Lactobacillus reuteri with the ability of reducing uric acid and application thereof

Abstract

The present application belongs to the field of microorganisms, and particularly relates to a lactobacillus reuteri with the ability of reducing uric acid and application thereof. Limosilactobacillus reuteri ) AMCC 12149, and the preservation number is CCTCC NO: M 20242932. The lactobacillus reuteri AMCC 12149 provided by the present application has the ability of rapidly degrading guanosine and inosine, has the ability of efficiently inhibiting the activity of xanthine oxidase in vitro, has good hydrophobicity and cohesiveness, and has the potential of continuously existing in the gastrointestinal tract and exerting beneficial effects.

Description

Technical Field

[0001] This invention belongs to the field of microbiology, specifically relating to *Lactobacillus reuteri* with uric acid-lowering ability and its applications. Background Technology

[0002] Hyperuricemia (HUA) is a disease characterized by serum uric acid levels exceeding the normal range due to purine metabolism disorders. Currently, treatment methods mainly include dietary therapy, drug therapy, and biological therapy. Among these, biological therapy has gained widespread acceptance due to its low side effects and cost-effectiveness. Research has found that some lactic acid bacteria have a highly effective ability to lower uric acid, such as *Lactobacillus brevis*. Levilactobacillus brevis DM9218 and Lactobacillus casei Lacticaseibacillus casei PA-3 can degrade intermediate metabolites such as purines, thereby improving the condition of hyperuricemia.

[0003] *Lactobacillus reuteri* is a Gram-positive rod-shaped bacterium widely distributed in various foods (especially meat and dairy products) and the intestines of many mammals. It is not only one of the dominant microorganisms in the mammalian gut but also one of the most common microorganisms in the human gut. Currently, this strain is recognized as an important new probiotic lactic acid bacterium with extremely high theoretical research and production application value. It has shown good application potential in the food, pharmaceutical, and health product fields.

[0004] Chinese patent application CN116286528A discloses a strain of *Lactobacillus reuteri* CKCC11157. However, the bacterial suspension of *Lactobacillus reuteri* CKCC11157 showed an inhibition rate of only 26.78% against xanthine oxidase, and the metabolites of *Lactobacillus reuteri* CKCC11157 showed an inhibition rate of only 18.36% against xanthine oxidase. It is evident that this strain has a low inhibition rate against xanthine oxidase.

[0005] Chinese patent application CN116585362A discloses a strain of *Lactobacillus reuteri* HCS02-001. However, this strain exhibits a degradation rate of only 29.03% for inosine and only 26.47% for guanosine. This indicates that the degradation rate of inosine and guanosine by this strain is relatively low. Summary of the Invention

[0006] The problem with the existing technology is that there is a lack of *Lactobacillus reuteri* that can rapidly degrade guanosine and inosine and inhibit xanthine oxidase activity in vitro. This results in the *Lactobacillus reuteri* in the existing technology generally having insufficient uric acid-lowering ability, which limits the application of *Lactobacillus reuteri* in the field of uric acid-lowering drugs.

[0007] To address the problems existing in the prior art, the present invention provides *Lactobacillus reuteri* with uric acid-lowering ability and its applications, the specific technical solution of which is as follows: Technical Solution 1: A type of *Lactobacillus reuteri*, characterized in that the *Lactobacillus reuteri* is: *Lactobacillus reuteri* (… Limosilactobacillus reuteri AMCC 12149, accession number CCTCC NO: M20242932.

[0008] Technical Solution 2: The *Lactobacillus reuteri* according to Technical Solution 1, characterized in that the *Lactobacillus reuteri* AMCC 12149... pheS The gene sequence is shown in SEQ ID NO.3. Preferably, it has the ability to inhibit xanthine oxidase activity and / or the ability to degrade purine compounds. More preferably, the purine compounds include guanosine and / or inosine, and / or are hydrophobic and / or have self-aggregating ability.

[0009] Technical Solution 3: A type of *Lactobacillus reuteri*, characterized in that the *Lactobacillus reuteri* is: *Lactobacillus reuteri* (… Limosilactobacillus reuteri AMCC 10930, accession number CCTCC NO: M2025224.

[0010] Technical Solution 4: The *Lactobacillus reuteri* according to Technical Solution 3, characterized in that the *Lactobacillus reuteri* AMCC 10930... pheS The gene sequence is shown in SEQ ID NO.4, and preferably, it has the ability to inhibit xanthine oxidase activity and / or the ability to degrade purine compounds. More preferably, the purine compound includes guanosine and / or inosine, and / or is hydrophobic, and / or has self-aggregating ability.

[0011] Technical Solution 5: According to Technical Solution 1 or 2, the *Lactobacillus reuteri* strain AMCC 12149 exhibits an inhibition rate of ≥40.00% against xanthine oxidase activity, preferably 43.00%-50.00%. The degradation rate of guanosine by Lactobacillus reuteri AMCC 12149 cells is greater than or equal to 49.00 μg / mL·min, preferably 49.00-115.00 μg / mL·min, more preferably 70.00-115.00 μg / mL·min, and even more preferably, the concentration of guanosine is greater than or equal to 10 mmol / L; The degradation rate of inosine by Lactobacillus reuteri AMCC 12149 cells is greater than or equal to 45.00 μg / mL·min, preferably 45.00-101.00 μg / mL·min, more preferably 64.00-101.00 μg / mL·min, and even more preferably, the concentration of inosine is greater than or equal to 10 mmol / L; The hydrophobicity of *Lactobacillus reuteri* AMCC 12149 cells is greater than or equal to 35%, preferably greater than or equal to 35.00% and less than or equal to 45.00%. This hydrophobicity refers to the retention of the *Lactobacillus reuteri* AMCC 12149 cell pellet after solid-liquid separation of the bacterial culture in MRS liquid medium, followed by resuspending the *Lactobacillus reuteri* AMCC 12149 cell pellet in buffer to obtain the OD (Organic Degradation). 600 The hydrophobicity of *Lactobacillus reuteri* AMCC 12149 cells was measured after mixing the bacterial suspension with xylene and allowing it to stand for 3 hours. And / or the autoaggregation rate of *Lactobacillus reuteri* AMCC 12149 cells is greater than or equal to 20.00%, wherein the autoaggregation rate refers to the bacterial suspension obtained by solid-liquid separation of the bacterial culture in MRS liquid medium, retaining the bacterial cell pellet, resuspending the bacterial cell pellet in buffer, and measuring the OD of the supernatant of the bacterial suspension. 600 The value was used as the initial OD value of the supernatant. 600 Value. After incubating the bacterial suspension statically for 4-24 h, the OD value of the supernatant was measured. 600 The value was used as the OD value after culturing the supernatant for 4-24 hours. 600 Value, then according to the formula: Self-condensation rate (%) = (1-A) t / A0)×100%, A t The OD value is represented by the supernatant cultured for 4-24 hours. 600 Value; A0 represents the initial OD of the supernatant. 600 The calculated value is the self-condensation rate.

[0012] Preferably, the 4-hour autoaggregation rate of *Lactobacillus reuteri* AMCC 12149 is greater than or equal to 20.00%, more preferably greater than or equal to 20.00% and less than or equal to 25.00%, wherein the 4-hour autoaggregation rate refers to the bacterial suspension obtained by solid-liquid separation of the bacterial culture in MRS liquid medium, retaining the bacterial cell pellet, and resuspending the bacterial cell pellet in buffer solution, wherein the OD of the supernatant of the bacterial suspension is measured. 600 The value is used as the initial OD value of the supernatant. 600 Value. After resuspending the bacterial cell pellet in buffer and incubating for 4 h, the OD value of the supernatant was measured.600 The value was used as the OD value after 4 hours of culture in the supernatant. 600 Value, then according to the formula: Self-condensation rate (%) = (1-A) t / A0)×100%, A t The OD value is represented by the supernatant cultured for 4 hours. 600 Value; A0 represents the initial OD of the supernatant. 600 The calculated value is the 4-hour self-condensation rate.

[0013] Preferably, the 12-hour autoaggregation rate of *Lactobacillus reuteri* AMCC 12149 is greater than or equal to 30.00%, more preferably greater than or equal to 30.00% and less than or equal to 37.00%, wherein the 12-hour autoaggregation rate refers to the bacterial suspension obtained by solid-liquid separation of the bacterial culture in MRS liquid medium, retaining the bacterial cell pellet, and resuspending the bacterial cell pellet in buffer solution to obtain a bacterial suspension, wherein the OD of the supernatant of the bacterial suspension is measured. 600 The value is used as the initial OD value of the supernatant. 600 Value. After resuspending the bacterial cell pellet in buffer and incubating for 12 h, the OD value of the supernatant was measured. 600 The value was used as the OD value after 12 hours of culture in the supernatant. 600 Value, then according to the formula: Self-condensation rate (%) = (1-A) t / A0)×100%, A t The OD value is represented by the supernatant cultured for 12 hours. 600 Value; A0 represents the initial OD of the supernatant. 600 The calculated value is the self-condensation rate over 12 hours.

[0014] Preferably, the 24-hour autoaggregation rate of *Lactobacillus reuteri* AMCC 12149 cells is greater than or equal to 57.00%, more preferably greater than or equal to 57.00% and less than or equal to 60.00%, wherein the 24-hour autoaggregation rate refers to the bacterial suspension obtained by solid-liquid separation of the bacterial culture in MRS liquid medium, retaining the bacterial cell pellet, and resuspending the bacterial cell pellet in buffer solution, wherein the OD of the supernatant of the bacterial suspension is measured. 600 The value is used as the initial OD value of the supernatant. 600 Value. After resuspending the bacterial cell pellet in buffer and incubating for 24 h, the OD value of the supernatant was measured. 600 The value was used as the OD value after 24 hours of culture in the supernatant. 600 Value, then according to the formula: Self-condensation rate (%) = (1-A) t / A0)×100%, A t The OD value is represented by the supernatant after 24 hours of incubation. 600 Value; A0 represents the initial OD of the supernatant. 600The calculated value is the 24-hour self-condensation rate.

[0015] Technical Solution 6: According to Technical Solution 3 or 4, the *Lactobacillus reuteri* is characterized in that the bacterial cells of *Lactobacillus reuteri* AMCC 10930 inhibit xanthine oxidase activity by ≥52.00%, preferably 52.00-60.00%; And / or the *Lactobacillus reuteri* AMCC 10930 cells described above, wherein the degradation rate of guanosine is greater than or equal to 46.00 μg / mL·min, preferably 46.00-136.00 μg / mL·min, more preferably 69.00-136.00 μg / mL·min, and even more preferably, the concentration of guanosine is greater than or equal to 10 mmol / L; And / or Lactobacillus reuteri AMCC 10930 cells, with a degradation rate of inosine greater than or equal to 44.00 μg / mL·min, preferably 44.00-131.00 μg / mL·min, more preferably 66.00-131.00 μg / mL·min, and even more preferably, the concentration of inosine is greater than or equal to 10 mmol / L; The hydrophobicity of *Lactobacillus reuteri* AMCC 10930 cells is greater than 35%, preferably greater than or equal to 35.00% and less than or equal to 45.00%, wherein the hydrophobicity refers to the retention of *Lactobacillus reuteri* AMCC 10930 cell pellet after solid-liquid separation of the bacterial culture in MRS liquid medium, and the obtaining of OD after resuspending the *Lactobacillus reuteri* AMCC 10930 cell pellet in buffer. 600 The hydrophobicity of *Lactobacillus reuteri* AMCC 10930 cells was measured after mixing the bacterial suspension with xylene and allowing it to stand for 3 hours. And / or the autoaggregation rate of *Lactobacillus reuteri* AMCC 10930 cells is greater than or equal to 24.00%, wherein the autoaggregation rate refers to the bacterial suspension obtained by solid-liquid separation of the bacterial culture in MRS liquid medium, retaining the bacterial cell pellet, and resuspending the bacterial cell pellet in buffer solution, wherein the OD of the supernatant of the bacterial suspension is measured. 600 The value is used as the initial OD value of the supernatant. 600 Value. After resuspending the bacterial cell pellet in buffer and incubating for 4-24 h, the OD value of the supernatant was measured. 600 The value was used as the OD value after culturing the supernatant for 4-24 hours. 600 Value, then according to the formula: Self-condensation rate (%) = (1-A) t / A0)×100%, where A t The OD value is represented by the supernatant cultured for 4-24 hours.600 Value; A0 represents the initial OD of the supernatant. 600 The calculated value is the self-condensation rate.

[0016] Preferably, the 4-hour self-aggregation rate of *Lactobacillus reuteri* AMCC 10930 cells is greater than or equal to 24.00%, more preferably greater than or equal to 24.00% and less than or equal to 30.00%, wherein the 4-hour self-aggregation rate refers to the bacterial suspension obtained by solid-liquid separation of the bacterial culture in MRS liquid medium, retaining the bacterial cell pellet, and resuspending the bacterial cell pellet in buffer solution, wherein the OD of the supernatant of the bacterial suspension is measured. 600 The value is used as the initial OD value of the supernatant. 600 Value. After resuspending the bacterial cell pellet in buffer and incubating for 4 h, the OD value of the supernatant was measured. 600 The value was used as the OD value after 4 hours of culture in the supernatant. 600 Value, then according to the formula: Self-condensation rate (%) = (1-A) t / A0)×100%, where A t The OD value is represented by the supernatant cultured for 4 hours. 600 Value; A0 represents the initial OD of the supernatant. 600 The calculated value is the 4-hour self-condensation rate.

[0017] Preferably, the 12-hour self-aggregation rate of *Lactobacillus reuteri* AMCC 10930 cells is greater than or equal to 50.00%, more preferably greater than or equal to 50.00% and less than or equal to 55.00%, wherein the 12-hour self-aggregation rate refers to the bacterial suspension obtained by solid-liquid separation of the bacterial culture in MRS liquid medium, retaining the bacterial cell pellet, and resuspending the bacterial cell pellet in buffer solution, wherein the OD of the supernatant of the bacterial suspension is measured. 600 The value is used as the initial OD value of the supernatant. 600 Value. After resuspending the bacterial cell pellet in buffer and incubating for 12 h, the OD value of the supernatant was measured. 600 The value was used as the OD value after 12 hours of culture in the supernatant. 600 Value, then according to the formula: Self-condensation rate (%) = (1-A) t / A0)×100%, where A t The OD value is represented by the supernatant cultured for 12 hours. 600 Value; A0 represents the initial OD of the supernatant. 600 The calculated value is the self-condensation rate over 12 hours.

[0018] Preferably, the 24-hour self-aggregation rate of *Lactobacillus reuteri* AMCC 10930 cells is greater than or equal to 65.00%, more preferably greater than or equal to 65.00% and less than or equal to 70.00%, wherein the 24-hour self-aggregation rate refers to the bacterial suspension obtained by solid-liquid separation of the bacterial culture in MRS liquid medium, retaining the bacterial cell pellet, and resuspending the bacterial cell pellet in buffer solution, wherein the OD of the supernatant of the bacterial suspension is measured. 600 The value is used as the initial OD value of the supernatant. 600 Value. After resuspending the bacterial cell pellet in buffer and incubating for 24 h, the OD value of the supernatant was measured. 600 The value was used as the OD value after 24 hours of culture in the supernatant. 600 Value, then according to the formula: Self-condensation rate (%) = (1-A) t / A0)×100%, where A t The OD value is represented by the supernatant after 24 hours of incubation. 600 Value; A0 represents the initial OD of the supernatant. 600 The calculated value is the 24-hour self-condensation rate.

[0019] Technical Solution 7: The application of *Lactobacillus reuteri* as described in any one of Technical Solutions 1-6 in the preparation of bacterial agents, extracellular metabolites, and intracellular metabolites.

[0020] Technical Solution 8: A method for preparing extracellular metabolites, characterized in that the extracellular metabolites include one or a combination of two of the following: extracellular metabolites of *Lactobacillus reuteri* AMCC 12149 and extracellular metabolites of *Lactobacillus reuteri* AMCC 10930. The extracellular metabolites of *Lactobacillus reuteri* AMCC 12149 are prepared by a method including the following steps: expanding the culture of *Lactobacillus reuteri* as described in technical solutions 1, 2, or 5. Alternatively, the extracellular metabolites of *Lactobacillus reuteri* AMCC 10930 may be prepared by a method comprising the following steps: expanding the culture of *Lactobacillus reuteri* as described in technical solutions 3, 4, or 6.

[0021] Technical Solution 9: The preparation method according to Technical Solution 8 is characterized in that, after expanding the culture of *Lactobacillus reuteri* AMCC 12149, it further includes: performing solid-liquid separation on the *Lactobacillus reuteri* AMCC 12149 bacterial solution obtained after expanding the culture of *Lactobacillus reuteri* AMCC 12149, and retaining the supernatant to obtain *Lactobacillus reuteri* AMCC 12149 extracellular metabolites; specifically, it includes the following steps: *Lactobacillus reuteri* AMCC 12149 extracellular metabolites are prepared by a method including the following steps: expanding the culture of *Lactobacillus reuteri* AMCC 12149 to obtain *Lactobacillus reuteri* AMCC 12149 bacterial solution; separating the solid and liquid components of the *Lactobacillus reuteri* AMCC 12149 bacterial solution, and retaining the supernatant to obtain *Lactobacillus reuteri* AMCC 12149 extracellular metabolites; preferably, *Lactobacillus reuteri* AMCC 12149... The concentration of *Lactobacillus reuteri* AMCC12149 in the bacterial culture was 1.0 × 10⁻⁶. 9 - 1.0 × 10 12 CFU / mL; Alternatively, after expanding the culture of *Lactobacillus reuteri* AMCC 10930, the method may further include: performing solid-liquid separation on the *Lactobacillus reuteri* AMCC 10930 bacterial culture obtained after expanding the culture, and retaining the supernatant to obtain *Lactobacillus reuteri* AMCC 10930 extracellular metabolites; specifically, it includes the following steps: the *Lactobacillus reuteri* AMCC 10930 extracellular metabolites are prepared by a method including the following steps: expanding the culture of *Lactobacillus reuteri* AMCC 10930 to obtain *Lactobacillus reuteri* AMCC 10930 bacterial culture; performing solid-liquid separation on the *Lactobacillus reuteri* AMCC 10930 bacterial culture, and retaining the supernatant to obtain *Lactobacillus reuteri* AMCC 10930 extracellular metabolites; preferably, *Lactobacillus reuteri* AMCC... The concentration of *Lactobacillus reuteri* AMCC10930 in the bacterial culture was 1.0 × 10⁻⁶. 9 - 1.0 × 10 12 CFU / mL Preferably, the solid-liquid separation is centrifugal separation. More preferably, the culture medium used for expansion culture includes tryptone, beef extract, glucose, sodium acetate, yeast extract, magnesium sulfate heptahydrate, manganese sulfate monohydrate, diammonium hydrogen citrate, dipotassium hydrogen phosphate, and Tween 80. More preferably, the culture medium further includes water, and each L of the culture medium contains 10-20 g of tryptone, and / or 10-20 g of beef extract, and / or 5-20 g of glucose, and / or 2-4 g of sodium acetate, and / or 5-10 g of yeast extract, and / or 0.1-0.2 g of magnesium sulfate heptahydrate, and / or 0.05-0.1 g of manganese sulfate monohydrate, and / or 0.2-0.4 g of diammonium hydrogen citrate, and / or 0.2-0.4 g of dipotassium hydrogen phosphate, and / or 0.5-1 mL of Tween 80, with the remainder being water.

[0022] Technical Solution 10: An extracellular metabolite, characterized in that it is prepared by the preparation method described in Technical Solution 8 or 9, wherein the extracellular metabolite refers to all metabolic products secreted outside the cells (i.e., culture medium / supernatant) by cultured *Lactobacillus reuteri* cells. Preferably, the extracellular metabolites of *Lactobacillus reuteri* AMCC 12149 inhibit xanthine oxidase activity by ≥92%, more preferably ≥92.00% and ≤95.00%; The extracellular metabolites of Lactobacillus reuteri AMCC 10930 inhibit xanthine oxidase activity by ≥82%, preferably ≥82.00% and ≤85.00%.

[0023] Technical Solution 11: A method for preparing intracellular metabolites, characterized in that the intracellular metabolites include one or a combination of two of the following: intracellular metabolites of *Lactobacillus reuteri* AMCC 12149 and intracellular metabolites of *Lactobacillus reuteri* AMCC 10930. The intracellular metabolites of *Lactobacillus reuteri* AMCC 12149 are prepared by a method including the following steps: expanding the culture of *Lactobacillus reuteri* as described in technical solutions 1, 2, or 5. Alternatively, the intracellular metabolites of *Lactobacillus reuteri* AMCC 10930 may be prepared by a method comprising the following steps: expanding the culture of *Lactobacillus reuteri* as described in technical solutions 3, 4, or 6.

[0024] Technical Solution 12: The preparation method according to Technical Solution 11 is characterized in that, after expanding the culture of *Lactobacillus reuteri* AMCC 12149, it further includes: performing solid-liquid separation on the bacterial culture obtained after expanding the culture of *Lactobacillus reuteri* AMCC 12149 to retain the bacterial cell precipitate; mixing the bacterial cell precipitate with buffer, breaking the bacterial cells, and separating the solid and liquid components to retain the supernatant; specifically, it includes the following steps: the intracellular metabolites of *Lactobacillus reuteri* AMCC 12149 are prepared by a method including the following steps: expanding the culture of *Lactobacillus reuteri* AMCC 12149, performing solid-liquid separation to retain the bacterial cell precipitate, mixing the bacterial cell precipitate with buffer, breaking the bacterial cells, and separating the solid and liquid components to retain the supernatant; Alternatively, after expanding the culture of *Lactobacillus reuteri* AMCC 10930, the method may further include: expanding the culture of *Lactobacillus reuteri* AMCC 10930 obtained by expanding the culture, separating the bacterial cells to retain the precipitate, mixing the precipitate with a buffer solution, breaking the bacterial cells, separating the solid and liquid components, and retaining the supernatant; specifically, it includes the following steps: the intracellular metabolites of *Lactobacillus reuteri* AMCC 10930 are prepared by a method including the following steps: expanding the culture of *Lactobacillus reuteri* AMCC 10930, separating the bacterial cells to retain the precipitate, mixing the precipitate with a buffer solution, breaking the bacterial cells, separating the solid and liquid components, and retaining the supernatant; preferably, the solid-liquid separation is centrifugation. Preferably, the components of the culture medium used for expansion culture include tryptone, beef extract, glucose, sodium acetate, yeast extract, magnesium sulfate heptahydrate, manganese sulfate monohydrate, diammonium citrate, dipotassium hydrogen phosphate, and Tween 80. More preferably, the culture medium also includes water. Each L of the culture medium contains 10-20 g of tryptone, and / or 10-20 g of beef extract, and / or 5-20 g of glucose, and / or 2-4 g of sodium acetate, and / or 5-10 g of yeast extract, and / or 0.1-0.2 g of magnesium sulfate heptahydrate, and / or 0.05-0.1 g of manganese sulfate monohydrate, and / or 0.2-0.4 g of diammonium citrate, and / or 0.2-0.4 g of dipotassium hydrogen phosphate, and / or 0.5-1 mL of Tween 80, with the remainder being water.

[0025] Preferably, the method for preparing the intracellular metabolites of *Lactobacillus reuteri* AMCC 12149 includes the following steps: (1) expanding the culture of *Lactobacillus reuteri* AMCC 12149 as described in technical solutions 1, 2, or 5 to obtain a suspension of *Lactobacillus reuteri* AMCC 12149; (2) separating the solid and liquid components of the bacterial culture of *Lactobacillus reuteri* AMCC 12149 obtained in step (1) and retaining the precipitate to obtain a bacterial precipitate of *Lactobacillus reuteri* AMCC 12149; (3) resuspending the bacterial precipitate of *Lactobacillus reuteri* AMCC 12149 obtained in step (2) to obtain a bacterial suspension of *Lactobacillus reuteri* AMCC 12149. Preferably, the concentration of the bacterial suspension of *Lactobacillus reuteri* AMCC 12149 is 1.0 × 10⁻⁶. 9 - 1.0 ×10 12 CFU / mL; (4) After the bacterial suspension of Lactobacillus reuteri AMCC 12149 is broken and solid-liquid separated, the supernatant is retained to obtain intracellular metabolites of Lactobacillus reuteri AMCC 12149. Preferably, the breaking treatment is ultrasonic breaking treatment and / or the solid-liquid separation is centrifugation.

[0026] Alternatively, the method for preparing intracellular metabolites of *Lactobacillus reuteri* AMCC 10930 may include the following steps: (1) expanding the culture of *Lactobacillus reuteri* AMCC 10930 as described in technical solutions 3, 4, or 6 to obtain a bacterial suspension of *Lactobacillus reuteri* AMCC 10930; (2) separating the solid and liquid components of the bacterial suspension of *Lactobacillus reuteri* AMCC 10930 obtained in step (1) and retaining the precipitate to obtain a bacterial cell precipitate of *Lactobacillus reuteri* AMCC 10930; (3) resuspending the bacterial cell precipitate of *Lactobacillus reuteri* AMCC 10930 obtained in step (2) to obtain a bacterial suspension of *Lactobacillus reuteri* AMCC 10930, preferably, the concentration of the bacterial suspension of *Lactobacillus reuteri* AMCC 10930 is 1.0 × 10⁻⁶. 9 - 1.0 ×10 12 CFU / mL; (4) After the bacterial suspension of Lactobacillus reuteri AMCC 10930 is broken and solid-liquid separated, the supernatant is retained to obtain intracellular metabolites of Lactobacillus reuteri AMCC 10930. Preferably, the breaking treatment is ultrasonic breaking treatment and / or the solid-liquid separation is centrifugation.

[0027] Technical Solution 13: An intracellular metabolite, characterized in that it is prepared by the preparation method described in Technical Solution 11 or 12, wherein the intracellular metabolite refers to all small molecule metabolites present inside cultured *Lactobacillus reuteri* cells that participate in metabolic reactions. Preferably, the intracellular metabolites of *Lactobacillus reuteri* AMCC 12149 inhibit xanthine oxidase activity by ≥73%, and more preferably, by 73%-80%. The intracellular metabolites of *Lactobacillus reuteri* AMCC 10930 inhibit xanthine oxidase activity by ≥46%, preferably 46%-50%.

[0028] Technical Solution 14: A method for preparing a microbial agent, characterized in that the microbial agent comprises one or a combination of two of *Lactobacillus reuteri* AMCC 12149 and *Lactobacillus reuteri* AMCC 10930. The Lactobacillus reuteri AMCC 12149 bacterial agent is prepared by a method including the following steps: expanding the culture of Lactobacillus reuteri as described in technical solutions 1, 2, or 5; Alternatively, the *Lactobacillus reuteri* AMCC 10930 bacterial agent may be prepared by a method including the following steps: expanding the culture of *Lactobacillus reuteri* as described in technical solutions 3, 4, or 6.

[0029] Technical Solution 15: The preparation method according to Technical Solution 14 is characterized in that, after expanding the culture of *Lactobacillus reuteri* AMCC 12149, it further includes: performing solid-liquid separation on the *Lactobacillus reuteri* AMCC 12149 bacterial solution obtained after expanding the culture of *Lactobacillus reuteri* AMCC 12149 to retain the bacterial cell precipitate; that is, it specifically includes the following steps: the *Lactobacillus reuteri* AMCC 12149 bacterial agent is obtained by expanding the culture of *Lactobacillus reuteri* as described in Technical Solution 1, 2, or 5, and then performing solid-liquid separation to retain the bacterial cell precipitate; Alternatively, after expanding the culture of *Lactobacillus reuteri* AMCC 10930, the method may further include: separating the bacterial solution of *Lactobacillus reuteri* AMCC 10930 obtained after expanding the culture of *Lactobacillus reuteri* AMCC 10930 into solid and liquid form, retaining the bacterial cell precipitate; specifically, it includes the following steps: the *Lactobacillus reuteri* AMCC 10930 bacterial agent is obtained by expanding the culture of *Lactobacillus reuteri* as described in technical solutions 3, 4, or 6, and then separating the bacterial solution into solid and liquid form, retaining the bacterial cell precipitate. Preferably, the components of the culture medium used for the expanded culture include: tryptone, beef extract, glucose, sodium acetate, yeast extract, magnesium sulfate heptahydrate, manganese sulfate monohydrate, diammonium citrate, dipotassium hydrogen phosphate, and Tween 80. More preferably, the culture medium also includes water. Each L of the culture medium contains 10-20 g of tryptone, and / or 10-20 g of beef extract, and / or 5-20 g of glucose, and / or 2-4 g of sodium acetate, and / or 5-10 g of yeast extract, and / or 0.1-0.2 g of magnesium sulfate heptahydrate, and / or 0.05-0.1 g of manganese sulfate monohydrate, and / or 0.2-0.4 g of diammonium citrate, and / or 0.2-0.4 g of dipotassium hydrogen phosphate, and / or 0.5-1 mL of Tween 80, with the remainder being water.

[0030] Preferably, before obtaining the Lactobacillus reuteri AMCC 12149 bacterial agent, the method further includes washing and drying the Lactobacillus reuteri AMCC 12149 bacterial cell precipitate; Before obtaining the *Lactobacillus reuteri* AMCC 10930 bacterial agent, the process also includes washing and drying the *Lactobacillus reuteri* AMCC 10930 bacterial cell precipitate. Preferably, the drying method is vacuum freeze drying. More preferably, the vacuum freeze-drying temperature is -85 to -80°C, and / or the vacuum degree of vacuum freeze-drying is 0-2 Pa, and / or the vacuum freeze-drying time is 40-48 h. Even more preferably, the vacuum freeze-drying process includes pre-freezing at -45 to -40°C for 3-4 h before vacuum freeze-drying. More preferably, the freeze-drying protectant used in vacuum freeze-drying comprises skim milk powder, maltodextrin, trehalose and monosodium glutamate. Even more preferably, the weight ratio of skim milk powder, maltodextrin, trehalose and monosodium glutamate is 2-4:9-11:5-7:1-3.

[0031] Technical Solution 16: A microbial agent, characterized in that it comprises one or a combination of two of the *Lactobacillus reuteri* described in Technical Solution 1, 2, or 5 and the *Lactobacillus reuteri* described in Technical Solution 3, 4, or 6, wherein the microbial agent refers to the bacterial cells obtained by collecting the *Lactobacillus reuteri* in live form, and the viable count of the microbial agent is 1 × 10⁻⁶. 9 -1×10 12 CFU / g.

[0032] Preferably, the microbial agent includes one or a combination of two of the microbial agents described in technical solutions 1, 2 or 5 and technical solutions 3, 4 or 6.

[0033] More preferably, the microbial agent is prepared by the preparation method described in any one of technical solutions 14 or 15. More preferably, the viable count of the *Lactobacillus reuteri* AMCC 12149 bacterial agent is 1 × 10⁻⁶. 9 -1×10 12 CFU / g, or the viable count of the *Lactobacillus reuteri* AMCC 10930 bacterial agent is 1×10⁻⁶. 9 -1×10 12 CFU / g.

[0034] Technical Solution 17: The use of any one of Technical Solutions 1-6, or the extracellular metabolite of Technical Solution 10, or the intracellular metabolite of Technical Solution 13, or the bacterial agent of Technical Solution 16 in the preparation of pharmaceuticals.

[0035] Technical Solution 18: The application according to Technical Solution 17, wherein the drug is a drug with uric acid-lowering function.

[0036] Technical Solution 19: The use of any one of Technical Solutions 1-6, or the extracellular metabolite of Technical Solution 10, or the intracellular metabolite of Technical Solution 13, or the bacterial agent of Technical Solution 16 in the preparation of a drug for relieving hyperuricemia.

[0037] Technical Solution 20: The use of any one of Technical Solutions 1-6, or the extracellular metabolite of Technical Solution 10, or the intracellular metabolite of Technical Solution 13, or the bacterial agent of Technical Solution 16 in the preparation of xanthine oxidase inhibitors, or in the degradation of purine compounds, or in the auxiliary degradation of purine compounds, preferably, the purine compounds include guanosine and / or inosine.

[0038] Beneficial effects of this invention: The *Lactobacillus reuteri* provided by this invention has the ability to rapidly degrade guanosine and inosine, possesses the ability to efficiently inhibit xanthine oxidase activity in vitro, and also has good hydrophobicity and cohesiveness. It has the potential to persist in the gastrointestinal tract and exert a uric acid-lowering effect. Therefore, the *Lactobacillus reuteri* provided by this invention has the potential to be used as a drug to assist in lowering uric acid. Attached Figure Description

[0039] Figure 1 This is the standard curve for guanosine.

[0040] Figure 2 This is the standard curve for inosine.

[0041] Figure 3 The graph shows the degradation rate of guanosine by 25 strains.

[0042] Figure 4 The graph shows the degradation rate of inosine by 25 strains.

[0043] Figure 5 This is a colony morphology diagram of *Lactobacillus reuteri*, in which... Figure 5 A in the diagram represents the colony morphology of *Lactobacillus reuteri* AMCC12149. Figure 5 B in the diagram represents the colony morphology of Lactobacillus reuteri AMCC 10930.

[0044] Figure 6 The image shows the microscopic morphology of *Lactobacillus reuteri*, in which... Figure 6 A in the image represents the microscopic morphology of *Lactobacillus reuteri* AMCC12149. Figure 6 B in the image represents the microscopic morphology of Lactobacillus reuteri AMCC 10930.

[0045] Figure 7 For Lactobacillus reuteri based pheS Phylogenetic tree diagram constructed from gene sequences.

[0046] Figure 8 The graph shows the inhibition rate of xanthine oxidase activity by *Lactobacillus reuteri*. Figure 8 Figure A in the figure represents the inhibition rate of xanthine oxidase activity by Lactobacillus reuteri AMCC 12149. Figure 8 In the figure, B represents the inhibition rate of xanthine oxidase activity by Lactobacillus reuteri AMCC 10930.

[0047] Figure 9 The figure shows the degradation ability of *Lactobacillus reuteri* AMCC 12149 on guanosine-inosine potassium phosphate buffer at concentrations of 1 mmol / L, 2 mmol / L, 5 mmol / L, and 10 mmol / L. Figure 9 In this context, A represents the guanosine content in the supernatant of *Lactobacillus reuteri* AMCC 12149. Figure 9 In this context, B represents the inosine content in the supernatant of *Lactobacillus reuteri* AMCC 12149.

[0048] Figure 10 The figure shows the degradation ability of *Lactobacillus reuteri* AMCC 10930 on guanosine-inosine potassium phosphate buffer at concentrations of 1 mmol / L, 2 mmol / L, 5 mmol / L, and 10 mmol / L. Figure 10 In this context, A represents the guanosine content in the supernatant of *Lactobacillus reuteri* AMCC 10930. Figure 10 In this context, B represents the inosine content in the supernatant of *Lactobacillus reuteri* AMCC 10930.

[0049] Microbial strain preservation information The present invention provides *Lactobacillus reuteri* ( Limosilactobacillus reuteri AMCC 12149 was deposited at the China Center for Type Culture Collection on December 30, 2024, with accession number CCTCC NO: M 20242932. The deposit address is: Wuhan University, Wuhan, China, 430072, China.

[0050] The present invention provides *Lactobacillus reuteri* ( Limosilactobacillus reuteri AMCC 10930 was deposited at the China Center for Type Culture Collection on February 14, 2025, with accession number CCTCC NO: M 2025224. The depositary address is Wuhan University, Wuhan, China, 430072, China. Detailed Implementation

[0051] To better understand the above technical solutions, the technical solutions of the present invention will be clearly and completely explained below in conjunction with specific embodiments. It should be noted that the content of the specific embodiments is only a specific implementation and explanation of the technical solutions of the present invention, and should not be construed as a limitation on the scope of protection of the present invention.

[0052] To address the problems existing in the prior art, the present invention provides *Lactobacillus reuteri* with uric acid-lowering ability and its applications, the specific technical solution of which is as follows: Technical Solution 1.1: A type of *Lactobacillus reuteri*, characterized in that the *Lactobacillus reuteri* is: *Lactobacillus reuteri* AMCC 12149 (… Limosilactobacillus reuteri AMCC 12149), accession number CCTCC NO: M20242932.

[0053] Technical Solution 1.2: The application of *Lactobacillus reuteri* as described in Technical Solution 1.1 in inhibiting xanthine oxidase activity, degrading purine compounds, or lowering uric acid.

[0054] Technical solution 1.3: The application according to technical solution 1.2 is characterized in that the purine compound includes guanosine and / or inosine.

[0055] Technical Solution 1.4: The application according to Technical Solution 1.2 is characterized in that the inhibition rate of the *Lactobacillus reuteri* on xanthine oxidase activity is greater than or equal to 40.00%.

[0056] Technical Solution 1.5: The application according to Technical Solution 1.3 is characterized in that the degradation rate of guanosine by the *Lactobacillus reuteri* is greater than or equal to 49.00 μg / mL·min. Alternatively, the degradation rate of inosine by *Lactobacillus reuteri* is greater than or equal to 45.00 μg / mL·min.

[0057] Technical Solution 1.6: The application of *Lactobacillus reuteri* as described in Technical Solution 1.1 in the preparation of probiotic products or in the preparation of xanthine oxidase inhibitors.

[0058] Technical Solution 1.7: According to the application described in Technical Solution 1.6, the hydrophobicity of *Lactobacillus reuteri* in the probiotic product is greater than or equal to 35%. The autoaggregation rate of *Lactobacillus reuteri* was greater than or equal to 20.00%. The autoaggregation rate refers to the bacterial suspension obtained by solid-liquid separation of the bacterial culture in MRS liquid medium, resuspending the bacterial cell pellet in buffer solution, and measuring the OD of the supernatant of the bacterial suspension. 600 The value is used as the initial OD value of the supernatant. 600 Value. After incubating the bacterial suspension statically for 4-24 h, the OD value of the supernatant was measured. 600 The value was used as the OD value after culturing the supernatant for 4-24 hours. 600 Value, then according to the formula: Self-condensation rate (%) = (1-A) t The value obtained by calculating ( / A0)×100% is the self-condensation rate. Preferably, the 4-hour self-aggregation rate of *Lactobacillus reuteri* is greater than or equal to 20.00%, wherein the 4-hour self-aggregation rate refers to the bacterial suspension obtained by solid-liquid separation of the bacterial culture in MRS liquid medium, retaining the bacterial cell pellet, and resuspending the bacterial cell pellet in buffer solution, wherein the OD of the supernatant of the bacterial suspension is measured. 600 The value is used as the initial OD value of the supernatant. 600 The OD value of the supernatant was measured after the bacterial suspension was incubated statically for 4 h. 600 The value was used as the OD value after 4 hours of culture in the supernatant. 600 Value, then according to the formula: Self-condensation rate (%) = (1-A) t / A0)×100%, A t The OD value is represented by the supernatant cultured for 4 hours. 600 Value; A0 represents the initial OD of the supernatant. 600 The calculated value is the self-condensation rate. The 12-hour autoaggregation rate of *Lactobacillus reuteri* is greater than or equal to 30.00%, where the 12-hour autoaggregation rate refers to the bacterial suspension obtained by solid-liquid separation after culture in MRS liquid medium, retaining the bacterial cell pellet, and resuspending the bacterial cell pellet in buffer solution. The OD of the supernatant of the bacterial suspension is measured. 600 The value is used as the initial OD value of the supernatant.600 The OD value of the supernatant was measured after the bacterial suspension was incubated statically for 12 hours. 600 The value was used as the OD value after 12 hours of culture in the supernatant. 600 Value, then according to the formula: Self-condensation rate (%) = (1-A) t / A0)×100%, A t The OD value is represented by the supernatant cultured for 12 hours. 600 Value; A0 represents the initial OD of the supernatant. 600 The calculated value is the self-condensation rate. The 24-hour autoaggregation rate of *Lactobacillus reuteri* is greater than or equal to 57.00%. Here, the 24-hour autoaggregation rate refers to the bacterial suspension obtained by solid-liquid separation of the bacterial culture in MRS liquid medium, retaining the bacterial cell pellet, and resuspending the bacterial cell pellet in buffer solution. The OD of the supernatant of the bacterial suspension is measured. 600 The value is used as the initial OD value of the supernatant. 600 The OD value of the supernatant was measured after the bacterial suspension was incubated statically for 24 hours. 600 The value was used as the OD value after 24 hours of culture in the supernatant. 600 Value, then according to the formula: Self-condensation rate (%) = (1-A) t / A0)×100%, A t The OD value is represented by the supernatant after 24 hours of incubation. 600 Value; A0 represents the initial OD of the supernatant. 600 The calculated value is the self-condensation rate.

[0059] Technical Solution 1.8: The application of Lactobacillus reuteri described in Technical Solution 1.1 in the preparation of bacterial agents, extracellular metabolites or intracellular metabolites.

[0060] Technical Solution 1.9: A method for preparing an extracellular metabolite, characterized by comprising the following steps: expanding the culture of *Lactobacillus reuteri* as described in Technical Solution 1.1 to obtain the extracellular metabolite.

[0061] Technical Solution 1.10: The preparation method according to Technical Solution 1.9 is characterized in that, after expanding the culture of the Lactobacillus reuteri, it further includes: separating the bacterial culture solution after solid-liquid separation and retaining the supernatant to obtain the extracellular metabolite.

[0062] Technical Solution 1.11: An extracellular metabolite, characterized in that it is prepared by the preparation method described in Technical Solution 1.9 or 1.10.

[0063] Technical Solution 1.12: A method for preparing intracellular metabolites, characterized by comprising the following steps: expanding the culture of *Lactobacillus reuteri* as described in Technical Solution 1.1 to obtain the intracellular metabolites.

[0064] Technical Solution 1.13: The preparation method according to Technical Solution 1.12 is characterized in that, after expanding the culture of the Lactobacillus reuteri, the method further includes: performing solid-liquid separation on the expanded culture solution to retain the bacterial cell precipitate, mixing the bacterial cell precipitate with a buffer solution, breaking the bacterial cells, and retaining the supernatant after solid-liquid separation to obtain the intracellular metabolite.

[0065] Technical solution 1.14: An intracellular metabolite, characterized in that it is prepared by the preparation method described in technical solutions 1.12 or 13.

[0066] Technical Solution 1.15: The application of the extracellular metabolite described in Technical Solution 1.11 or the intracellular metabolite described in Technical Solution 1.14 in inhibiting xanthine oxidase activity.

[0067] Technical Solution 1.16: The application according to Technical Solution 1.15 is characterized in that the extracellular metabolite has an inhibition rate of greater than or equal to 92% on xanthine oxidase activity, or the intracellular metabolite has an inhibition rate of greater than or equal to 73% on xanthine oxidase activity.

[0068] Technical Solution 1.17: A bacterial agent, characterized in that it contains *Lactobacillus reuteri* as described in Technical Solution 1.1.

[0069] Technical Solution 1.18: A method for preparing the bacterial agent described in Technical Solution 1.17, characterized in that it includes the following steps: expanding the culture of Lactobacillus reuteri described in Technical Solution 1.1.

[0070] Technical Solution 1.19: The preparation method according to Technical Solution 1.18 is characterized in that, after expanding the culture of the Lactobacillus reuteri, it further includes: performing solid-liquid separation on the expanded culture solution to retain the bacterial cell precipitate, thereby obtaining the bacterial agent.

[0071] Technical solution 1.20: The preparation method according to technical solution 1.18 or 1.19 is characterized in that, before obtaining the bacterial agent, the bacterial cell precipitate is further washed and dried.

[0072] Technical Solution 1.21: The use of the extracellular metabolite described in Technical Solution 1.11, or the intracellular metabolite described in Technical Solution 1.14, or the bacterial agent described in Technical Solution 1.17 in the preparation of xanthine oxidase inhibitors or in the degradation of purine compounds.

[0073] Technical Solution 1.22: The application of *Lactobacillus reuteri* as described in Technical Solution 1.1, or the extracellular metabolite as described in Technical Solution 1.11, or the intracellular metabolite as described in Technical Solution 1.14, or the bacterial agent as described in Technical Solution 1.17 in the preparation of pharmaceuticals.

[0074] Technical Solution 1.23: The application according to Technical Solution 1.22, wherein the drug is a drug with uric acid-lowering function.

[0075] Technical Solution 1.24: The application of *Lactobacillus reuteri* as described in Technical Solution 1.1, or the extracellular metabolites as described in Technical Solution 1, or the intracellular metabolites as described in Technical Solution 1, or the bacterial agent as described in Technical Solution 1.17 in the preparation of a drug for relieving hyperuricemia.

[0076] In some specific embodiments, the raw materials used in preparing MRS liquid culture medium and MRS agar culture medium according to the present invention include tryptone, beef extract, and yeast extract. Tryptone, beef extract, and yeast extract mainly exist as organic nitrogen sources in the culture medium to provide the necessary nitrogen element for microbial growth during fermentation. Common organic nitrogen sources such as tryptone, beef extract, and yeast extract decompose in the culture medium, releasing amino acids and small peptides, which then become nitrogen sources required for microbial growth. That is to say, when using tryptone, beef extract, and yeast extract as common organic nitrogen sources to prepare the culture medium, the present invention does not particularly limit their source; they can be commercially available or prepared by conventional methods. As long as the total nitrogen content of commercially available or conventionally prepared tryptone is greater than or equal to 12 wt%, it can be used in the present invention. Commercially available beef extract can also be used in the present invention. Commercially available yeast extract powder with a total nitrogen content of ≥10.0 wt% and an amino nitrogen content of ≥5.0 wt% can be used in this invention.

[0077] Preferably, in some specific embodiments, based on the weight of the yeast extract, the yeast extract further comprises: 2-2.5 ppm of vitamin B1, 37-40 ppm of vitamin B2, 113-116 ppm of vitamin B5, 15-20 ppm of vitamin B6, 6-10 ppm of vitamin B7, 25-28 ppm of vitamin B9, 3205-3210 ppm of choline, 1575-1580 ppm of inositol, 325-330 ppm of niacin, and 0.2-0.4 ug of vitamin B12 per 100 g of yeast extract.

[0078] And / or, by weight of the yeast extract, the potassium is 31910-31912 mg / kg, the sodium is 5735-5740 mg / kg, the calcium is 354-357 mg / kg, the magnesium is 2670-2675 mg / kg, the zinc is 77-83 mg / kg, and the iron is 77-83 mg / kg.

[0079] And / or, based on the weight of the yeast extract, the yeast extract comprises: 30.3-40.85% free amino acids and 51-70.5% hydrolyzed amino acids.

[0080] The free amino acid content includes, based on the weight of the yeast extract, 1-2% free aspartic acid, 2-3% free threonine, 1.5-2% free serine, 6.5-7% free glutamic acid, 1-1.5% free glycine, 4-5% free alanine, 0.1-0.15% free cysteine, 2-3% free valine, 0.5-1% free methionine, 2-2.5% free isoleucine, 3.3-3.7% free leucine, 0.5-1% free tyrosine, 1.5-2% free phenylalanine, 2-2.5% free lysine, 0.1-1% free histidine, 1.5-2.5% free arginine, and 0.5-1% free proline.

[0081] The hydrolyzed amino acid content includes, based on the weight of the yeast extract, 6-6.5% hydrolyzed aspartic acid, 2-3% hydrolyzed threonine, 2-3% hydrolyzed serine, 10-15% hydrolyzed glutamic acid, 2-3% hydrolyzed glycine, 5-6% hydrolyzed alanine, 0.5-1% hydrolyzed cysteine, 3-4% hydrolyzed valine, 0.5-1% hydrolyzed methionine, 3-4% hydrolyzed isoleucine, 4-5% hydrolyzed leucine, 1-2% hydrolyzed tyrosine, 2-3% hydrolyzed phenylalanine, 4-5% hydrolyzed lysine, 1-2% hydrolyzed histidine, 3-4% hydrolyzed arginine, and 2-3% hydrolyzed proline.

[0082] In some specific embodiments, the *Lactobacillus reuteri* AMCC 12149 bacterial agent provided by the present invention is prepared using conventional methods in the art. For example, it can be prepared by a method including the following steps: expanding the culture of *Lactobacillus reuteri* AMCC 12149, separating the solid and liquid phases, and retaining the bacterial cell precipitate to obtain the bacterial agent. Preferably, before obtaining the bacterial agent, the method further includes concentrating and / or drying the bacterial cell precipitate using conventional concentration and / or drying methods in the art.

[0083] In some specific embodiments, the *Lactobacillus reuteri* AMCC 10930 bacterial agent provided by the present invention is prepared using conventional methods in the art. For example, it can be prepared by a method including the following steps: expanding the culture of *Lactobacillus reuteri* AMCC 10930, separating the solid and liquid phases to retain the bacterial cell precipitate to obtain the bacterial agent. Preferably, before obtaining the bacterial agent, the method further includes concentrating and / or drying the bacterial cell precipitate using conventional concentration and / or drying methods in the art.

[0084] In some specific embodiments, the present invention provides the use of the bacterial cells of *Lactobacillus reuteri* AMCC 12149, or the bacterial cells of *Lactobacillus reuteri* AMCC 10930 (the bacterial cells may specifically refer to live bacterial cells, inactivated bacterial cells, or bacterial agents containing live bacterial cells and / or inactivated bacterial cells), or the extracellular metabolites of *Lactobacillus reuteri* AMCC 12149, or the extracellular metabolites of *Lactobacillus reuteri* AMCC 10930, or the intracellular metabolites of *Lactobacillus reuteri* AMCC 12149, or the intracellular metabolites of *Lactobacillus reuteri* AMCC 10930 in the preparation of pharmaceutical products.

[0085] Preferably, the drug is a drug with uric acid-lowering function.

[0086] More preferably, its application in the preparation of medicines for relieving hyperuricemia.

[0087] Preferably, in the preparation of xanthine oxidase inhibitors or in the degradation of purine compounds, the purine compounds preferably include guanosine and / or inosine.

[0088] It should be noted that the application mentioned refers to the fact that the *Lactobacillus reuteri* provided by this invention has good self-aggregation ability and surface hydrophobicity, which enables *Lactobacillus reuteri* to have better adhesion to intestinal epithelial cells, allowing it to colonize stably in the gastrointestinal tract. On this basis, *Lactobacillus reuteri* colonized in the gastrointestinal tract can play a role in degrading purine compounds and inhibiting xanthine oxidase activity in the internal environment of the gastrointestinal tract. Therefore, *Lactobacillus reuteri* provided by this invention has potential effects in lowering uric acid and alleviating hyperuricemia.

[0089] Unless otherwise stated, all reagents / instruments used in the embodiments of this invention are conventional commercially available products. Information on the sources of the experimental reagents / instruments used in this invention is shown in Table 1.

[0090]

[0091] The components of the culture medium and its preparation process involved in the embodiments of the present invention are as follows: 1. Each L of MRS liquid medium contains the following components: 10 g tryptone, 10 g beef extract, 20 g glucose, 2 g sodium acetate, 5 g yeast extract (model: FM888), 0.1 g magnesium sulfate heptahydrate, 0.05 g manganese sulfate monohydrate, 0.2 g diammonium hydrogen citrate, 0.2 g dipotassium hydrogen phosphate, and 1 mL Tween 80, with the remainder being water.

[0092] MRS liquid culture medium: 10 g tryptone, 10 g beef extract, 20 g glucose, 2 g sodium acetate, 5 g yeast extract (model: FM888), 0.1 g magnesium sulfate heptahydrate, 0.05 g manganese sulfate monohydrate, 0.2 g diammonium citrate, 0.2 g dipotassium hydrogen phosphate, and 1 mL Tween 80 were mixed with distilled water and brought to a final volume of 1 L. The mixture was then sterilized at 115°C for 30 min to obtain MRS liquid culture medium.

[0093] 2. Based on each L of MRS agar medium, the MRS agar medium contains the following components: 10 g tryptone, 10 g beef extract, 20 g glucose, 2 g sodium acetate, 5 g yeast extract (model: FM888), 0.1 g magnesium sulfate heptahydrate, 0.05 g manganese sulfate monohydrate, 0.2 g diammonium hydrogen citrate, 0.2 g dipotassium hydrogen phosphate, 1 mL Tween 80, and 20 g agar, with the remainder being water.

[0094] Preparation method of MRS agar medium: Mix 10 g tryptone, 10 g beef extract, 20 g glucose, 2 g sodium acetate, 5 g yeast extract (model: FM888), 0.1 g magnesium sulfate heptahydrate, 0.05 g manganese sulfate monohydrate, 0.2 g diammonium citrate, 0.2 g dipotassium hydrogen phosphate, 1 mL Tween 80, and 20 g agar and water, bring the volume to 1000 mL, adjust the pH to 7.0, and sterilize at 115 ℃ for 20 min to obtain MRS agar medium.

[0095] The preparation process of the solution used in this embodiment of the invention is as follows: 1. Guanosine-Inosine Potassium Phosphate Solution with a Concentration of 1 g / L: Mix 1 g of guanosine, 1 g of inosine, and a 0.01 M potassium phosphate solution with a pH of 7.0, and bring the volume to 1 L with potassium phosphate solution to obtain a 1 g / L guanosine-inosine potassium phosphate solution. In this 1 g / L guanosine-inosine potassium phosphate solution, the concentration of guanosine is 1 g / L (i.e., 3.53 mmol / L guanosine), and the concentration of inosine is 1 g / L (i.e., 3.73 mmol / L inosine).

[0096] 2. Guanosine-inosine potassium phosphate solution with a concentration of 1 mmol / L: Mix 0.283 g of guanosine, 0.268 g of inosine and a 0.01 M potassium phosphate solution with a pH of 7.0 and make up to 1 L with potassium phosphate solution to obtain a 1 mmol / L guanosine-inosine potassium phosphate solution.

[0097] 3. Guanosine-inosine potassium phosphate solution with a concentration of 2 mmol / L: Mix 0.566 g of guanosine, 0.536 g of inosine and a 0.01 M potassium phosphate solution with a pH of 7.0 and make up to 1 L with potassium phosphate solution to obtain a 2 mmol / L guanosine-inosine potassium phosphate solution.

[0098] 4. Guanosine-inosine potassium phosphate solution with a concentration of 5 mmol / L: Mix 1.416 g guanosine, 1.34 g inosine and a 0.01 M potassium phosphate solution with pH 7.0 and make up to 1 L with potassium phosphate solution to obtain a 5 mmol / L guanosine-inosine potassium phosphate solution.

[0099] 5. Guanosine-inosine potassium phosphate solution with a concentration of 10 mmol / L: Mix 2.83 g guanosine, 2.68 g inosine and a 0.01 M potassium phosphate solution with a pH of 7.0 and make up to 1 L with potassium phosphate solution to obtain a 10 mmol / L guanosine-inosine potassium phosphate solution.

[0100] The trace elements contained in the yeast extract powder (model: FM888) used to prepare the culture medium of this invention are as follows: vitamin B1 2.3 ppm, vitamin B2 38.8 ppm, vitamin B5 115.0 ppm, vitamin B6 18.0 ppm, vitamin B7 7.9 ppm, vitamin B9 26.7 ppm, vitamin B12 0.23 (ug / 100g), choline 3206.0 ppm, inositol 1577.7 ppm, and niacin 328.0 ppm.

[0101] The trace elements contained in the yeast extract powder (model: FM888) used in the examples are as follows: potassium 31911.66 mg / kg, sodium 5738.91 mg / kg, calcium 355.25 mg / kg, magnesium 2673.59 mg / kg, zinc 80.94 mg / kg and iron 80.21 mg / kg.

[0102] The yeast extract (model: FM888) used in the examples contained 35.1% free amino acids and 61.21% hydrolyzed amino acids.

[0103] The free amino acid content is as follows, based on the weight of the yeast extract: free aspartic acid 1.6%, free threonine 2.1%, free serine 1.7%, free glutamic acid 6.7%, free glycine 1.2%, free alanine 4.2%, free cysteine ​​0.1%, free valine 2.7%, free methionine 0.8%, free isoleucine 2.2%, free leucine 3.5%, free tyrosine 0.9%, free phenylalanine 1.8%, free lysine 2.3%, free histidine 0.5%, free arginine 2.0%, and free proline 0.8%.

[0104] The hydrolyzed amino acid content is as follows: based on the weight of the yeast extract, hydrolyzed aspartic acid 6.23%, hydrolyzed threonine 2.71%, hydrolyzed serine 2.73%, hydrolyzed glutamic acid 12.33%, hydrolyzed glycine 2.74%, hydrolyzed alanine 5.17%, hydrolyzed cysteine ​​0.61%, hydrolyzed valine 3.84%, hydrolyzed methionine 0.84%, hydrolyzed isoleucine 3.65%, hydrolyzed leucine 4.72%, hydrolyzed tyrosine 1.65%, hydrolyzed phenylalanine 2.68%, hydrolyzed lysine 4.63%, hydrolyzed histidine 1.19%, hydrolyzed arginine 3.30%, and hydrolyzed proline 2.19%.

[0105] To better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0106] Example 1: Isolation of strains and evaluation of their ability to degrade guanosine in vitro (1) Strains Isolation Take 1 g of fermented chili pepper sample (wherein, fermented chili pepper refers to a spicy seasoning sauce made from fermented red chili peppers and cornmeal) and 1 g of fermented cornmeal sample, add 10 mL of physiological saline to each sample, homogenize, and then perform serial dilution. Take 10 g of each sample... -4 10 -5 The diluted solution was spread onto MRS agar plates and incubated at 37°C for 48 h to obtain single colonies.

[0107] (2) Strain purification Observe the colony morphology, select single colonies with different edges, shapes, and colors, and inoculate them into MRS liquid medium. Incubate anaerobicly at 37°C for 48 h. Pile the bacterial solution onto MRS agar plates for purification, and incubate anaerobicly at 37°C for 48 h to complete one purification step. Repeat the purification process for three generations, obtaining a total of 25 strains, which were then numbered and stored.

[0108] (2) Evaluation of the strain's ability to degrade guanosine in vitro Twenty-five bacterial strains were inoculated into MRS liquid medium and cultured at 37°C for 48 h to obtain a bacterial suspension. One mL of the bacterial suspension was centrifuged at 8000 rpm for 5 min, and the supernatant was discarded. The bacterial pellet was washed twice with 1 mL of physiological saline, resuspended, and the bacterial concentration was adjusted to 1.0 × 10⁻⁶. 9 The bacterial precipitate was collected by centrifuging at 8000 rpm for 5 min at CFU / mL. 750 μL of a 1 g / L guanosine-inosine potassium phosphate solution was added to the precipitate, and the mixture was anaerobically incubated at 37℃ for 1 h, followed by heating in a boiling water bath for 10 min to terminate the reaction. The reaction solution was centrifuged at 12000 rpm for 10 min, and the supernatant was collected and filtered through a 0.22 μm aqueous microporous membrane to obtain the supernatant for analysis. The supernatant was analyzed by high-performance liquid chromatography (HPLC) to obtain chromatograms of characteristic peaks for guanosine and inosine. The HPLC conditions were as follows: Agilent Zorbax Eclipse Plus-C18 column (4.6 mm x 250 mm); mobile phase: 50 mmol / L KH₂PO₄-K₂HPO₄ buffer (pH 6.8), isogradient elution; detection wavelength: 253 nm; column temperature: 35℃; elution time: 20 min; flow rate: 1 mL / min.

[0109] Based on the peak areas of guanosine and inosine in the supernatant, and combined with the standard curves of guanosine and inosine, the contents of guanosine and inosine in the supernatant were calculated. The effects of 25 bacterial strains on guanosine (…) were calculated using (Formula 1). Figure 3 ) and inosine ( Figure 4 The degradation rate of ).

[0110] The preparation method of the standard curves for guanosine and inosine is as follows: A 1 g / L standard solution of guanosine and inosine was prepared using sterile water. After filtration through a 0.22 μm aqueous microporous membrane, the solutions were diluted to obtain standard solutions of different concentrations (0.1, 0.2, 0.3, 0.4, 0.5 g / L). The retention time and peak area of ​​the standard solutions were analyzed according to the set chromatographic conditions. A linear fit was performed between the concentrations of guanosine and inosine and the peak areas to establish standard curves relating their content to peak areas. The guanosine standard curve is shown below. Figure 1 As shown, the inosine standard curve is as follows: Figure 2 As shown.

[0111] Degradation rate of guanosine or inosine (%) = (C0 - C) / C0 × 100. (Formula 1) In the formula, C0 is the content of guanosine or inosine in the supernatant to be tested, in g / L; C is the content of the remaining guanosine or inosine in the supernatant to be tested, in g / L.

[0112] like Figure 3 and Figure 4 As shown, Figure 3 The graph shows the degradation rate of guanosine by 25 bacterial strains. Figure 4 The figure shows the degradation rates of inosine by 25 strains. The results indicate that strains 12149 and 10930 can effectively degrade guanosine and inosine. Strain 12149, isolated from fermented chili pepper samples, achieved degradation rates of 96.41% and 82.49% for guanosine and inosine, respectively. Strain 10930, isolated from fermented cornmeal samples, achieved 100% degradation rates for both guanosine and inosine. These two strains showed significantly higher degradation efficiencies for guanosine and inosine than the other 23 strains. Therefore, strains 12149 and 10930 were selected as preferred strains for further identification analysis and evaluation of their uric acid-lowering performance.

[0113] Example 2: Strain Identification Bacterial suspensions of strains 12149 and 10930 were plated separately on MRS agar plates and incubated at 37°C for 48 h. Colony morphology was then observed. Simultaneously, single colonies were picked and inoculated into MRS liquid medium. After incubation at 37°C for 48 h, 10 μL of the bacterial suspension was dropped onto a glass slide, and the microscopic morphology of the strains was observed under an oil immersion microscope (100×). The colony morphology of strains 12149 and 10930 was as follows: colonies were milky yellow, round, slightly raised, approximately 1.0-2.0 mm in diameter, with neat, glossy edges and no transparent zone. Their microscopic morphology showed short rod-shaped structures arranged in chains.

[0114] Genomic DNA was extracted from strains numbered 12149 and 10930, respectively, and used for... pheS PCR amplification was performed using the gene as the target (primer F: 5'-GACACAAACGTCACCAATGCAA-3', i.e., SEQ ID NO.1; primer R: 5'-AAGCACTTCAATCCAACCAGTTT-3', i.e., SEQ ID NO.2). The PCR program was: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 60 s, 30 cycles; final extension at 72℃ for 5 min. The amplified products were detected by 1% agarose gel electrophoresis and sequenced. The obtained sequences were then compared for BLAST homology in the GenBanK database. Sequence similarity greater than 97% was considered to indicate the same species. Strains numbered 12149 and 10930... pheS The gene sequences are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

[0115] SEQ ID NO.3: GACACAAACGTCACCAATGCAAGCGCGGATGCTTGAAAAACATGATTTTAGTCAGGGTCCATTAAAGATGATTTCACCAGGTAAGGTTTATCGACGTGATACTGATGATGCAACGCACAGTCACCAATTCCACCAAATTGAAGGAATGGTTGTTGGTAAAAATATTACGATGGCCGA TTTGAAAGGAACTCTTGAAGCAGTTGCTCAAAACCTCTTTGGTGATAAGTTAGAGGTTCGCTTACGGCCAAGTTACTTCCCATTTACTGAGCCATCAGTTGAAGCAGATATTACTTGTTTCAACTGCCTTGGTAAGGGTTGTGCAATTTGTAAACAAACTGGTTGGATTGAAGTGCTT SEQ ID NO.4: CTGGGTTACCCCAATCTGTTTTGATGCGGACCCAAACGTCACCAATGCAAGCACGGATGCTCGAAAAACATGATTTTAGTCAAGGCCCACTAAAGATGATTTCACCAGGTAAGGTTTACCGGCGGGATACTGATGATGCAACTCACAGTCACCAATTCCACCAAATTGAAGGGATGGTTGTTGGTAAAAATATTACTAT GGCTGATTTGAAGGGAACCCTTGAGGCCGTTGCTCAAAACCTTTTCGGTGACAAGTTAAAGGTTCGCTTGCGACCAAGTTACTTCCCATTTACTGAACCATCAGTTGAGGCAGATATTACTTGTTTCAACTGCCTTGGCAAGGGTTGTGCAATTTGTAAACAAACTGGTTGGATTGAAGTTTCTTGGTGCCGGCATGGTCC ACCCA Based on SEQ ID NO.3 and SEQ ID NO.4 pheS Gene sequences were analyzed, and a phylogenetic tree was constructed using MEGA 11.0 software. The constructed phylogenetic tree is shown below. Figure 7 As shown, Figure 7 To target Lactobacillus reuteri based on pheS Phylogenetic tree diagram constructed from gene sequences. Strain number 10930 and... Lactobacillus reuteristrain CICC6226 clustered into a branch with 100% confidence support, indicating the closest relationship between the two strains; this branch then clustered with strain 12149 with 83% confidence support, forming a higher-level branch; this branch then further clustered with... Lactobacillus caviae strain MOZM2 polymerized with a 94% confidence level. These results indicate that strains 10930 and 12149, although both belonging to *Lactobacillus reuteri* (…),… Limosilactobacillus reuteri This species, and the phylogenetic relationship is relatively close, belonging to the same high-confidence evolutionary branch, but the two are two independent strains of this species, not the same strain, and they constitute independent terminal branch nodes in the phylogenetic tree.

[0116] Based on morphological analysis and molecular identification results, strains numbered 12149 and 10930 were confirmed to be *Lactobacillus reuteri*. Limosilactobacillus reuteri The specific preservation information for the two strains is as follows: (1) Strain numbered 12149: Lactobacillus reuteri AMCC 12149 ( Limosilactobacillus reuteri AMCC 12149 was deposited at the China Center for Type Culture Collection (CCTCC) on December 30, 2024, with accession number CCTCC NO: M 20242932. Its colony morphology is shown in the image below. Figure 5 The microscopic morphology of A in the figure is shown below. Figure 6 A in the middle.

[0117] (2) Strain numbered 10930: Lactobacillus reuteri AMCC 10930 ( Limosilactobacillus reuteri AMCC 10930 was deposited at the China Center for Type Culture Collection (CCTCC) on February 14, 2025, with accession number CCTCC NO: M 2025224. Its colony morphology is shown in the image below. Figure 5 See the microscopic morphology image of B in the image. Figure 6 B in the middle.

[0118] Example 3: Detection of the inhibitory effect of *Lactobacillus reuteri* on xanthine oxidase. It should be noted that the extracellular metabolites of *Lactobacillus reuteri* AMCC 12149 and *Lactobacillus reuteri* AMCC 10930 were prepared according to step (1) in this embodiment; the intracellular metabolites of *Lactobacillus reuteri* AMCC 12149 and *Lactobacillus reuteri* AMCC 10930 were prepared according to step (2) in this embodiment; and the bacterial suspensions of *Lactobacillus reuteri* AMCC 12149 and *Lactobacillus reuteri* AMCC 10930 were prepared according to step (3) in this embodiment.

[0119] (1) Preparation of extracellular metabolites of Lactobacillus reuteri Lactobacillus reuteri was inoculated into MRS liquid medium and cultured at 37°C for 24 h. 1 mL of a 1×10⁻⁶ concentration was then used. 9 The bacterial culture of CFU / mL was centrifuged at 8000 rpm for 5 min, and the supernatant was collected as the extracellular metabolite of Lactobacillus reuteri.

[0120] (2) Preparation of intracellular metabolites of Lactobacillus reuteri Collect the bacterial pellet of *Lactobacillus reuteri* obtained in step (1) and wash twice with physiological saline. Resuspend the bacterial cells and adjust the bacterial concentration to 1.0 × 10⁻⁶. 9 A bacterial suspension was obtained at CFU / mL. The suspension was then subjected to ultrasonic disruption in an ice bath. The disruption parameters were as follows: power 200 W, sonication for 3 s, interval 10 s, 30 cycles. After ultrasonic disruption, the suspension was centrifuged at 4℃ and 8000 rpm for 10 min, and the supernatant was collected to obtain intracellular metabolites of *Lactobacillus reuteri*.

[0121] (3) Preparation of bacterial suspension of Lactobacillus reuteri The bacterial precipitate of *Lactobacillus reuteri* obtained in step (1) was collected under low-temperature conditions (4°C), washed twice with physiological saline at low temperature (4°C), and 500g of *Lactobacillus reuteri* bacterial precipitate was resuspended in 600mL of lyophilization protectant solution (the 600mL lyophilization protectant solution is prepared by mixing 18g of skim milk powder, 60g of maltodextrin, 36g of trehalose, 12g of monosodium glutamate with water and making up to 600mL, wherein the weight ratio of skim milk powder, maltodextrin, trehalose and monosodium glutamate is 3:10:6:2). Then, it was equilibrated at 4°C for 60min, pre-frozen at -40°C for 4h, and finally freeze-dried under vacuum at -80°C and 0Pa for 48h to obtain *Lactobacillus reuteri* AMCC 12149 bacterial agent and *Lactobacillus reuteri* AMCC, respectively. 10930 microbial agent (all viable bacteria count is 1×10⁻⁶) 10CFU / g). Lactobacillus reuteri AMCC 12149 and Lactobacillus reuteri AMCC 10930 bacterial cultures were resuspended in physiological saline and adjusted to a concentration of 1.0 × 10⁻⁶ CFU / g. 9 CFU / mL was used to obtain a bacterial suspension of *Lactobacillus reuteri* as the test cells for *Lactobacillus reuteri*.

[0122] (4) Detection of the inhibitory ability of the strain on xanthine oxidase The enzyme activity was determined using a xanthine oxidase (XOD) activity assay kit (D799775-0050). The specific method is as follows: The reaction solution was prepared according to the reaction system shown in Table 2. After incubating the reaction solution at 37℃ for 20 min, the absorbance at 530 nm was measured. The inhibition rates of xanthine oxidase activity by *Lactobacillus reuteri* AMCC 12149 and *Lactobacillus reuteri* AMCC 10930 were calculated using (Formula 2). The results are shown below. Figure 8 As shown.

[0123]

[0124] Inhibition rate (%) = 1 - U1 / U2 × 100 (Formula 2) In the formula, U1 represents the xanthine oxidase activity of the sample group; U2 represents the xanthine oxidase activity of the control group. The enzyme activity of xanthine oxidase is defined as: the amount of NO produced per milliliter of liquid per minute. 2- Defined as a unit of enzyme activity.

[0125] XOD activity (U / mL) = (∆A sample ÷ ∆A standard × C standard) × 10 3 ÷ T × F = 12.5 × ∆A sample ÷ ∆A standard × F, In the formula, ΔAsample is the difference between Ameasured group and Ablank group; ΔAstandard is the difference between Astandard group and Ablank group; 10 3 Here are the unit conversion factors, 1 μmol = 10 3 nmol; C represents the standard solution concentration, 0.25 μmol / ml; T represents the reaction time, 20 min; F represents the dilution factor.

[0126] like Figure 8 As shown, Figure 8 In the figure, A represents the inhibition rate of xanthine oxidase activity by *Lactobacillus reuteri* AMCC 12149. Figure 8Figure B in the graph shows the inhibition rate of xanthine oxidase activity by *Lactobacillus reuteri* AMCC 10930. The results indicate that the extracellular metabolites, intracellular metabolites, and bacterial cells of *Lactobacillus reuteri* AMCC 12149 inhibited xanthine oxidase activity by 92.76%, 73.22%, and 44.94%, respectively; while the extracellular metabolites, intracellular metabolites, and bacterial cells of *Lactobacillus reuteri* AMCC 10930 inhibited xanthine oxidase activity by 82.53%, 46.90%, and 52.53%, respectively. This suggests that the extracellular metabolites, intracellular metabolites, and bacterial cells of both strains exhibit good xanthine oxidase inhibitory activity, with the extracellular metabolites showing particularly significant inhibitory activity.

[0127] In summary, xanthine oxidase is a key enzyme in the uric acid synthesis pathway. Reducing its activity can effectively decrease uric acid production. The extracellular metabolites of *Lactobacillus reuteri* AMCC 12149 and *Lactobacillus reuteri* AMCC 10930 both exhibited inhibition rates of over 82.00% against xanthine oxidase. Among them, the extracellular metabolite of *Lactobacillus reuteri* AMCC12149 reached the highest inhibition rate of 92.76%. This indicates that the extracellular metabolites, intracellular metabolites, and bacterial cells of both strains can effectively inhibit xanthine oxidase activity, reduce uric acid production, and have the ability to lower uric acid levels, thus effectively alleviating hyperuricemia.

[0128] Example 4: Detection of the degradation capacity of strains of guanosine and inosine The degradation ability of *Lactobacillus reuteri* AMCC 12149 and AMCC 10930 on guanosine-inosine potassium phosphate buffer at concentrations of 1 mmol / L, 2 mmol / L, 5 mmol / L, and 10 mmol / L was determined using the following method: (1) Preparation of Lactobacillus reuteri AMCC 12149 cells: Take 4 2 mL OD tubes 600 A culture of *Lactobacillus reuteri* AMCC 12149 with a pH of 2 was centrifuged at 8000 rpm for 2 min at 4 °C, the supernatant was discarded, and the bacterial cells were collected. The cells were washed twice with 750 μL of physiological saline and resuspended. After centrifugation at 8000 rpm for 5 min, the bacterial pellet was collected. Then, 750 μL of guanosine-inosine potassium phosphate buffer (0.01 M, pH 7.0) at concentrations of 1 mmol / L, 2 mmol / L, 5 mmol / L, and 10 mmol / L were added to the bacterial pellet, respectively. The mixture was incubated at 37 °C with shaking at 120 rpm for 60 min, and samples were taken every 20 min.

[0129] (2) Preparation of Lactobacillus reuteri AMCC 10930 cells: Take 4 2 mL OD cells 600Lactobacillus reuteri AMCC 10930 bacterial suspension with a pH of 2 was centrifuged at 8000 rpm for 2 min at 4 °C, the supernatant was discarded, and the bacterial cells were collected. The bacterial cells were washed twice with 750 μL of physiological saline and resuspended. After centrifugation at 8000 rpm for 5 min, the bacterial cell pellet was collected. Subsequently, 750 μL of guanosine-inosine potassium phosphate buffer (0.01 M, pH 7.0) with concentrations of 1 mmol / L, 2 mmol / L, 5 mmol / L, and 10 mmol / L were added to the bacterial pellet, respectively. The mixture was incubated at 37 °C with shaking at 120 rpm for 60 min, and samples were taken every 20 min.

[0130] (3) The samples taken in steps (1) and (2) were heated in a boiling water bath for 10 min to terminate the reaction. The supernatant was collected by centrifugation at 12000 rpm for 10 min and filtered through a 0.22 μm aqueous microporous membrane to obtain the supernatants of *Lactobacillus reuteri* AMCC 12149 and *Lactobacillus reuteri* AMCC 10930, respectively. The two supernatants were analyzed by high performance liquid chromatography (HPLC) to obtain the characteristic peak chromatograms of guanosine and inosine. The HPLC conditions were as follows: column: Agilent Zorbax Eclipse Plus-C18 (4.6 mm × 50 mm); mobile phase: 50 mmol / L KH2PO4-K2HPO4 buffer (pH 6.8), isogradient elution; detection wavelength: 253 nm; column temperature: 35 ℃; elution time: 20 min; flow rate: 1 mL / min.

[0131] (4) According to the standard curve (e.g.) Figure 1 The peak areas of guanosine in the supernatants of *Lactobacillus reuteri* AMCC 12149 and *Lactobacillus reuteri* AMCC 10930 obtained in step (3) were calculated, and the content of guanosine in the supernatants of *Lactobacillus reuteri* AMCC 12149 and *Lactobacillus reuteri* AMCC 10930 was obtained. The results are shown in Tables 3 and 4. Figure 9 A and Figure 10 As shown in A in the diagram.

[0132] (5) According to the standard curve (e.g.) Figure 2 The peak areas of inosine in the supernatants of *Lactobacillus reuteri* AMCC 12149 and *Lactobacillus reuteri* AMCC 10930 obtained in step (3) were calculated to obtain the inosine content in the supernatants of *Lactobacillus reuteri* AMCC 12149 and *Lactobacillus reuteri* AMCC 10930. The results are shown in Tables 3 and 4. Figure 9 B and Figure 10 As shown in B in the diagram.

[0133] (6) The degradation rates of guanosine or inosine by Lactobacillus reuteri AMCC 12149 and Lactobacillus reuteri AMCC10930 were calculated using Formula 3 below. The results are shown in Tables 3 and 4.

[0134] Degradation rate of guanosine or inosine (μg / mL·min) = (C0-C) / T (Formula 3) In the formula, C0 is the initial concentration of guanosine or inosine in the supernatant, in μg / mL; C is the remaining concentration of guanosine or inosine in the supernatant, in μg / mL; and T is the reaction time.

[0135]

[0136] like Figure 9 As shown in Table 3, Figure 9 The graph shows the degradation results of *Lactobacillus reuteri* AMCC 12149 on guanosine-inosine potassium phosphate buffer at concentrations of 1 mmol / L, 2 mmol / L, 5 mmol / L, and 10 mmol / L. After 40 min of reaction, *Lactobacillus reuteri* AMCC 12149 showed a degradation rate of over 94.66% for both 10 mmol / L guanosine and inosine, with degradation rates of 70.06 μg / mL∙min and 64.87 μg / mL∙min, respectively.

[0137]

[0138] like Figure 10 As shown in Table 4, Figure 10 The graph shows the degradation ability of *Lactobacillus reuteri* AMCC 10930 on guanosine-inosine potassium phosphate buffer at concentrations of 1 mmol / L, 2 mmol / L, 5 mmol / L, and 10 mmol / L. After 20 min of reaction, *Lactobacillus reuteri* AMCC 10930 showed a degradation rate of over 97.03% for both 10 mmol / L guanosine and inosine, with degradation rates of 135.8 μg / mL·min and 130.9 μg / mL·min, respectively.

[0139] In summary, guanosine and inosine are precursors to uric acid formation. Reducing their levels can decrease the formation of uric acid precursors, thereby reducing uric acid synthesis. Both *Lactobacillus reuteri* AMCC 12149 and AMCC 10930 exhibited degradation rates exceeding 94% for 10 mmol / L guanosine and inosine, with degradation rates greater than 64 μg / mL·min. *Lactobacillus reuteri* AMCC 10930 showed the highest degradation rate at 135.8 μg / mL·min. Ultimately, both strains achieved 100% degradation of guanosine and inosine. This indicates that both strains can effectively reduce the accumulation of uric acid precursors by influencing purine metabolism, thus lowering uric acid levels and alleviating hyperuricemia.

[0140] Example 5: Detection of self-aggregation rate and surface hydrophobicity of *Lactobacillus reuteri* The specific adhesion of *Lactobacillus reuteri* to intestinal epithelial cells not only facilitates its colonization in the intestine but also enhances signaling communication between the bacteria and intestinal cells, inhibits pathogen colonization, and improves the body's immunity. It is important to note that *Lactobacillus reuteri* colonization in the intestine requires its ability to adhere to the surface of host cells; that is, *Lactobacillus reuteri* must possess adhesive capacity. Studies have shown that this adhesive capacity is positively correlated with the self-aggregation ability and surface hydrophobicity of *Lactobacillus reuteri*. Therefore, the self-aggregation ability and surface hydrophobicity of *Lactobacillus reuteri* AMCC 12149 and AMCC 10930 will be further investigated.

[0141] (1) Detection of autoaggregation rate of bacterial strains: Lactobacillus reuteri AMCC 12149 and Lactobacillus reuteri AMCC 10930 were inoculated into MRS liquid medium and cultured at 37℃ for 24 h to obtain bacterial suspension. The bacterial suspension was centrifuged at 5000 rpm for 10 min, washed twice with sterile PBS, and resuspended to adjust the bacterial suspension concentration to OD. 600 = 1, to obtain a bacterial suspension, wherein the OD of the supernatant of the bacterial suspension is measured. 600 The value is used as the initial OD value of the supernatant. 600 The bacterial suspension was then incubated at 37°C for 4 h, 12 h, and 24 h, and samples were taken to measure the OD value of the supernatant. 600 The value was calculated based on (Formula 4) to determine the autoaggregation rate of *Lactobacillus reuteri*, and the results are shown in Table 5.

[0142] Self-condensation rate (%) = (1-A) t / A0) ×100% (Formula 4); In the formula, A t OD values ​​of the supernatant after 4 h, 12 h, and 24 h of incubation 600Value, A0 is the initial OD of the supernatant. 600 value.

[0143]

[0144] Self-aggregation is the phenomenon of bacterial cells spontaneously forming clumps. It can be used to assess the adhesiveness of bacterial strains to ensure high density in the gut. The stronger this ability, the better the adhesion and colonization of the strain in the gut. As shown in Table 5, the 24-hour self-aggregation rates of *Lactobacillus reuteri* AMCC 10930 and *Lactobacillus reuteri* AMCC 12149 were 67.8% and 58.3%, respectively. This indicates good self-aggregation ability, laying the foundation for their stable survival in the gut and their uric acid-lowering function. Therefore, *Lactobacillus reuteri* AMCC 10930 and AMCC 12149 can be used as probiotic products.

[0145] (2) Detection of surface hydrophobicity of bacterial strains: *Lactobacillus reuteri* AMCC 12149 and *Lactobacillus reuteri* AMCC 10930 were inoculated into MRS liquid medium and cultured at 37°C for 24 h. After centrifugation at 5000 rpm for 10 min, the bacterial suspension was washed twice with sterile PBS and resuspended, and the concentration of the bacterial suspension was adjusted to OD. 600 = 1. Mix 3 mL of bacterial suspension with 1 mL of xylene, shake for 2 min, and let stand at 37℃ for 3 h. Then, take the aqueous phase and measure the OD. 600 The surface hydrophobicity of *Lactobacillus reuteri* was calculated using Formula 5 below, and the results are shown in Table 6.

[0146] Surface hydrophobicity (%) = (1-A) t / A0)×100% (Formula 5); In the formula, A t OD after 3 h of bacterial suspension culture 600 Value, A0 is the OD of the initial bacterial suspension. 600 value.

[0147]

[0148] As shown in Table 6, the surface hydrophobicity of bacterial strains is an important indicator for evaluating their adhesion ability, which determines whether the strain can persist in the gastrointestinal tract and exert beneficial effects. Related studies have shown that bacterial surface hydrophobicity is divided into three levels: strongly hydrophobic (71%–100%), moderately hydrophobic (36%–70%), and weakly hydrophobic (0%–35%). The results show that after 3 hours of culture, the surface hydrophobicity of *Lactobacillus reuteri* AMCC 12149 and *Lactobacillus reuteri* AMCC 10930 were 40.1% and 39.2%, respectively. This indicates that their hydrophobic ability is moderate, suggesting their potential to persist in the gastrointestinal tract and exert beneficial effects. Therefore, *Lactobacillus reuteri* AMCC 10930 and AMCC 121 can be used as probiotic products.

[0149] In summary, the *Lactobacillus reuteri* AMCC 12149 and AMCC 10930 provided by this invention possess the ability to efficiently degrade guanosine inosine and inhibit xanthine oxidase activity. They also exhibit good self-aggregation and hydrophobicity. Therefore, both *Lactobacillus reuteri* AMCC 12149 and AMCC 10930 provided by this invention have the potential to survive stably and continuously in the gastrointestinal tract and exert probiotic effects. This indicates that both *Lactobacillus reuteri* AMCC 12149 and AMCC 10930 have the potential to be used in the preparation of adjuvant drugs for lowering uric acid.

[0150] The above embodiments are only for further explanation and understanding of the technical solution of the present invention, and are not intended to limit the present invention. Any improvements made by those skilled in the art on this basis that do not highlight substantive features or make significant progress should fall within the protection scope of the present invention.

Claims

1. A type of *Lactobacillus reuteri*, characterized in that, The *Lactobacillus reuteri* mentioned is: *Lactobacillus reuteri* AMCC 12149 ( Limosilactobacillus reuteri AMCC 12149), accession number CCTCC NO: M20242932.

2. The use of *Lactobacillus reuteri* as described in claim 1 in the preparation of products that inhibit xanthine oxidase activity or in the preparation of products that degrade purine compounds.

3. The application according to claim 2, characterized in that, The purine compounds include guanosine and / or inosine.

4. The application according to claim 2, characterized in that, The inhibition rate of the *Lactobacillus reuteri* against xanthine oxidase activity was greater than or equal to 40.00%.

5. The application according to claim 3, characterized in that, The degradation rate of guanosine by *Lactobacillus reuteri* was greater than or equal to 49.00 μg / mL·min. Alternatively, the degradation rate of inosine by *Lactobacillus reuteri* is greater than or equal to 45.00 μg / mL·min.

6. The use of *Lactobacillus reuteri* as described in claim 1 in the preparation of probiotic products or in the preparation of xanthine oxidase inhibitors.

7. The application according to claim 6, wherein, The hydrophobicity of *Lactobacillus reuteri* in the probiotic product is greater than or equal to 35%. The autoaggregation rate of *Lactobacillus reuteri* was greater than or equal to 20.00%. The autoaggregation rate refers to the bacterial suspension obtained by solid-liquid separation of the bacterial culture in MRS liquid medium, resuspending the bacterial cell pellet in buffer solution, and measuring the OD of the supernatant of the bacterial suspension. 600 The value is used as the initial OD value of the supernatant. 600 The OD value of the supernatant was measured after the bacterial suspension was incubated statically for 4-24 h. 600 The value was used as the OD value after culturing the supernatant for 4-24 hours. 600 Value, then according to the formula: Self-condensation rate (%) = (1-A) t / A0)×100%, where A t The OD value is represented by the supernatant cultured for 4-24 hours. 600 Value; A0 represents the initial OD of the supernatant. 600 The calculated value is the self-condensation rate.

8. The application according to claim 7, wherein, The 4-hour autoaggregation rate of *Lactobacillus reuteri* was greater than or equal to 20.00%. Here, the 4-hour autoaggregation rate refers to the bacterial suspension obtained after solid-liquid separation of the bacterial culture in MRS liquid medium, resuspending the bacterial cell pellet in buffer solution to obtain a bacterial suspension. The OD of the supernatant of this bacterial suspension was measured. 600 The value is used as the initial OD value of the supernatant. 600 The OD value of the supernatant was measured after the bacterial suspension was incubated statically for 4 h. 600 The value was used as the OD value after 4 hours of culture in the supernatant. 600 Value, then according to the formula: Self-condensation rate (%) = (1-A) t / A0)×100%, A t The OD value is represented by the supernatant cultured for 4 hours. 600 Value; A0 represents the initial OD of the supernatant. 600 The calculated value is the self-condensation rate. The 12-hour autoaggregation rate of *Lactobacillus reuteri* is greater than or equal to 30.00%, where the 12-hour autoaggregation rate refers to the bacterial suspension obtained by solid-liquid separation after culture in MRS liquid medium, retaining the bacterial cell pellet, and resuspending the bacterial cell pellet in buffer solution. The OD of the supernatant of the bacterial suspension is measured. 600 The value is used as the initial OD value of the supernatant. 600 The OD value of the supernatant was measured after the bacterial suspension was incubated statically for 12 hours. 600 The value was used as the OD value after 12 hours of culture in the supernatant. 600 Value, then according to the formula: Self-condensation rate (%) = (1-A) t / A0)×100%, A t The OD value is represented by the supernatant cultured for 12 hours. 600 Value; A0 represents the initial OD of the supernatant. 600 The calculated value is the self-condensation rate. The 24-hour autoaggregation rate of *Lactobacillus reuteri* is greater than or equal to 57.00%. Here, the 24-hour autoaggregation rate refers to the bacterial suspension obtained by solid-liquid separation of the bacterial culture in MRS liquid medium, retaining the bacterial cell pellet, and resuspending the bacterial cell pellet in buffer solution. The OD of the supernatant of the bacterial suspension is measured. 600 The value is used as the initial OD value of the supernatant. 600 The OD value of the supernatant was measured after the bacterial suspension was incubated statically for 24 hours. 600 The value was used as the OD value after 24 hours of culture in the supernatant. 600 Value, then according to the formula: Self-condensation rate (%) = (1-A) t / A0)×100%, A t The OD value is represented by the supernatant after 24 hours of incubation. 600 Value; A0 represents the initial OD of the supernatant. 600 The calculated value is the self-condensation rate.

9. The use of *Lactobacillus reuteri* as described in claim 1 in the preparation of bacterial agents, extracellular metabolites, or intracellular metabolites.

10. A method for preparing an extracellular metabolite, characterized in that, The method includes the following steps: expanding the culture of *Lactobacillus reuteri* as described in claim 1 to obtain the extracellular metabolite.

11. The preparation method according to claim 10, characterized in that, The process further includes: after expanding the culture of the Lactobacillus reuteri, performing solid-liquid separation on the expanded culture solution and retaining the supernatant to obtain the extracellular metabolite.

12. An extracellular metabolite, characterized in that, It is prepared by the preparation method described in claim 10 or 11.

13. A method for preparing an intracellular metabolite, characterized in that, The procedure includes the following steps: expanding the culture of *Lactobacillus reuteri* as described in claim 1 to obtain the intracellular metabolites.

14. The preparation method according to claim 13, characterized in that, The process further includes: performing solid-liquid separation on the expanded culture of the *Lactobacillus reuteri* to retain the bacterial cell precipitate; mixing the bacterial cell precipitate with a buffer solution; breaking the bacterial cells; and retaining the supernatant after solid-liquid separation to obtain the intracellular metabolites.

15. An intracellular metabolite, characterized in that, It is prepared by the preparation method described in claim 13 or 14.

16. The use of the extracellular metabolite of claim 12 or the intracellular metabolite of claim 15 in the preparation of a product that inhibits xanthine oxidase activity.

17. The application according to claim 16, characterized in that, The extracellular metabolite inhibits xanthine oxidase activity by ≥92%, or the intracellular metabolite inhibits xanthine oxidase activity by ≥73%.

18. A microbial agent, characterized in that, Contains *Lactobacillus reuteri* as described in claim 1.

19. A method for preparing the microbial agent according to claim 18, characterized in that, The procedure includes the following steps: expanding the culture of *Lactobacillus reuteri* as described in claim 1.

20. The preparation method according to claim 19, characterized in that, The process further includes: performing solid-liquid separation on the expanded culture solution to retain the bacterial cell precipitate and obtain the bacterial agent.

21. The preparation method according to claim 19 or 20, characterized in that, Before obtaining the bacterial agent, the process also includes washing and drying the bacterial cell precipitate.

22. The use of the extracellular metabolite of claim 12, or the intracellular metabolite of claim 15, or the bacterial agent of claim 18 in the preparation of xanthine oxidase inhibitors or in the preparation of products that degrade purine compounds.

23. The use of the *Lactobacillus reuteri* of claim 1, or the extracellular metabolite of claim 12, or the intracellular metabolite of claim 15, or the bacterial agent of claim 18 in the preparation of a pharmaceutical product.

24. The application according to claim 23, wherein, The drug in question is one that has the function of lowering uric acid.

25. The use of the *Lactobacillus reuteri* of claim 1, or the extracellular metabolite of claim 12, or the intracellular metabolite of claim 15, or the bacterial agent of claim 18 in the preparation of a medicament for relieving hyperuricemia.

Images