A strain of antler-like mushroom and application thereof

Abstract

The application discloses a deer mushroom strain and application thereof. A deer mushroom (Lyophyllum decastes) strain LD563 of the application has a preservation number of GDMCC NO.66927. The strain is stable in character, strong in stress resistance, and has neat fruiting, and the fruiting body has a unique mushroom fragrance, a fresh and crisp taste, and excellent commodity character. The biological conversion rate of the strain can reach 120%-130%, and the yield is high. The average yield of the strain in regional test and production test is 912 grams / bag (750 grams of dry material), and the yield is increased by 7.80% compared with that of a control strain LD37. Meanwhile, the strain can be artificially cultured, and the culture condition is simple and easy to preserve, and the strain is suitable for factory production, and has a good development and application prospect.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and more particularly to a strain of *Agaricus esculentus* and its applications. Background Technology

[0002] Lyophyllum decastes, also known as the lotus-leafed arborescent mushroom, is a saprophytic edible fungus belonging to the genus Lyophyllum in the family Tricholomataceae of the class Basidiomycetes. It is mainly distributed in Northeast, Southwest, and East my country, typically growing in forest litter or humus-rich soil. Rich in nutrients and with a unique taste, Lyophyllum decastes possesses high nutritional value and special medicinal effects, and has gradually become one of the emerging varieties with development potential in the edible fungi industry.

[0003] The deer antler mushroom is highly dependent on its growth environment, occurring mostly in autumn. It thrives in cool, humid forest environments with high humus content, and typically grows in clumps or clusters. Its natural growth cycle is long, fruiting is not concentrated, and it is significantly limited by climate and geographical conditions. Currently, the artificial cultivation of *Amanita muscaria* is still in the exploratory stage. Its mycelial growth rate is slow, fruiting induction is difficult, and the cultivation cycle is long. Furthermore, industrialized production often suffers from prominent problems such as weak mycelial vigor, unstable yield, and uneven fruiting body quality.

[0004] Studies have shown that the growth and development of saprophytic fungi are closely related to the nutrient composition of their substrate, microbial community, and environmental factors. In industrialized cultivation, traditional culture media often fail to fully meet their nutritional needs, leading to slow mycelial expansion, low bioconversion rates, and susceptibility to contamination by other microorganisms. In recent years, research on promoting mycelial growth, regulating fruiting, and improving quality in the cultivation of saprophytic fungi has gained increasing attention. Screening superior strains with growth-promoting functions and adapted to industrialized conditions, and optimizing their cultivation substrate and growth microenvironment, has become a key technological direction for achieving efficient, stable, and green production of *Amanita muscaria*.

[0005] Therefore, selecting a high-quality strain suitable for the industrialized cultivation of *Pleurotus ostreatus* and establishing an efficient and stable cultivation system is of great significance for promoting the industrialization of this rare edible fungus. Summary of the Invention

[0006] In view of the shortcomings and defects of the existing technology, the purpose of this invention is to provide a strain of Lyophyllum decastes, LD563, and its applications.

[0007] The objective of this invention can be achieved through the following technical solutions:

[0008] In a first aspect, the present invention seeks protection for a Lyophyllum decastes strain LD563, the preservation number of which is GDMCC NO.66927.

[0009] The main biological characteristics of this strain are as follows: after culturing on PDA medium at 25℃ for 10 days, the colony diameter is 5.8 cm, indicating moderate growth. The mycelial density and aerial hyphae are moderate. The colony surface is white and the back is pale yellow. The growth is radial with relatively neat, serrated edges. It does not readily produce spores under artificial culture conditions.

[0010] The full sequence of the ITS region was amplified and sequenced, and the full sequence of 16SRNA obtained by PCR amplification was (SEQ ID NO:1).

[0011] Morphological and molecular biological identification confirmed that this strain is classified as *Lyophyllum decastes*, belonging to the genus *Lyophyllum* of the family Tricholomataceae in the class Basidiomycetes. Its strain number is LD563. It is currently deposited at the Guangdong Provincial Microbial Culture Collection Center (GDMCC) with accession number GDMCC NO.66927, dated September 5, 2025. The deposit address is Building 59, Institute of Microbiology, Guangdong Academy of Sciences, No. 100 Xianlie Middle Road, Guangzhou, 510075, China.

[0012] Secondly, the present invention seeks protection for a type of *Pleurotus ostreatus* spore, which is the spore obtained after culturing the above-mentioned *Pleurotus ostreatus* strain LD563.

[0013] Thirdly, the present invention seeks to protect a type of *Pleurotus ostreatus* mycelium, which is the mycelium obtained by culturing the above-mentioned *Pleurotus ostreatus* strain LD563.

[0014] Fourthly, the present invention seeks protection for a fruiting body of *Pleurotus ostreatus*, which is a fruiting body obtained by cultivating the above-mentioned *Pleurotus ostreatus* strain LD563.

[0015] Fifthly, the present invention seeks protection for the application of the above-mentioned *Pleurotus ostreatus* strain LD563 in the industrialized cultivation of *Pleurotus ostreatus*.

[0016] Sixthly, the present invention seeks protection for the use of the above-mentioned fruiting bodies of *Amanita muscaria* in food processing.

[0017] Seventhly, the present invention claims protection for a liquid culture medium for culturing the aforementioned *Agaricus esculentus* strain LD563, the liquid culture medium comprising the following components: 10-50 g / L glucose, 1-5 g / L soybean flour, 0.5-2 g / L magnesium sulfate, 0.5-5 g / L potassium dihydrogen phosphate, 1-5 g / L yeast extract, and 0.1-0.5 mL / L antifoaming agent; the pH of the culture medium is 6.5-7.0. In a specific embodiment of the present invention, the pH of the culture medium is adjusted to 6.5-7.0 using potassium dihydrogen phosphate.

[0018] Eighthly, the present invention claims protection for a method for preparing the above-mentioned liquid culture medium of *Pleurotus ostreatus* strain LD563, wherein the liquid culture medium is used and cultured in a fermenter at 22°C to 23°C, a pressure of 0.06 MPa to 0.07 MPa, and an aeration rate of 0.8 to 1.2 vvm for 6 to 7 days.

[0019] Ninthly, the present invention claims protection for a method for cultivating the above-mentioned *Pleurotus ostreatus* strain LD563, the method comprising the following steps:

[0020] (1) Inoculation and mycelium growth: The liquid inoculum of the LD563 strain of the deer antler mushroom was inoculated into the sterilized cultivation substrate and cultured in an environment with a temperature of 20℃~25℃, relative humidity of 60%~80%, and CO2 concentration of 2000~4000 ppm until the mycelium filled the bag.

[0021] The cultivation material, by weight percentage, comprises: 30%–50% sawdust, 10%–30% corn cob, 10%–30% wheat bran, 1%–5% soybean meal, 1%–10% corn flour, 1%–10% cottonseed hulls, and 1%–5% calcium carbonate, with the sum of the weight percentages of each component being 100%.

[0022] (2) Scratching: Scratching should be performed 70-100 days after inoculation;

[0023] (3) Mushroom Management: After scratching the fungus, environmental control should be carried out in the following stages:

[0024] a. Days 1-7 after scratching: temperature 17-18℃, humidity 100%, white light irradiation 12 hours / day, CO2 concentration 1500-2000 ppm;

[0025] b. Days 8-17 after scratching: temperature 17-18℃, humidity 96%-98%, no light, CO2 concentration 4000-8000ppm;

[0026] c. Days 18-22 after scratching: temperature 17-18℃, humidity 98%-100%, white light irradiation 6-12 hours / day, CO2 concentration 2000-3000 ppm;

[0027] d. Days 23-26 after scratching: temperature 16-17℃, humidity 96%-98%, white light irradiation 12-18 hours / day, CO2 concentration 1500-2000 ppm.

[0028] Furthermore, the liquid culture is prepared using the aforementioned method for preparing the liquid culture of the *Pleurotus ostreatus* strain LD563.

[0029] Furthermore, in step (3), the CO2 concentration on days 8 to 17 after scratching is 5000 to 8000 ppm; and the daytime light exposure on days 18 to 22 after scratching is 8 to 12 hours / day.

[0030] The strain screened in this invention can be propagated in liquid culture medium and fermenter conditions, and can complete its growth cycle and produce fruiting under certain cultivation management conditions. Studies have shown that this strain is a high-quality strain suitable for the industrial cultivation of *Pleurotus ostreatus*.

[0031] Compared with the prior art, the present invention has the following significant advantages:

[0032] The Lyophyllum decastes strain LD563 of this invention exhibits stable characteristics, with an optimal fruiting temperature range of 16℃-18℃. It has robust stipes, a unique mushroom aroma, a fresh, crisp, and smooth texture, and excellent commercial qualities. Its biological conversion rate can reach 120%-130%, and it boasts high yield. Regional and production trials showed an average yield of 912 g / bag (750 g dry substrate), a 7.80% increase compared to the control variety LD37. Furthermore, this strain can be artificially cultivated under simple conditions, is easy to preserve, and is suitable for industrial production, demonstrating promising development and application prospects. Attached Figure Description

[0033] Figure 1 This is a frontal view of the colony morphology of the strain of the present invention.

[0034] Figure 2 This is a diagram of the reverse side morphology of colonies cultured from the strain of this invention.

[0035] Figure 3 This represents the antagonistic reaction between the strain of this invention and the control.

[0036] Figure 4 The differences between the fruiting body longitudinal section of the strain of the present invention and the control strain, the main color of the cap center, the cap thickness, the stipe color, and the maximum diameter of the stipe are shown.

[0037] Figure 5 The difference in the overall growth trend of the fruiting bodies between the strain of this invention and the control strain is shown.

[0038] Figure 6 Images show the industrialized cultivation of fruiting bodies of the strain of this invention and the control strain.

[0039] Information on the preservation of biological materials

[0040] Lyophyllum decastes strain LD563 is deposited at the Guangdong Provincial Microbial Culture Collection Center (GDMCC), with accession number GDMCC NO.66927, deposited on September 5, 2025. The deposit address is Building 59, No. 100 Xianlie Middle Road, Institute of Microbiology, Guangdong Academy of Sciences, Guangdong Province, 510075, China. Detailed Implementation

[0041] The technical solution of the present invention will be further described below with reference to the accompanying drawings and specific embodiments.

[0042] Example 1:

[0043] Strain LD563 was selected through hybridization breeding between June 2022 and October 2025. The parents are 'LD5' and 'LD37'. 'LD5' is a commercial mushroom, *Pleurotus ostreatus*, purchased from Kunshan Qinghe Edible Fungus Technology Co., Ltd., and obtained through tissue isolation and purification (first generation) in June 2022. 'LD37' is a commercial mushroom, *Pleurotus ostreatus*, purchased from Jiangsu Jiangnan Biotechnology Co., Ltd. in June 2022, and obtained through tissue isolation and purification (first generation).

[0044] The breeding method was as follows: parental spores were collected, and 50 monokaryotic populations were established for each parent. Fifteen monokaryotic individuals were selected based on mycelial morphology and growth rate for confrontation hybridization. Twenty-four hybrids were selected through mycelial morphology, microscopic examination, and antagonism experiments. These 24 hybrids and two parents were then subjected to fruiting trials. The superior hybrid combination was selected by comparing traits and yield. Further screening was conducted using fruiting trials, and a strain with superior growth traits was finally selected through comparison of traits and yield. Its mycelium grows rapidly at 25℃ and has a high yield; this strain was named 'LD563'.

[0045] The main biological characteristics of this strain are as follows: after culturing on PDA medium at 25℃ for 10 days, the colony diameter is 5.8 cm, indicating moderate growth. The mycelial density and aerial hyphae are moderate. The colony surface is white and the back is pale yellow. The growth is radial with relatively neat, serrated edges. It does not readily produce spores under artificial culture conditions.

[0046] The full sequence of the ITS region was amplified and sequenced, and the full sequence of 16SRNA obtained by PCR amplification was (SEQ ID NO:1).

[0047] Morphological and molecular biological identification confirmed that this strain is classified as *Lyophyllum decastes*, belonging to the genus *Lyophyllum* of the family Tricholomataceae in the class Basidiomycetes. Its strain number is LD563. It is currently deposited at the Guangdong Provincial Microbial Culture Collection Center (GDMCC) with accession number GDMCC NO.66927, dated September 5, 2025. The deposit address is Building 59, Institute of Microbiology, Guangdong Academy of Sciences, No. 100 Xianlie Middle Road, Guangzhou, 510075, China.

[0048] Example 2:

[0049] Mycelial characteristics of strain LD563 were determined using Difco PDA medium for plate culture, with LD37 as a control (one of the parents of strain LD563, both with similar agronomic traits). Quantitative mycelial blocks were collected using a 5 mm diameter punch and inoculated into the center of 90 mm diameter Petri dishes, and cultured in the dark at 10℃, 15℃, 20℃, 25℃, and 30℃. Colony diameter was measured using the cross-hatching method on days 13 and 17 post-inoculation. Each treatment was replicated in triplicate, and the average value was taken. Mycelial growth rate was calculated using the following formula:

[0050]

[0051] In the formula: S—mycelial growth rate, in millimeters per day (mm / d);

[0052] D1—Coronary diameter, the diameter of the colony measured for the first time, in millimeters (mm);

[0053] D2 – Colony outer diameter, the second measurement of colony diameter, in millimeters (mm);

[0054] d1 — The number of days of mycelial growth measured for the first time, in days (d);

[0055] d2 — The number of days of mycelial growth measured for the second time, in days (d).

[0056] Table 1. Comparison of mycelial growth rate between strain LD563 and control LD37

[0057]

[0058] According to the results in Table 1, there was a significant difference in mycelial growth rate between strain LD563 and control LD37 within the temperature range of 10℃ to 25℃. Specifically, at 10℃ to 20℃, the mycelial growth rate of control LD37 was significantly faster than that of strain LD563; while at 25℃, the growth rate of strain LD563 was significantly faster than that of control LD37.

[0059] Example 3:

[0060] Mycelial blocks of strain LD563 and control LD37 were inoculated into the same 90 mm diameter Petri dish using a 5 mm punch, with the two colonies 3 cm apart. Five replicates were set for each treatment. The dishes were incubated at (24±1)℃ in the dark for 28 days, and the presence of antagonism at the colony interface was observed. Another sample of the same strain was inoculated into the center of a 90 mm diameter Petri dish using a 5 mm punch, with five replicates for each treatment. The dishes were incubated at (24±1)℃ in the dark for 14 days, and mycelial morphology was observed. After 28 days of incubation in the dark, the presence of pigments in the colonies was observed.

[0061] Table 2 Comparison of mycelial quality traits between strain LD563 and control LD37

[0062]

[0063] According to the results in Table 2, there was a clear antagonistic reaction between strain LD563 and the control LD37. Furthermore, there was a difference in the color of the reverse side of their colonies: strain LD563 was light yellow, while the control LD37 was white.

[0064] Example 4: Preparation and industrialized cultivation of liquid culture of *Pleurotus ostreatus* strain LD563

[0065] 1. Preparation of culture in shake flasks

[0066] The specific steps for preparing 1 L of liquid bacterial culture medium are as follows:

[0067] Weigh 20 g of glucose, 3 g of soybean flour, 1 g of magnesium sulfate, 1 g of potassium dihydrogen phosphate, and 1.5 g of yeast extract, and add them sequentially to about 800 mL of distilled water, stirring to dissolve. Add 0.1 mL of defoamer (foaming agent, a polyether nonionic surfactant, specifically composed of glycerol polyoxypropylene ether), and add distilled water to bring the volume to 1 L. Adjust the pH of the culture medium to 6.7-6.8 with potassium dihydrogen phosphate solid.

[0068] Fill the shake flasks with the liquid culture medium, filling them to 50%–60% of their capacity, and seal them with cotton plugs. Autoclave at 121°C and 0.1 MPa for 30 minutes.

[0069] After cooling the liquid culture medium to room temperature, under aseptic conditions, pick 7-8 mother culture blocks of 3 mm × 3 mm from the activated *Pleurotus ostreatus* strain LD563 (preservation number: GDMCC NO.12345) and inoculate them into a shake flask. Incubate at 24℃ and 150 r / min for 7 days.

[0070] 2. Preparation of liquid culture medium for culturing *Agaricus esculentus* strain LD563

[0071] The specific steps for preparing 1 L of liquid bacterial culture medium are as follows:

[0072] Weigh 20 g of glucose, 3 g of soybean flour, 1 g of magnesium sulfate, 1 g of potassium dihydrogen phosphate, and 1.5 g of yeast extract, and add them sequentially to about 800 mL of distilled water, stirring to dissolve. Add 0.1 mL of defoamer (foaming agent, a polyether nonionic surfactant, specifically composed of glycerol polyoxypropylene ether), and add distilled water to bring the volume to 1 L. Adjust the pH of the culture medium to 6.7-6.8 with potassium dihydrogen phosphate solid.

[0073] The prepared culture medium was dispensed into fermenters, with the liquid volume being 70% of the fermenter volume. The culture medium was sterilized at 121℃ and 0.1MPa for 50 min and then cooled to room temperature (25℃) for later use.

[0074] 3. Preparation of liquid culture of *Pleurotus ostreatus* strain LD563

[0075] Under aseptic conditions, inoculate the shake-flask inoculum into the sterilized liquid culture medium at an inoculation rate of 5%–10% (v / v). Control the fermentation tank conditions as follows: temperature 22℃–23℃, tank pressure 0.06 MPa–0.07 MPa, aeration rate 0.8 vvm, and stirring speed 150–180 r / min. During the cultivation process, sample the mycelial spheres every 12 hours to observe the morphology and viscosity of the culture medium. After 6–7 days of cultivation, when the mycelial sphere density reaches more than 60% of the total culture medium volume, the mycelial sphere diameter is 2–4 mm, and the culture medium is pale yellow and has no obvious odor, it is ready to be used as liquid inoculum for subsequent cultivation.

[0076] 4. Preparation and sterilization of cultivation substrate

[0077] Prepare the cultivation medium according to the following weight percentages: Based on 1.0 kg of dry material per cultivation bag (17 cm × 35 cm × 0.05 cm polypropylene corner bag), the components are: 380 g sawdust, 260 g corn cob, 200 g wheat bran, 30 g soybean meal, 70 g corn flour, 50 g cottonseed hulls, and 10 g calcium carbonate. Mix the dry materials thoroughly, then add water and stir until the moisture content is 60%–65% (it should clump together when squeezed but crumble easily when touched). Pack the prepared cultivation medium into cultivation bags, approximately 2.5 kg of wet material per bag, to a height of about 4 / 5 of the bag height. Secure the bags with loops and cover with a non-cotton-covered lid. Place the bagged cultivation medium in an autoclave and autoclave at 121℃ and 0.12 MPa for 2–2.5 hours. After sterilization, transfer to a cooling chamber for forced cooling, ensuring the medium cools completely to below 22℃ within 16 hours.

[0078] 5. Inoculation and mycelium growth

[0079] In a sterile inoculation room, the liquid spawn prepared in step 3 is inoculated into the cooled culture medium at an inoculation rate of 30-40 mL per bag, ensuring even distribution of the spawn on the surface and in the perforated holes within the medium. The inoculated culture bags are then transferred to a mycelium incubation room and cultured under conditions of 22-24°C, 75-80% relative humidity, and 2500-3500 ppm CO2 concentration (adjusted via ventilation or a CO2 monitor) in darkness. During the incubation period, the mycelial growth and contamination status are checked every 7-10 days, and contaminated bags are removed promptly. The culture continues until the mycelium has completely filled the culture bags, marking the start of the post-ripening stage.

[0080] 6. Scratching fungus

[0081] On day 85 after inoculation, when the mycelium has fully matured and the mycelium inside the substrate bag is dense and white, perform the mycelial scratching operation. Remove the old mycelial skin and the aged mycelial layer on the surface of the cultivation bag, scratching to a depth of 0.3-0.5 cm to expose the fresh mycelium inside, while keeping the substrate surface flat. Immediately after scratching, transfer the cultivation bag to the fruiting room.

[0082] 7. Mushroom Management

[0083] After scratching the fungus, arrange the cultivation bags on the mushroom rack as usual, and then perform environmental control in the following stages:

[0084] a. Bud induction period (days 1-7 after scratching): Control the temperature at 17-18℃, relative humidity at 100% (maintained by spray humidification), white light irradiation for 12 hours / day (light intensity 200-500 lux), and CO2 concentration at 1500-2000 ppm. This stage promotes primordium formation.

[0085] b. Inhibition period (8-17 days after scratching): Control the temperature at 17-18℃, relative humidity at 96%-98%, no light (dark conditions), and CO2 concentration at 4000-8000 ppm. During this stage, high CO2 and low humidity inhibit cap expansion and promote stipe elongation.

[0086] c. Elongation period (days 18-22 after scratching): Control the temperature at 17-18℃, relative humidity at 98%-100%, white light for 10 hours / day (light intensity 200-500 lux), and CO2 concentration at 2000-3000 ppm. During this stage, the stipe continues to elongate, and the cap begins to differentiate.

[0087] d. Maturation stage (23-26 days after scratching): Control the temperature at 16-17℃, relative humidity at 96%-98%, white light for 16 hours / day (light intensity 200-500 lux), and CO2 concentration at 1500-2000 ppm. This stage promotes the maturation and uniform color of the fruiting bodies.

[0088] 8. Harvesting

[0089] When the mushroom cap diameter is 1.5 cm to 3 cm and the stem length is 8 cm to 12 cm, it can be harvested promptly. When harvesting, hold the base of the stem and gently twist and pull it out, remove any remaining substrate from the roots, and then grade and package it according to commercial specifications.

[0090] Example 5:

[0091] From September 2024 to September 2025, strain LD563 and control LD37 underwent two regional trials and one production trial at three locations: Jiangsu Hemu Agricultural Expo Park Co., Ltd., Jiangsu Jiangnan Biotechnology Co., Ltd., and Lianyungang Youhe Edible Fungus Co., Ltd. The trials employed a factory-style cultivation model, using 22 cm × 36 cm cultivation bags, each filled with 750 g of dry substrate. The bags were arranged horizontally on shelves. In the regional trials, each plot contained 54 bags with three replicates; in the production trial, each plot contained 504 bags with two replicates. Both strains were planted adjacent to each other. When the fruiting bodies reached 13-15 cm in length and the caps had not yet opened, phenotypic characteristics were observed, with 30 samples taken each time.

[0092] Table 3 Comparison of fruiting body characteristics between strain LD563 and control LD37

[0093]

[0094] According to the results in Table 3, strain LD563 showed significant differences from the control LD37 in the characteristics of its fruiting bodies. Specifically, the longitudinal section of the cap of LD563 was flat, while that of LD37 was round. The center of the cap of LD563 was dark gray, while that of LD37 was light gray. The cap of LD563 was thicker than that of LD37, by 0.70 cm and 0.58 cm, respectively. The maximum diameter of the stipe of LD563 was thicker than that of LD37, by 2.11 cm and 1.87 cm, respectively. The stipe of LD563 was light gray, while that of LD37 was light grayish-white. The number of fruiting bodies of LD563 was less than that of LD37, by 78 and 91, respectively. The fruiting body yield of LD563 was higher than that of LD37, by 0.91 kg and 0.85 kg, respectively.

[0095] Table 4. Comparison of yield between strain LD563 and control LD37.

[0096]

[0097] According to the results in Table 4, the average yield of strain LD563 in the first regional trial was 0.910 kg / bag (biological conversion rate 121.33%), the average yield in the second regional trial was 0.912 kg / bag (biological conversion rate 121.60%), and the average yield in the production trial was 0.915 kg / bag (biological conversion rate 122.00%), representing increases of 7.69%, 7.80%, and 7.90% respectively compared to the control LD37. Strain LD563 exhibits high yield and significant specificity, making it suitable for industrial cultivation.

[0098] Example 6:

[0099] The fruiting bodies of *Pleurotus ostreatus* were dried by gradually increasing the temperature from 35℃ to 65℃ to prepare samples for testing. Subsequently, the contents of protein, fat, carbohydrates, total sugar, crude fiber, ash, total amino acids, vitamin B2, and niacin in strain LD563 and the control LD37 were determined and compared.

[0100] Table 5. Comparison of quality test data between strain LD563 and control LD37

[0101]

[0102] According to the results in Table 5, strain LD563 was superior to the control LD37 in terms of carbohydrate, total sugar, and vitamin B2 content. Specifically, LD563 had a 1.9% higher carbohydrate content, a 1.70% higher total sugar content, and a 0.62 mg / 100g higher vitamin B2 content than LD37. This difference suggests that LD563 may have a stronger metabolic advantage in nutrient accumulation, especially in the biosynthesis of carbohydrates and vitamin B2. The higher carbohydrate and total sugar content can provide more sufficient carbon and energy support for fruiting body growth, while the increased vitamin B2 content, as a key coenzyme component, also reflects the potential advantage of this strain in physiological metabolic efficiency. These improvements in nutritional indicators may provide an intrinsic physiological basis for the superior yield and quality performance of LD563.

[0103] sequence list

[0104] The full 16SRNA sequence (SEQ ID NO:1) of Lyophyllum decastes strain LD563:

[0105] TTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTAGTCTTGTCTGATTTGAGGTCAAAAAGTCAGAAGCTGTCCTTAGAGGACGGTTAGAAGCAAAACCTCTCAACTAGTTGAGGCTGACACTCTAGTGGCGTAGATAATTATCACACCAAGAGATGATCAACAAAGGTTTCACTAATGCATTTCAGAGGAGCCGACTTCTGTGAAGCCCGCAAACCCCCACATCCAAGCCTAACCAAACTCGCAAAAGTTGGAAAAGTTGAGAATTTAATGACACTCAAACAGACATGCTCCCCGGAATACCAGGGAGCGCCAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATTTGATTAAAGGCACAAAGGCCAGTAAACGACATTCTGTTACATTCATATGGGGTATGTAAAGACATAGACCGGAAATGTAAGAAAAGCTAGGGGCTTTCGCTCAGCAGTCCTCAAACCGAGTTTCCTCGAAAGATATCCAGGTCTACAAAAGGTGCACAGGTGGTAAAGATGGAGCTAGGCGTGCACATGCTCCTAGGAGCCAGCAACAGCCCAACCAAATTTATTCAATAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCA。

Claims

1. A strain of Lyophyllum decastes, LD563, characterized in that, The preservation number of the *Pleurotus ostreatus* strain LD563 is GDMCC NO.66927.

2. A type of *Pleurotus ostreatus* spore, characterized in that, The spores obtained after culturing the *Deer Antler Fungus* strain LD563 as described in claim 1.

3. A type of *Flammulina velutipes* mycelium, characterized in that, The mycelium obtained for culturing the *Deer Antler Fungus* strain LD563 as described in claim 1.

4. A fruiting body of *Fungiformis cuspidatum*, characterized in that, Fruiting bodies obtained by cultivating the *Deer Antler Fungus* strain LD563 as described in claim 1.

5. The application of the *Pleurotus ostreatus* strain LD563 as described in claim 1 in the industrialized cultivation of *Pleurotus ostreatus*.

6. The application of the fruiting body of *Flammulina velutipes* as described in claim 4 in food processing.

7. A liquid culture medium for culturing the *Deer Antler Fungus* strain LD563 according to claim 1, characterized in that, The liquid culture medium contains the following components: glucose 10-50 g / L, soybean flour 1-5 g / L, magnesium sulfate 0.5-2 g / L, potassium dihydrogen phosphate 0.5-5 g / L, yeast extract 1-5 g / L, and antifoaming agent 0.1-0.5 mL / L; the pH of the culture medium is 6.5-7.

0.

8. A method for preparing a liquid culture of the *Pleurotus ostreatus* strain LD563 according to claim 1, characterized in that, Using the liquid culture medium as described in claim 7, the culture was carried out in a fermenter at 22°C to 23°C, a pressure of 0.06 MPa to 0.07 MPa, and an aeration rate of 0.8 to 1.2 vvm for 6 to 7 days.

9. A method for cultivating the *Pleurotus ostreatus* strain LD563 of claim 1, characterized in that, The method includes the following steps: (1) Inoculation and mycelium growth: The liquid inoculum of the LD563 strain of the deer antler mushroom was inoculated into the sterilized cultivation substrate and cultured in an environment with a temperature of 20℃~25℃, relative humidity of 60%~80%, and CO2 concentration of 2000~4000 ppm until the mycelium filled the bag. The cultivation material, by weight percentage, comprises: 30%–50% sawdust, 10%–30% corn cob, 10%–30% wheat bran, 1%–5% soybean meal, 1%–10% corn flour, 1%–10% cottonseed hulls, and 1%–5% calcium carbonate, with the sum of the weight percentages of each component being 100%. (2) Scratching: Scratching should be performed 70-100 days after inoculation; (3) Mushroom Management: After scratching the fungus, environmental control should be carried out in the following stages: a. Days 1-7 after scratching: temperature 17-18℃, humidity 100%, white light irradiation 12 hours / day, CO2 concentration 1500-2000ppm; b. Days 8-17 after scratching: temperature 17-18℃, humidity 96%-98%, no light, CO2 concentration 4000-8000 ppm; c. Days 18-22 after scratching: temperature 17-18℃, humidity 98%-100%, white light irradiation 6-12 hours / day, CO2 concentration 2000-3000 ppm; d. Days 23-26 after scratching: temperature 16-17℃, humidity 96%-98%, white light irradiation 12-18 hours / day, CO2 concentration 1500-2000 ppm.

10. The method according to claim 9, characterized in that, In step (3), the CO2 concentration on days 8 to 17 after scratching is 5000 to 8000 ppm; the daytime light exposure on days 18 to 22 after scratching is 8 to 12 hours / day.

Images