Engineered bacteria co-expressing st6galnac1, lfca and tff3 and preparation method and application thereof

Abstract

The application discloses an engineering bacterium co-expressing ST6GALNAC1, LFCA and TFF3 and a preparation method and application thereof, and belongs to the field of genetic engineering and microbial technology. The experiment proves that the combined expression system can significantly and specifically up-regulate the expression of host MUC2 and the sialylation biochemical modification level, thereby improving the structural integrity of the mucus barrier under the pathological state. At the level of molecular signal reconstruction, Lc-pPG-ST6-LFCA-TFF3 effectively inhibits the p38 / MAPK cell stress response pathway triggered by pathogen invasion, stably and strongly remodels the activity of the WNT / ERK signal level system, and successfully drives the host intestinal epithelial tissue to change from a "high stress-related state" to a "high-efficiency repair and homeostasis maintenance state".

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and microbial technology, and in particular to an engineered bacterium co-expressing ST6GALNAC1, LFCA and TFF3, its preparation method and application. Background Technology

[0002] Salmonella typhimurium ( Salmonella typhimurium *Streptococcus faecium* is an important zoonotic pathogen that can cause gastroenteritis and systemic infections in livestock and poultry, and can also threaten human health through the food chain. This bacterium has numerous serotypes, a wide host range, strong environmental adaptability, and complex pathogenic mechanisms, making it persistent and difficult to eradicate in intensive farming environments. Antibiotics have long been the primary means of controlling this bacterium, but their irrational use has not only led to the emergence of multidrug-resistant strains, significantly weakening the efficacy of traditional treatments, but also non-specifically disrupted the intestinal microecological balance, increasing the risk of pathogen colonization and spread, and causing food safety issues such as antibiotic residues. Therefore, developing safe, efficient, and non-resistant novel anti-infection strategies has become an urgent technical problem to be solved in this field.

[0003] The intestinal mucus barrier is the first line of defense against intestinal pathogens. Mucin 2 (MUC2), secreted by goblet cells, forms a dense gel-like network through high cross-linking, physically isolating intestinal microbes from epithelial cells. Studies have shown that the barrier function of MUC2 depends not only on its spatial conformation but also on strict regulation by O-glycosylation modification, especially terminal sialylation modification. Terminal sialylation catalyzed by ST6GALNAC1 endows the MUC2 glycan network with a dense negative charge, forming steric hindrance and electrostatic repulsion, thereby preventing the degradation of the mucus backbone by proteases secreted by pathogens and symbiotic bacteria, which is the molecular basis for maintaining intestinal immune homeostasis. Clinical studies and animal model experiments have confirmed that loss of ST6GALNAC1 activity or dysregulation of the sialylation pathway leads to the collapse of the mucus barrier, exposing the host to the risk of severe inflammatory bowel disease and fatal intestinal infections.

[0004] In its long-term host-pathogen evolution, *Salmonella typhimurium* has developed a sophisticated mechanism to break through the aforementioned defense network. This bacterium not only dismantles physical defenses by secreting specific hydrolases to strip MUC2 of sialic acid residues, but also utilizes the type III secretion system (TTSS-1 and TTSS-2) to inject virulence effector proteins (such as AvrA) into the host cytoplasm, triggering a multiple pathological cascade: on the one hand, it strongly activates pro-inflammatory stress signaling pathways such as p38 / MAPK, leading to decreased expression of tight junction proteins (ZO-1, Occludin, Claudin-1) and increased intestinal barrier permeability; on the other hand, it hijacks and inhibits the WNT / β-catenin and ERK signaling pathways responsible for epithelial repair. This dual disruption, consisting of "mucus barrier degradation" and "repair signal paralysis," is the fundamental cause of severe intestinal damage induced by *Salmonella* infection.

[0005] While probiotics have been reported to inhibit pathogens through competitive rejection or immune modulation, the anti-infective capabilities of their natural strains are limited, particularly in reversing the multidimensional mucosal pathological damage caused by Salmonella. Most existing engineered probiotics are limited to single-target designs (e.g., expressing only one antimicrobial molecule or a single repair factor), failing to simultaneously repair the mucus barrier, suppress inflammatory storms, and activate epithelial regeneration. A literature search has yielded no reports on the combined introduction of ST6GALNAC1, LFCA, and TFF3 into Lactobacillus casei for anti-Salmonella infection. Summary of the Invention

[0006] The purpose of this invention is to provide an engineered bacterium co-expressing ST6GALNAC1, LFCA, and TFF3, its preparation method, and its applications, in order to solve the problems existing in the prior art. Based on the current state of the prior art, the inventors of this application intend to provide a recombinant Lactobacillus casei capable of expressing ST6GALNAC1, and its application in enhancing intestinal barrier function and resisting Salmonella infection.

[0007] To achieve the above objectives, the present invention provides the following solution: One of the technical solutions of the present invention is an engineered bacterium Lc-pPG-ST6-LFCA-TFF3 that co-expresses ST6GALNAC1, LFCA and TFF3. The engineered bacterium is based on Lactobacillus casei ATCC393 as the starting strain and co-expresses sialyltransferase ST6GALNAC1, antimicrobial peptide LFCA and repair factor TFF3.

[0008] The second technical solution of the present invention, the preparation method of the engineered bacteria Lc-pPG-ST6-LFCA-TFF3, includes the following steps: (1) Amplify the ST6GALNAC1 gene and the LFCA-TFF3 fusion gene, and construct the cloning vector pEASY-ST6-LFCA-TFF3 containing the ST6GALNAC1-LFCA-TFF3 fusion gene; (2) The recombinant plasmid pEASY-ST6-LFCA-TFF3 and the expression vector pPG-612 were double-digested with restriction endonucleases SacⅡ and NotⅠ, and then ligated to obtain the recombinant expression vector pPG-ST6-LFCA-TFF3; (3) Preparation of competent Lactobacillus casei cells; (4) The recombinant plasmid pPG-ST6-LFCA-TFF3 was electroporated into competent Lactobacillus casei cells, and positive transformants were screened, which were the engineered bacteria Lc-pPG-ST6-LFCA-TFF3.

[0009] The third technical solution of the present invention is the application of the engineered bacteria Lc-pPG-ST6-LFCA-TFF3 in the preparation of drugs for repairing the intestinal mucosal barrier.

[0010] The fourth technical solution of the present invention is the application of the engineered bacteria Lc-pPG-ST6-LFCA-TFF3 in the preparation of drugs against Salmonella typhimurium infection.

[0011] The fifth technical solution of the present invention is a pharmaceutical composition for treating Salmonella typhimurium infection, comprising the engineered bacteria Lc-pPG-ST6-LFCA-TFF3 and a pharmaceutically acceptable carrier.

[0012] The sixth technical solution of the present invention is the application of the engineered bacterium Lc-pPG-ST6-LFCA-TFF3 in the preparation of drugs for relieving intestinal inflammation, reducing intestinal pathological tissue damage, or increasing the number of goblet cells.

[0013] The seventh technical solution of the present invention is the application of the engineered bacteria Lc-pPG-ST6-LFCA-TFF3 in the preparation of a microecological preparation for the prevention and control of Salmonella infection in livestock and poultry farming.

[0014] Based on the above technical solution, the present invention has the following technical effects: This invention uses Lactobacillus casei ( Lactobacillus caseiUsing ATCC393 as a chassis, a recombinant plasmid pPG-ST6-LFCA-TFF3 was constructed to co-express sialyltransferase ST6GALNAC1, antimicrobial peptide LFCA, and repair factor TFF3, thus preparing a novel functional engineered probiotic, Lc-pPG-ST6-LFCA-TFF3. This engineered bacterium exhibited strong adhesion to LS174T intestinal epithelial cells (absolute adhesion rate of 21.3%) and high biosafety, maintaining a high cell viability consistent with the control group throughout a 6-hour co-culture period without inducing observable cytotoxicity. This engineered bacterium also competitively inhibited Salmonella Typhimurium (…). Salmonella typhimurium It significantly upregulated the expression of tight junction proteins Claudin-1 (33.9%), Occludin (42.6%), and ZO-1 in LS174T cells, and enhanced the expression of MUC2 protein (59.4%) and the transcriptional levels of glycosyltransferase genes ST6GALNAC1, ST6GALNAC2, Fut1, Fut2, Fut3, and B3GNT6 (0.5-5.0-fold). It also specifically inhibited the activation of the MAPK signaling pathway, resulting in a 51.2% decrease in P-p38 protein levels. Simultaneously, it drove the Wnt / β-catenin repair axis through an asymmetric uncoupling mechanism (Wnt3a increased by 80.5%, p-GSK-3β increased by 80.3%, and CyclinD1 increased by 58.4%).

[0015] Following oral inoculation of C57BL / 6 mice, the engineered bacteria controlled host weight loss to 9.4% (significantly superior to 20.8% in the wild-type Lc group and 35.4% in the 5-ASA group). It also significantly increased IgA levels in the spleen (SP), mesenteric lymph nodes (MLN), and Pell's collecting lymph nodes (PPs) of mice. + B cells (1.5-2.3 times), Foxp3 + The study increased the number of Treg cells (2.0-2.8 times); increased serum anti-inflammatory factor IL-10 levels; decreased serum TNF-α and IL-1β levels; and reduced the mRNA levels of TNF-α, IL-1β, IL-17, and CXCL1 genes in mouse intestinal tissue by more than 90%; significantly upregulated the mRNA expression of ZO-1, Claudin-1, Occludin, and MUC2 genes in mouse ileum tissue (0.5-2.5 times); increased the levels of glycosyltransferase genes ST6GALNAC1 (3.5 times) and B3GNT6 (2.5 times); decreased the level of p-p38 (62%); alleviated intestinal pathological tissue damage caused by Salmonella typhimurium (intact intestinal villi, submucosal edema subsided); and increased the number of goblet cells (significantly higher than the infection group).

[0016] Furthermore, this engineered bacterium can significantly reduce the expression of p-p38 protein in mouse colon tissue, and enhance the expression of tight junction proteins Claudin-1, Occludin and ZO-1, as well as glycosyltransferases ST6GALNAC1 and ST6GALNAC2; it can also increase the expression of Firmicutes in the gut. Firmicutes Bacteroidetes ( Bacteroidota Abundance, and specifically enriched next-generation probiotics such as Akermansia myxophilus ( ) Akkermansia muciniphila This study enriched the diversity of the gut microbiota, and the relative abundance of Salmonella in the experimental group was lower than that in the dirty cage group. Metagenomic analysis further confirmed that this engineered bacterium could target and reduce the abundance of the Salmonella virulence island SPI-2 and the high-risk polymyxin resistance gene PmrF. The novel functional probiotic prepared in this invention can significantly alleviate intestinal damage and inflammation caused by Salmonella typhimurium infection, providing an effective intervention for the prevention and treatment of Salmonella infection and related intestinal diseases. Attached Figure Description

[0017] Figure 1 PCR amplification of the ST6 gene. Wherein, M: DL 2000 DNA Maker; 1-2: ST6; 3: negative control.

[0018] Figure 2 The results show the PCR amplification of the LFCA-TFF3 fusion gene. M: DL 2000 DNA Maker; 1: LFCA-TFF3; 2: Negative control.

[0019] Figure 3 The results show the PCR amplification of the ST6-LFCA-TFF3 fusion gene. M: DL 5000 DNA Maker; 1-2: ST6-LFCA-TFF3; 3: Negative control.

[0020] Figure 4 The results are from the PCR identification of the recombinant plasmid pEASY-ST6-LFCA-TFF3. Wherein, M: DL 5000 DNAMaker; 1-13: pEASY-ST6-LFCA-TFF3.

[0021] Figure 5 The results show the PCR identification of the recombinant plasmid pPG-ST6-LFCA-TFF3. Wherein, M: DL 5000 DNA Maker; 1-13: pPG-ST6-LFCA-TFF3.

[0022] Figure 6The results of PCR identification of recombinant lactic acid bacteria Lc-pPG-ST6-LFCA-TFF3 are shown. M: DL 5000 DNAMaker; 1-2: Lc-pPG-ST6-LFCA-TFF3; 3: negative control.

[0023] Figure 7 The results of double enzyme digestion identification of recombinant lactic acid bacteria Lc-pPG-ST6-LFCA-TFF are shown. M: DL 5000 DNAMaker; 1: Lc-pPG-ST6-LFCA-TFF3; 2: negative control.

[0024] Figure 8 The results of Western blot identification of recombinant lactic acid bacteria Lc-pPG-ST6-LFCA-TFF3 are shown. M: protein marker; 1, 3: Lc-pPG-ST6-LFCA-TFF3 induced by 2% lactose; 2: negative control; 4: uninduced Lc-pPG-ST6-LFCA-TFF3.

[0025] Figure 9 Western blot analysis results for recombinant lactic acid bacteria Lc-pPG-ST6-LFCA-TFF3 treated with simulated gastric juice. In the table, M: protein marker; 1: Lc-pPG-ST6-LFCA-TFF3 simulated gastric juice; 2: Lc-pPG-ST6-LFCA-TFF3 simulated gastric juice; 3: negative control.

[0026] Figure 10 To detect the effects of pathogenic bacteria and probiotics on the survival rate of LS174T cells. A: Co-culture for 2 h; B: Co-culture for 4 h; C: Co-culture for 6 h; D: Co-culture for 8 h.

[0027] Figure 11 The results show the adhesion ability of engineered bacteria.

[0028] Figure 12 To detect the competitive invasion ability of engineered bacteria.

[0029] Figure 13 The effect of engineered probiotics on the expression of tight junction proteins in LS174T cells. A: Occludin; B: Claudin-1.

[0030] Figure 14 The results show the effect of engineered probiotics on the activation of the p38 / MAPK signaling pathway in LS174T cells. A: p38; B: P-p38.

[0031] Figure 15The results show the effect of engineered probiotics on the activation of the WNT / ERK signaling pathway in LS174T cells. A: Wnt3a; B: Cyclin D1; C: GSK-3β; D: p-GSK-3β; E: β-catenin; F: p-β-catenin; G: ERK1 / 2; H: p-ERK1 / 2.

[0032] Figure 16 The results show the effects of engineered probiotics on the expression of ST6-2 and related proteins in LS174T cells. A: ST6-2; B: MUC2.

[0033] Figure 17 This is the result of RT-PCR detection of the mRNA level of pro-inflammatory factor genes in LS174T cells by engineered probiotics. A: IL-6, B: TNF-α, C: IL-1β, D: CXCL1.

[0034] Figure 18 This is the result of RT-PCR detection of the mRNA level of the tight junction protein gene in LS174T cells by engineered probiotics. A: Occludin, B: Claudin-1, C: Claudin-2.

[0035] Figure 19 The results of RT-PCR detection of p38 gene mRNA levels in LS174T cells by engineered probiotics.

[0036] Figure 20 This is the result of RT-PCR detection of mRNA levels of Wnt signaling pathway-related genes in LS174T cells by engineered probiotics. A: Wnt3a; B: Cyclin D1; C: β-catenin; D: CCR3; E: GSK-3β; F: EGF; G: MMP7; H: BIRC5.

[0037] Figure 21 These are the RT-PCR results for glycosylation transferase-related genes. A: Fut1; B: Fut2; C: Fut3; D: B3GNT6; E: ST6GALNAC1; F: ST6GALNAC2.

[0038] Figure 22 The results are from RT-PCR detection of the MUC2 gene mRNA level.

[0039] Figure 23 The results of histopathological observation of the duodenum of mice in each group are shown.

[0040] Figure 24 The results of histopathological observation of the jejunum of mice in each group are shown.

[0041] Figure 25 The results of histopathological observation of the ileum of mice in each group are shown.

[0042] Figure 26 The results of histopathological observation of the colon of mice in each group are shown.

[0043] Figure 27 The results show the changes in the number of goblet cells in the ileum of mice in each group. In the figure, A shows the histological staining of goblet cells in the ileum of mice in each group, and B shows the results of the changes in the number of goblet cells in the ileum.

[0044] Figure 28 The results show the changes in the number of colonic goblet cells in each group of mice. In the figures, A shows the histological staining of colonic goblet cells in each group of mice, and B shows the results of the changes in the number of colonic goblet cells.

[0045] Figure 29 The results are from immunofluorescence assays of mouse ileum tissue. A: ZO-1; B: Claudin-1; C: Occludin; D: MUC2. Detailed Implementation

[0046] This invention provides a multidimensional targeted synergistic repair technical solution: using Lactobacillus casei, which has a natural advantage in intestinal colonization (… Lactobacillus casei Using ATCC393 cells as the chassis cells, a recombinant engineered strain, Lc-pPG-ST6-LFCA-TFF3, co-expressing ST6GALNAC1, LFCA (bovine lactoferrin peptide-lactoferrin defense peptide fusion sequence), and TFF3 (trefoil factor 3) was constructed using the pPG612 secretory expression system. This strain repairs the mucus barrier by in situ catalyzing sialylation of the MUC2 terminal via ST6GALNAC1, provides direct antibacterial activity and downregulates NF-κB inflammatory signals via LFCA, and drives the proliferation and migration of damaged epithelial cells via TFF3, thereby achieving systemic control of Salmonella infection.

[0047] This invention aims to regulate the stability of core signaling pathways such as Wnt / β-catenin and MAPK / ERK through engineered probiotics, thereby reshaping the intestinal defense barrier in three dimensions: physical, biochemical, and immune, and providing a new approach to microecological therapy for preventing and controlling drug-resistant Salmonella infection and promoting tissue repair.

[0048] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.

[0049] This invention provides an engineered bacterium Lc-pPG-ST6-LFCA-TFF3 that co-expresses ST6GALNAC1, LFCA, and TFF3. The engineered bacterium is based on Lactobacillus casei ATCC393 and co-expresses sialyltransferase ST6GALNAC1, antimicrobial peptide LFCA, and repair factor TFF3.

[0050] In some specific implementations, the engineered bacteria are prepared by electroporation of Lactobacillus casei competent cells using the recombinant plasmid pPG-ST6-LFCA-TFF3, wherein the recombinant plasmid pPG-ST6-LFCA-TFF3 contains the ST6-LFCA-TFF3 gene fragment.

[0051] In some specific implementations, the nucleotide sequence of the ST6-LFCA-TFF3 gene fragment is shown in SEQ ID NO. 5.

[0052] This invention also provides a method for preparing the engineered bacterium Lc-pPG-ST6-LFCA-TFF3, comprising the following steps: (1) Amplify the ST6GALNAC1 gene and the LFCA-TFF3 fusion gene, and construct the cloning vector pEASY-ST6-LFCA-TFF3 containing the ST6GALNAC1-LFCA-TFF3 fusion gene; (2) The recombinant plasmid pEASY-ST6-LFCA-TFF3 and the expression vector pPG-612 were double-digested with restriction endonucleases SacⅡ and NotⅠ, and then ligated to obtain the recombinant expression vector pPG-ST6-LFCA-TFF3; (3) Preparation of competent Lactobacillus casei cells; (4) The recombinant plasmid pPG-ST6-LFCA-TFF3 was electroporated into competent Lactobacillus casei cells, and positive transformants were screened, which were the engineered bacteria Lc-pPG-ST6-LFCA-TFF3.

[0053] This invention also provides the application of the engineered bacterium Lc-pPG-ST6-LFCA-TFF3 in the preparation of drugs for repairing the intestinal mucosal barrier.

[0054] This invention also provides the application of the engineered bacterium Lc-pPG-ST6-LFCA-TFF3 in the preparation of drugs against Salmonella typhimurium infection.

[0055] This invention also provides a pharmaceutical composition for treating Salmonella typhimurium infection, comprising the engineered bacterium Lc-pPG-ST6-LFCA-TFF3 and a pharmaceutically acceptable carrier.

[0056] This invention also provides the application of the engineered bacterium Lc-pPG-ST6-LFCA-TFF3 in the preparation of drugs for relieving intestinal inflammation, reducing intestinal pathological tissue damage, or increasing the number of goblet cells.

[0057] This invention also provides the application of the engineered bacterium Lc-pPG-ST6-LFCA-TFF3 in the preparation of a microecological preparation for the prevention and control of Salmonella infection in livestock and poultry farming.

[0058] Example 1 I. Construction of recombinant plasmid pPG-ST6 1. Primer design and target gene amplification Gene sequences of ST6GALNAC1 (Gene ID: 55808), LFCA (GenBank: AAQ98614.1), and TFF3 (Gene ID: 7033) were obtained from the NCBI database. Two pairs of primers specific to the ST6 and LFCA-TFF3 genes and the Lactobacillus casei expression vector pPG-612 were designed: F1 (pPG-ST6), R1 (pPG-ST6) and F2 (pPG-LFCA-TFF3), R2 (pPG-LFCA-TFF3). The primers were synthesized by Changchun Kumei Biotechnology Co., Ltd., and each primer pair contained a His tag sequence and corresponding restriction enzyme sites.

[0059] F1 (SEQ ID NO.1): 5'- GCGGCCGC ATGCACCATCATCATCATCATCTGTTAGGGACCAGCCATCC-3'(Not I) R1 (SEQ ID NO.2): 5'- TGCCAACGACGGCATTTAAAACCGCCACCGCCACCGCCGAGGAGCCCTTGCATTCTGT-3' F2 (SEQ ID NO.3): 5'-TCACCGCCACCGCCACCGCCTTTAAATGCCGTCGTTGGCAATGGC-3' R2 (SEQ ID NO.4): 5'- CCGCGG ATGCACCATCATCATCATCATTTAAAAGGTGCATTCTGCTTCTTGC-3' (Sac II).

[0060] Changchun Kumei Biotechnology Co., Ltd. synthesized primers and used extracted ST6 and LFCA-TFF3 cDNA as templates for PCR amplification using upstream and downstream primers. The expected size of the ST6 gene fragment was 1665 bp. Figure 1The amplification system is shown in Table 1.

[0061] Table 1 PCR amplification reaction system

[0062] 2. Construction of cloning vectors and recombinant expression vectors The ST6-LFCA-TFF3 target gene fragment recovered from the previous gel step ( Figure 3 The cloning vector pEASY-Blunt-Zero was incubated overnight in a metal bath at 16 °C. The incubation system is shown in Table 2.

[0063]

[0064] Table 2 Connection Reaction System

[0065] Take 5 μL of the ligation product and transform it into MC1061 competent cells using a standard chemical transformation method. The specific steps are as follows: Remove MC1061 competent cells at -80℃ and thaw them on ice. Transfer the ligation product to the thawed competent cells, mix well, incubate on ice for 30 min, heat shock at 42℃ for 90 s, add 900 μL of LB liquid medium, shake on a 37℃ incubator for 2 h, centrifuge at 5000 rpm for 10 min, discard the supernatant, retain 50 μL of supernatant, aspirate the bacterial cell pellet, spread evenly on LB solid medium (50 μg / mL kanamycin), and incubate in an inverted incubator at 37℃ overnight. Pick single colonies overnight, extract plasmids according to the bacterial plasmid miniprep kit instructions, and perform PCR identification. Send any suspected plasmids to Changchun Kumei Biotechnology Co., Ltd. for sequencing. After successful identification, name it pEASY-ST6-LFCA-TFF3. Figure 4 ).

[0066] The recombinant plasmid pEASY-ST6LFCA-TFF3 and the expression vector pPG-612 were double-digested using restriction endonucleases SacII and NotI, respectively. The digestion mixture consisted of 20 μL plasmid, 1 μL SacII, 1 μL NotI, 5 μL 10×flycut buffer, and 23 μL sterile water. The mixture was thoroughly mixed and incubated at 37 °C for 5 h. After digestion, agarose gel electrophoresis was performed to detect the digestion and recover the target gene and vector fragments.

[0067] The target gene and expression vector pPG-612 were ligated using T4 DNA ligase. The ligation system was as follows: 7 μL target gene + 1 μL vector fragment + 1 μL T4 DNA ligase + 1 μL 10×T4 DNA ligase buffer. The ligation was carried out overnight at 16 °C. The next day, the cells were transformed into MC1061 competent cells. The ligation system is shown in Table 3.

[0068] Table 3 Connection Reaction System

[0069] After 1.5 h of bacterial culture, centrifuge and spread evenly on LB agar plates containing chloramphenicol (10 μg / mL). Incubate overnight at 37°C with the plates inverted. Pick single colonies, extract plasmids, and perform double enzyme digestion and PCR identification. Submit suspected plasmids for sequencing. After verification, name the plasmids pPG-ST6-LFCA-TFF3. Figure 5 ).

[0070] II. Preparation of the novel functional engineered probiotic Lc-pPG-ST6-LFCA-TFF3 1. Preparation of competent Lactobacillus casei cells Lactobacillus casei ATCC393 was streaked onto antibiotic-free MRS solid medium and cultured anaerobically at 37°C until single colonies formed. Single colonies were picked and inoculated onto MRS liquid medium and cultured overnight at 37°C. Then, the colonies were transferred to 200 mL of MRS liquid medium at a 2% (v:v) inoculation rate and cultured until the OD600 value was approximately 0.8.

[0071] After incubating the bacterial culture on ice for 30 min, centrifuge at 5000 rpm at 4℃ for 10 min to collect the bacterial cells. Wash twice with 30 mL of pre-chilled EPWB buffer, then wash once with 30 mL of pre-chilled EPB buffer. Finally, resuspend in 1 mL of pre-chilled EPB buffer, incubate on ice for 15 min, and aliquot into 200 μL / tube. Store at -80℃ for later use.

[0072] 2. Electroporation of recombinant plasmids and screening and identification of engineered bacteria Mix 15 μL of recombinant plasmid pPG-ST6-LFCA-TFF3 with 200 μL of competent Lactobacillus casei cells, incubate on ice for 5 min, then transfer to a pre-cooled electroporation cuvette and electroporate at 2.7 kV and 5-6 ms. Immediately add 900 μL of MRS recovery medium containing 15% sucrose, incubate on ice for 15 min, and then anaerobic culture at 37°C for 6 h.

[0073] Spread 100 μL of bacterial culture onto an MRS agar plate containing 10 μg / mL chloramphenicol, and anaerobically culture at 37°C for 24-36 h. Pick a single colony and inoculate it onto MRS liquid medium containing 10 μg / mL chloramphenicol, and culture overnight at 37°C. Extract plasmids for PCR, double enzyme digestion identification, and sequencing. The positive strain is the novel functional engineered probiotic Lc-pPG-ST6-LFCA-TFF3 ( Figure 6 , 7 ).

[0074] 3. Validation of recombinant protein expression in engineered bacteria The recombinant lactic acid bacteria Lc-pPG-ST6-LFCA-TFF3 was inoculated into MRS liquid medium containing chloramphenicol (10 μg / mL). The next day, it was inoculated at a rate of 2% (v:v) into MRS liquid medium containing 2% lactose and 10 μg / mL chloramphenicol, and induced overnight under anaerobic conditions at 37°C. Meanwhile, an uninduced bacterial culture was set up as a negative control group.

[0075] Subsequently, 20 mL of bacterial culture was taken from both the induced and uninduced groups and centrifuged at 4 ℃ and 8000 rpm for 20 min to collect the bacterial pellet. The pellet was resuspended in 20 mL of sterile PBS, sonicated for 30 min, and then centrifuged at 4 ℃ and 12000 rpm for 5 min to collect the pellet. After processing, the bacterial cells were resuspended in 400 μL of PBS, followed by mixing with 800 μL of 5×SDS-PAGE loading buffer. The cells were incubated overnight at 4 ℃ with anti-His-Tag primary antibody (TBST diluted antibody, 1:3000), and then incubated at room temperature for 4 h with HRP-labeled goat anti-rabbit IgG secondary antibody (1:8000 dilution). After incubation, the cells were washed three times with TBST, and then placed in an imaging system for development after adding ECL chemiluminescence buffer.

[0076] The verification results are as follows Figure 8 As shown, the induced group exhibited a distinct and specific band at approximately 74 kDa, consistent with the theoretical molecular weight, indicating successful expression of the target protein. The uninduced group showed a weak signal, suggesting a certain degree of basal expression of the pPG vector. The empty vector control group showed no obvious band, ruling out background interference from host proteins. Figure 9 As shown, after treatment with an acidic environment and pancreatic enzymes, the 74 kDa target protein remained stably expressed without significant degradation, indicating that the fusion protein has good gastrointestinal stability.

[0077] III. In vitro functional validation of engineered probiotics (using LS174T intestinal epithelial cell model) 1. Cell Culture and Processing LS174T cells were resuscitated and cultured in RPMI 1640 complete medium containing 20% ​​fetal bovine serum and 1% penicillin-streptomycin antibiotics at 37°C in a 5% CO2 incubator. The medium was changed, passaged, and cryopreserved according to standard methods.

[0078] Cells were loaded at a rate of 1×10 5 Inoculate cells per well into 24-well plates and culture until a monolayer of cells forms. Discard the complete culture medium, wash three times with pre-warmed sterile PBS, and add engineered probiotic Lc-pPG-ST6-LFCA-TFF3, wild-type Lactobacillus casei (Lc), and Salmonella typhimurium (ST) suspensions (concentration 1×10⁻⁶) at an MOI of 100. 7 Add 1 mL of RPMI 1640 incomplete medium (without antibiotics) to each well and co-incubate for different times (2, 4, 6, 8 h) for subsequent detection.

[0079] 2. Biosafety testing (trypan blue staining method) After co-culture, discard the culture medium, wash once with PBS, digest cells with trypsin, mix the single-cell suspension with trypan blue staining solution at a ratio of 9:1, count the number of viable cells using a hemocytometer, calculate the cell viability (number of viable cells / total number of cells × 100%), and determine the optimal co-culture time as 6 hours. Figure 10 ).

[0080] Adhesion and Invasion Capability Testing Adhesion assay: After co-culturing cells and bacteria for 3 hours, wash three times with PBS to remove unadhesed bacteria, add 1% Triton X-100 to lyse cells for 30 minutes, serially dilute the lysis buffer and spread it on solid culture medium (MRS for lactic acid bacteria, LB for Salmonella), count colonies after incubation, and calculate the adhesion rate (number of adhered bacteria / number of inoculated bacteria × 100%).

[0081] Invasion assay: After co-culturing cells and bacteria (MOI 100) for 3 h, the cells were washed three times with PBS to remove unattached bacteria. Then, 1 mL of RPMI 1640 medium containing gentamicin (100 μg / mL) was added and the cells were incubated for 2 h to kill bacteria adhering to the cell surface. Subsequent procedures were the same as the adhesion assay: after washing with PBS, 1% Triton X-100 was added to lyse the cells, and the cells were serially diluted, plated, and cultured. The number of invading bacteria was counted, and the invasion rate (number of invading bacteria / number of inoculated bacteria × 100%) was calculated.

[0082] The verification results are as follows Figure 11-12 As shown, the novel functional engineered probiotic Lc-pPG-ST6-LFCA-TFF3 constructed in this invention significantly enhances the adhesion ability of Lactobacillus casei ATCC393 to LS174T intestinal epithelial cells by co-expressing sialidyltransferase ST6GALNAC1, antimicrobial peptide LFCA, and repair factor TFF3. Its absolute adhesion rate reaches 21.3%, approximately 2.87 times higher than wild-type Lactobacillus casei (7.4%), and significantly higher than Salmonella typhimurium (13.2%). It competitively inhibits the adhesion and invasion of Salmonella typhimurium to intestinal epithelial cells (relative invasiveness is only 9.2% of the Salmonella group), laying the foundation for the engineered bacteria to establish long-term colonization in the intestine (in vivo colonization time >10 h) and highly efficient interaction with intestinal epithelial cells. This solves the problems of weak intestinal colonization ability and difficulty in effectively antagonizing pathogenic bacteria in traditional probiotics.

[0083] Detection of cell barrier function and signaling pathway related indicators Protein expression detection: After co-culturing cells and bacteria (MOI 100) for 6 h, the culture medium was discarded, and the cells were washed three times with pre-cooled PBS. A 6-well plate was placed on ice, and 120 μL of RIPA lysis buffer (containing protease inhibitors) was added to each well. Cells were lysed on ice for 30 min. Cells were gently scraped from the bottom of the wells with a cell scraper and transferred to centrifuge tubes. The tubes were centrifuged at 12,000 rpm for 20 min at 4 °C, and the supernatant was collected. The total protein concentration was determined using a BCA protein assay kit. After unifying the protein concentrations of each group, 5×SDS-PAGE loading buffer was added, and the cells were boiled for 10 min for denaturation. After SDS-PAGE electrophoresis (80 V constant voltage for 30 min, 120 V constant voltage for 90 min), the protein was transferred to a PVDF membrane using a wet transfer method (300 mA constant current for 1 h). The membrane was blocked with 5% skim milk at room temperature for 1 h, and then incubated overnight at 4°C with the following primary antibodies: Claudin-1 (1:1000), Occludin (1:1000), ZO-1 (1:1000), p38 (1:1000), P-p38 (1:1000), and β-actin (1:1000). After washing three times with TBST, the membrane was incubated with HRP-labeled goat anti-rabbit IgG secondary antibody (1:8000) at room temperature for 1 h, and then developed using ECL chemiluminescence. The grayscale values ​​were analyzed using ImageJ software.

[0084] Gene expression detection: After co-culturing cells and bacteria (MOI 100) for 6 h, the culture medium was discarded, and the cells were washed once with pre-cooled PBS. Approximately 2 × 10⁻⁶ cells were collected. 6Cells. Total RNA was extracted according to the Simply P Total RNA Extraction Kit instructions: lysis buffer R1 was added, vortexed, and incubated on ice for 5 min. Lysis buffer R2 was added, and the mixture was transferred to a purification column. The cells were centrifuged at 12000 rpm for 1 min, washed twice with washing buffer, and then eluted with 25 μL of elution buffer. RNA concentration was determined using NanoDrop, and all samples were quantified to 1000 ng. Reverse transcription was performed using the HiScript II 1st Strand cDNA Synthesis Kit: the reaction mixture contained 4 μL of 5×ALL-in-one RT Buffer, 1 μL of ALL-in-one Enzyme Mix, X μL of Template RNA (1 pg–1 μg), and RNase-free ddH2O to a final volume of 20 μL; the reaction conditions were 50℃ for 15 min and 85℃ for 5 s. qRT-PCR was performed using ChamQ Universal SYBR qPCR Master Mix: the reaction mixture consisted of 10 μL of 2×SYBR Mix, 1 μL each of forward and reverse primers, 2 μL of cDNA, and 6 μL of ddH2O. The mRNA expression levels of MUC2, glycosyltransferase genes (B3GNT6, Fut1, Fut2, Fut3, ST6GALNAC1, ST6GALNAC2), tight junction protein genes (Claudin-1, Claudin-2, ZO-1, Occludin), inflammatory cytokine genes (IL-1β, TNF-α, IL-17, CXCL1), and signaling pathway-related genes (p38, Wnt3a, β-catenin, GSK-3β, CyclinD1, etc.) were detected. β-Actin was used as an internal control, and the relative expression levels were calculated using the 2^-ΔΔCt method.

[0085] Experimental results showed that, under the Salmonella typhimurium infection scenario, the novel functional engineered probiotic Lc-pPG-ST6-LFCA-TFF3 could significantly repair and enhance the intestinal epithelial cell barrier function. In in vitro experiments, it upregulated the expression of tight junction proteins Occludin and Claudin-1 in LS174T cells by 42.6% and 33.9%, respectively, increased the expression of MUC2 protein by 59.4%, and increased the expression of glycosyltransferase genes ST6GALNAC1, ST6GALNAC2, Fut1, Fut2, Fut3, and B3GNT6 by 0.5-5.0 times. In in vivo experiments, the expression of tight junction proteins ZO-1, Claudin-1, and Occludin in mouse ileum tissue was significantly upregulated compared with the infection group, MUC2 gene mRNA increased by 1.93 times, and glycosyltransferase genes ST6GALNAC1 and B3GNT6 increased by 3.5 times and 2.5 times, respectively. Simultaneously, this engineered bacterium specifically inhibited the activation of the p38 / MAPK signaling pathway, reducing P-p38 levels in in vitro cells by 51.2% and in vivo mouse ileum tissue by 62%. It also precisely activated the Wnt / β-catenin repair axis through an asymmetric uncoupling mechanism (Wnt3a increased by 80.5%, p-GSK-3β by 80.3%, and CyclinD1 by 58.4%), while triggering a negative feedback self-limiting mechanism (GSK-3β transcriptional upregulation), effectively avoiding the risk of abnormal intestinal mucosal proliferation. These results address the problems of intestinal barrier damage, excessive inflammatory response activation, and paralysis of repair signals caused by pathogenic bacterial infection, demonstrating a more significant barrier function repair effect than wild-type Lactobacillus casei.

[0086] IV. In vivo functional verification of engineered probiotics (using the Kunming mouse infection model) 1. Animal grouping and establishment of infection models Six-week-old female SPF-grade C57BL / 6 mice (weighing 18-22 g) were housed in a standardized environment (23℃, 20% humidity, 12 h light / 12 h dark cycle) with free access to food and water. After one week of acclimatization, all mice were given sterile water containing streptomycin sulfate (5 mg / mL) for two consecutive days to clear intestinal symbiotic flora and enhance Salmonella colonization. After one day of normal feeding, the mice were randomly divided into 8 groups (n=12): Control group (administered PBS by gavage, 200 μL / animal); Salmonella typhimurium infection group (Positive control, 1×10⁶ gavage) 8 CFU / mL bacterial suspension, 200 μL / animal); 5-ASA drug treatment group (5-ASA, 200 μL / animal administered by gavage daily after challenge); Wild-type Lactobacillus casei treatment group (Lc, 1×10⁻⁶ daily by gavage after challenge) 8 CFU / mL bacterial suspension, 200 μL / animal); The engineered probiotic Lc-pPG-ST6-LFCA-TFF3 treatment group (Lc-pPG-ST6-LFCA-TFF3, same dosage as the Lc group). 5-ASA dirty cage sharing group (D-5-ASA, housed together with 5-ASA group); Wild-type Lc dirty cage sharing group (D-Lc, housed together with Lc group); The engineered probiotic dirty cage sharing group (D-Lc-pPG-ST6-LFCA-TFF3, which was housed in the same cage as the Lc-pPG-ST6-LFCA-TFF3 group).

[0087] Each group received treatment for 10 consecutive days according to the above protocol.

[0088] 2. Detection of immune function-related indicators Flow cytometry analysis: One day after the last treatment, mice were euthanized, and spleens (SP), mesenteric lymph nodes (MLN), and Pell's aggregated lymph nodes (PPs) were harvested and placed in a small dish containing a grinding mesh and 1 mL of complete culture medium. Single-cell suspensions were prepared by grinding on ice. 500 μL of erythrocyte lysis buffer was added to the spleen cell suspension, and lysis was terminated on ice for 3 min. After centrifugation, fluorescently labeled antibodies were added: CD11c-percp-cy5.5, CD80-PE, and CD86-FITC were added for dendritic cells (DCs); CD45R / B220-PEcy5.5 and IgA-FITC (fixation and membrane perforation required) were added for B cells; and CD3-Percp-cy5.5, CD4-PE-cy5, and Foxp3-FITC (fixation and membrane perforation required) were added for T cells. After incubation at 4°C in the dark for 35 min, the cells were washed, fixed, filtered, and the number and proportion of each immune cell were analyzed by flow cytometry. Meanwhile, intestinal epithelial cells were isolated from the intact intestine of mice, and the number of Paneth cells (CD326-APC, CD45-Cy5.5, CD44-FITC, CD117-PE) and goblet cells (CD326-APC, CD45-Cy5.5, CLCA1-AF488) was detected.

[0089] ELISA assay: Mouse serum and fresh fecal supernatant were collected and analyzed according to the ELISA kit instructions. Serum concentrations of IgG, IL-10, TNF-α, and IL-1β, and fecal secretory sIgA content were measured. 50 μL of different concentrations of standards were added to the standard wells. 10 μL of the sample to be tested was added to the sample wells, followed by 40 μL of sample diluent. Except for the blank wells, 100 μL of HRP-labeled detection antibody was added to each well. The mixture was incubated at 37°C for 60 min. After washing five times, 50 μL each of substrates A and B were added, and the mixture was incubated at 37°C in the dark for 15 min. 50 μL of stop solution was added, and the OD value was measured at 450 nm within 15 min.

[0090] qRT-PCR detection: Mouse ileum tissue (approximately 60 mg) was collected, lysed thoroughly using a tissue homogenizer after adding lysis buffer R2, and lysed on a shaker for 30 min. After centrifugation, the supernatant was transferred to an adsorption column, washed, and eluted with 25 μL of elution buffer to remove total RNA. The RNA concentration was measured using NanoDrop, and all samples were quantified to 1000 ng before reverse transcription to synthesize cDNA. qRT-PCR was performed using ChamQ Universal SYBR qPCR Master Mix to detect the mRNA expression levels of inflammatory factors (TNF-α, IL-1β, IL-17, CXCL1), tight junction proteins (ZO-1, Claudin-1, Claudin-2), MUC2, glycosyltransferase genes (ST6GALNAC1, ST6GALNAC2, Fut1, Fut2, Fut3, B3GNT6), and signaling pathway-related genes (p38, Wnt3a, β-catenin, GSK-3β, CyclinD1, c-Myc, BIRC5, etc.), with β-Actin as an internal control.

[0091] 3. Intestinal tissue pathological examination Tissues from the duodenum, jejunum, ileum, colon, liver, and spleen of mice were collected and fixed in 4% paraformaldehyde for one month. After routine gradient dehydration with alcohol (70%→80%→85%→90%→95%→100%), clearing with xylene, and embedding in paraffin, sections (3 μm thickness) were prepared using a paraffin microtome. The sections were then spread in a 40°C water bath, removed from the slides, and dried at 80°C for 2 h. Hematoxylin-eosin (HE) staining, periodic acid-Scheffler (PAS) staining (for goblet cells), and immunohistochemical (IHC) staining (for Claudin-1, ZO-1, Occludin, p38, p-p38, MUC2, ST6GALNAC1, Wnt3a, β-catenin, p-β-catenin, GSK-3β, p-GSK-3β, CyclinD1, ERK1 / 2, p-ERK1 / 2, and UEL1) were performed. Immunofluorescence (IF) staining (detection of ZO-1, Claudin-1, Occludin, and MUC2).

[0092] 4. Intestinal flora analysis Following the final treatment, fresh fecal samples were collected from mice and stored in pre-cryopreservative tubes, flash-frozen in liquid nitrogen, and then stored at -80°C. Total DNA was extracted from the fecal samples and subjected to metagenomic high-throughput sequencing. The sequencing results were analyzed using the Lianchuan Bio Cloud Platform for bioinformatics analysis: α-diversity analysis (Chao1 index, Shannon index, Simpson index, Observed species index, and Goods index). Coverage index was used to assess the richness and evenness of the gut microbiota; β-diversity analysis (principal coordinate analysis PCoA and non-metric multidimensional scaling analysis NMDS) was used to assess the differences in microbiota structure among groups; species composition analysis was used to assess relative abundance changes at the phylum level (Firmicutes, Bacteroidota, Pseudomonadota, etc.) and genus level (Lactobacillus, Akkermansia, Bacteroides, Phocaeicola, etc.); functional composition analysis was used to annotate the abundance of metabolic pathways such as short-chain fatty acid metabolism (butyrate metabolism, pyruvate metabolism) and lipopolysaccharide synthesis based on the KEGG database; virulence factor analysis was used to analyze the abundance of genes such as Salmonella virulence island (SPI-2), siderophores (Salmochelin), virulence regulation system (PhoP), and polymyxin resistance gene (PmrF) based on the VFDB database, and to assess the impact of engineered bacteria on gut microbiota balance and the resistance gene pool.

[0093] Experimental results showed that oral administration of Lc-pPG-ST6-LFCA-TFF3 as a functional delivery vector effectively activated host mucosal and systemic immune responses. Flow cytometry analysis showed that it could increase IgA levels in the spleen, mesenteric lymph nodes, and Peyer's aggregated lymph nodes of mice. + B cell count increased 1.5-2.3 times, Foxp3 + The number of Treg cells increased 2.0-2.8 times, while significantly reversing the pathological proliferation of CD11c. + Dendritic cell and Paneth cell counts were measured. ELISA showed a significant increase in serum IL-10 levels, a significant decrease in serum TNF-α and IL-1β levels compared to the infection group, and a highly significant increase in fecal sIgA concentration. qPCR showed that the mRNA levels of TNF-α, IL-1β, IL-17, and CXCL1 genes in mouse intestinal tissue decreased by more than 90%, while the expression of tight junction proteins, mucins, and glycosyltransferase genes was significantly upregulated. Furthermore, this engineered bacterium can regulate the intestinal flora structure, increase the abundance of Firmicutes and Bacteroidetes, specifically enrich the next-generation probiotic Akkermansia muciniphila, enrich intestinal flora diversity, and target the reduction of Salmonella virulence island SPI-2 and the high-risk polymyxin resistance gene PmrF. The relative abundance of Salmonella in the experimental group was lower than that in the dirty cage group. This engineered bacterium controlled host weight loss to 9.4% (significantly better than the 20.8% in the wild-type Lc group and the 35.4% in the 5-ASA group), effectively alleviating intestinal pathological damage caused by Salmonella typhimurium (intact intestinal villi, reduction of submucosal edema), increasing the number of goblet cells, and maintaining the integrity of the intestinal wall and villi. The dirty cage model further confirmed that this engineered bacterium can achieve herd-level immune protection through environmental transmission. Compared to the shortcomings of traditional antibiotic treatment, such as difficulty in eradicating intracellular bacteria, easy induction of drug resistance, and disruption of the intestinal microecology, this engineered bacterium possesses multiple functions including barrier repair, immune activation, anti-inflammation, and microbiota regulation. It can be used as an oral microecological preparation for the prevention and control of Salmonella infection in livestock and poultry farming and the intervention of intestinal infection-related diseases in humans, reducing antibiotic use and lowering the risk of drug resistance. It has broad application prospects in the fields of medicine, animal husbandry, and food health, and can generate significant social and economic benefits.

[0094] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. An engineered bacterium, Lc-pPG-ST6-LFCA-TFF3, co-expressing ST6GALNAC1, LFCA, and TFF3, characterized in that, The engineered bacteria, with Lactobacillus casei ATCC393 as the starting strain, co-express sialyltransferase ST6GALNAC1, antimicrobial peptide LFCA, and repair factor TFF3.

2. The engineered bacterium Lc-pPG-ST6-LFCA-TFF3 according to claim 1, characterized in that, The engineered bacteria were prepared by electroporation of Lactobacillus casei competent cells using the recombinant plasmid pPG-ST6-LFCA-TFF3, which contains the ST6-LFCA-TFF3 gene fragment.

3. The engineered bacterium Lc-pPG-ST6-LFCA-TFF3 according to claim 2, characterized in that, The nucleotide sequence of the ST6-LFCA-TFF3 gene fragment is shown in SEQ ID NO.

5.

4. The method for preparing the engineered bacterium Lc-pPG-ST6-LFCA-TFF3 as described in any one of claims 1-3, characterized in that, Includes the following steps: (1) Amplify the ST6GALNAC1 gene and the LFCA-TFF3 fusion gene, and construct the cloning vector pEASY-ST6-LFCA-TFF3 containing the ST6GALNAC1-LFCA-TFF3 fusion gene; (2) The recombinant plasmid pEASY-ST6-LFCA-TFF3 and the expression vector pPG-612 were double-digested with restriction endonucleases SacⅡ and NotⅠ, and then ligated to obtain the recombinant expression vector pPG-ST6-LFCA-TFF3; (3) Preparation of competent Lactobacillus casei cells; (4) The recombinant plasmid pPG-ST6-LFCA-TFF3 was electroporated into competent Lactobacillus casei cells, and positive transformants were screened, which were the engineered bacteria Lc-pPG-ST6-LFCA-TFF3.

5. The use of the engineered bacterium Lc-pPG-ST6-LFCA-TFF3 as described in any one of claims 1-3 in the preparation of a drug for repairing the intestinal mucosal barrier.

6. The use of the engineered bacterium Lc-pPG-ST6-LFCA-TFF3 as described in any one of claims 1-3 in the preparation of a drug for treating Salmonella typhimurium infection.

7. A pharmaceutical composition for treating Salmonella typhimurium infection, characterized in that, It comprises the engineered bacterium Lc-pPG-ST6-LFCA-TFF3 as described in any one of claims 1-3 and a pharmaceutically acceptable carrier.

8. The use of the engineered bacterium Lc-pPG-ST6-LFCA-TFF3 as described in any one of claims 1-3 in the preparation of a medicament for relieving intestinal inflammation, reducing intestinal pathological tissue damage, or increasing the number of goblet cells.

9. The use of the engineered bacterium Lc-pPG-ST6-LFCA-TFF3 as described in any one of claims 1-3 in the preparation of a microecological preparation for the prevention and control of Salmonella infection in livestock and poultry farming.

Images