (T / C ratio) was calculated. The results are shown below. Figure 6 As shown in B.

[0277] Depend on Figure 6As shown in Figure A, after tail vein injection of CLTX@LNPs-1 into a mouse model, the average B / P ratios at 4, 8, 12, 18, and 24 h were approximately 0.7, 1.2, 1.5, 1.7, and 1.8, respectively. In contrast, after tail vein injection of CLTX@D-Lin-MC3-DMA / Chol. in Comparative Example 3, the average B / P ratio at each time point did not exceed 0.2, which was significantly lower than that of CLTX@LNPs-1. This indicates that the imidazole amino acid-responsive biomimetic lipid compound dA5Z15Z... ij The drug-loaded LNPs of 18Hz3-JCl significantly improved the blood-brain barrier permeability of CLTX and the brain tissue distribution in mouse models, with brain delivery performance far superior to that of the control group 3.

[0278] Figure 6 In Case B, one week after tail vein injection of CLTX@LNPs-1, the average T / C ratio was 0.32, indicating an average relative tumor inhibition rate of 68%. In contrast, one week after tail vein injection of CLTX@D-Lin-MC3-DMA / Chol. in Comparative Case 3, the average T / C ratio was 0.91, indicating an average relative tumor inhibition rate of 9%. This demonstrates that at the same CLTX dose, the pharmacodynamics of CLTX@LNPs-1 delivering CLTX to the brain are significantly superior to those of the drug-loaded LNPs in Comparative Case 3. Figure 6 The results shown in A are consistent.

[0279] Example 17: Imidazole amino acid-responsive biomimetic lipid compound dA5Z15Z ij The effect of miR329@LNPs-1 in vivo on brain delivery at 18Hz 3-JCl

[0280] This embodiment further evaluates the imidazole amino acid-responsive biomimetic lipid compound dA5Z15Z. ij Drug-loaded lipid nanoparticles miR-329@LNPs-1 (miR-329@dA5Z15Z) of 18Hz 3-JCl ij 18Hz 3-JCl / Chol.) brain delivery effects at the in vivo level.

[0281] U-118MG cell suspension (1×10⁻⁶) was implanted into the brains of immunodeficient female nude mice with an average weight of approximately 25 g at 4-8 weeks of age. 6 (cells / mL), after 1-2 weeks of growth, a tumor volume of approximately 100-150 mm was obtained. 3An immunodeficient mouse model was established. These mice were randomly divided into three groups of three. miR-329@LNPs-1 and miR-329@D-Lin-MC3-DMA / Chol. (Comparative Example 4) were injected via tail vein (dose: 22 nmol, injection volume: 200 μL), while the control group received an equal volume of physiological saline. Brain tissue was harvested at 4, 8, 12, 18, and 24 h post-injection. The miR-329 content in brain tissue and total miR-329 content in plasma were quantitatively determined using q-PCR at each time point. The brain tissue-to-plasma concentration ratio (B / P ratio) was calculated for each group. The results are shown below. Figure 7 As shown in Figure A. The above experiment was repeated, except that mouse brain tissue was removed one week after injection. Tumor weights were compared between groups, and the relative tumor proliferation rate (T / C ratio) was calculated. The results are shown below. Figure 7 As shown in B.

[0282] Depend on Figure 7 As shown in Figure A, after tail vein injection of miR-329@LNPs-1 into a mouse model, the average B / P ratios at 4, 8, 12, 18, and 24 h were approximately 0.9, 1.4, 1.6, 1.9, and 1.8, respectively. In contrast, after tail vein injection of miR-329@D-Lin-MC3-DMA / Chol. in Comparative Example 4, the average B / P ratios at all time points did not exceed 0.5, significantly lower than those of miR-329@LNPs-1. This indicates that the imidazole amino acid-responsive biomimetic lipid compound dA5Z15Z... ij The drug-loaded LNPs of 18Hz3-JCl significantly improved the blood-brain barrier permeability of miR-329 and the brain tissue distribution in mouse models, with brain delivery performance far superior to that of the control group 4.

[0283] Figure 7 In Case B, one week after tail vein injection of miR-329@LNPs-1, the average T / C ratio was 0.41, indicating an average relative tumor inhibition rate of 59%. In contrast, one week after tail vein injection of miR-329@D-Lin-MC3-DMA / Chol. in Comparative Case 4, the average T / C ratio was 0.86, indicating an average relative tumor inhibition rate of 14%. This demonstrates that at the same miR-329 dose, the pharmacodynamics of miR-329@LNPs-1 delivering miR-329 to the brain are significantly superior to those of the drug-loaded LNPs in Comparative Case 4. Figure 7 The results shown in A are consistent.

[0284] In summary, it can be demonstrated that the drug-loaded LNPs based on imidazole acid-responsive biomimetic lipid compounds in this invention can effectively cross the blood-brain barrier to achieve brain-targeted delivery of different types of drugs, and can trigger an acid response mechanism for rapid drug release after being taken up by glioma cells. Specifically, the imidazole acid-responsive biomimetic lipid compound dA5Z15Z...ij LNPs-1 (dA5Z15Z) composed of 18Hz3-JCl and cholesterol ij The 18Hz 3-JCl / Chol. can achieve the maximum encapsulation rate of small molecule chemical drugs, peptide drugs and small nucleic acid drugs and demonstrates better brain-targeted delivery efficiency.

[0285] The embodiments of the present invention have been described in detail above, but they should not be used to limit the scope of the present invention. All variations made within the scope of the present invention should still fall within the patent coverage of the present invention.

Claims

1. An imidazolic acid-responsive biomimetic lipid compound, characterized in that: The structure is shown in Equation 14; Equation 14; Where R' is C9~C 18 A straight-chain saturated hydrocarbon group or a straight-chain unsaturated hydrocarbon group, where R" is C9~C9. 18 The straight-chain saturated hydrocarbon group or the straight-chain unsaturated hydrocarbon group, where R' and R" are the same group or different groups; m is an integer from 1 to 5; n is an integer from 3 to 9; X - It is an anionic group, specifically I - ,Br - Cl - BF4 - or PF6 - .

2. The imidazole amino acid-responsive biomimetic lipid compound according to claim 1, characterized in that: R' and R" are C 13 ~C 17 Straight-chain alkyl, monoalkenyl, or diene-chain compounds.

3. The imidazole amino acid-responsive biomimetic lipid compound according to claim 1 or 2, characterized in that: R' and R" can be one or both of the following structures: 。 4. The imidazole amino acid-responsive biomimetic lipid compound according to claim 1, characterized in that: m is 1, 2, or 3; n is 3, 4, or 5.

5. A method for preparing the imidazole amino acid-responsive biomimetic lipid compound according to any one of claims 1-4, characterized in that: Includes the following steps: Step S01: The compound shown in Formula 1 is reacted with a protecting agent containing the protecting group PG-I to obtain the intermediate shown in Formula 2; ； Step S02: The intermediate shown in Formula 2 is reacted with a protecting agent containing the protecting group PG-II to obtain the intermediate shown in Formula 3; ； Step S03: The intermediate shown in Formula 3 and the compound shown in Formula 4 are reacted together under anaerobic and strongly alkaline conditions to obtain the intermediate shown in Formula 5. ； Step S04: Under certain conditions, the protecting group PG-I of the intermediate shown in Formula 5 is removed to obtain the intermediate shown in Formula 6. ； Step S05: The intermediate shown in Formula 6 and the compound shown in Formula 7 are subjected to an etherification reaction under certain conditions to obtain the intermediate shown in Formula 8. ； Step S06: Under certain conditions, the protecting group PG-II of the intermediate shown in Formula 8 is removed to obtain the intermediate shown in Formula 9; ； Step S07: The intermediate shown in Formula 9 and the compound shown in Formula 7' are subjected to an etherification reaction under certain conditions to obtain the intermediate shown in Formula 10. ； Step S08: The intermediate shown in Formula 10 is reacted with the compound shown in Formula 11 to obtain the intermediate shown in Formula 12. ； Step S09: The intermediate shown in Formula 12 is acidified with HX and then reacted with the compound shown in Formula 13 to form a salt, thereby obtaining the imidazole amino acid-responsive biomimetic lipid compound shown in Formula 14. 。 6. A method for preparing drug-loaded lipid nanoparticles, characterized in that: The imidazole amino acid-responsive biomimetic lipid compound described in any of claims 1-4 is deprotected by an acylhydrazine protecting group, and then mixed with cholesterol and a therapeutic drug, undergoing cross-linking polymerization and self-assembly to form drug-loaded lipid nanoparticles.

7. The method for preparing drug-loaded lipid nanoparticles according to claim 6, characterized in that: Includes the following steps: Step V01: Dissolve the imidazole amino acid-responsive biomimetic lipid compound in an organic solvent, add a deprotecting agent to remove the hydrazide protecting group of the imidazole amino acid-responsive biomimetic lipid compound, add cholesterol and dissolve it completely, remove the organic solvent, and obtain a mixture of deprotected imidazole amino acid-responsive biomimetic lipid compound and cholesterol. Step V02: Add a therapeutic drug to a mixture of deprotected imidazole amino acid-responsive biomimetic lipid compounds and cholesterol, mix in a binary cosolvent composed of an organic solvent and a weakly acidic buffer, crosslink and polymerize the deprotected imidazole amino acid-responsive biomimetic lipid compounds in the binary cosolvent, and self-assemble with cholesterol and the therapeutic drug to prepare crude drug-loaded lipid nanoparticles loaded with the therapeutic drug. Step V03: The crude drug-loaded lipid nanoparticles are dialyzed to remove small molecules, organic solvent components and buffer salt components, resulting in drug-loaded lipid nanoparticles in which the therapeutic drug is loaded.

8. The method for preparing drug-loaded lipid nanoparticles according to claim 7, characterized in that: Therapeutic drugs are small molecule drugs, peptide drugs, or small nucleic acid drugs.

9. Drug-loaded lipid nanoparticles prepared by the method of any one of claims 6-8.

10. The use of the drug-loaded lipid nanoparticles according to claim 9 in the preparation of drugs targeting glioma.

Images