Use of a novel indole-3-pyruvate decarboxylase in the preparation of genetically engineered escherichia coli with high yield of indole-3-acetic acid

Abstract

The application belongs to the technical field of microbial fermentation, and particularly relates to application of a novel indole-3-pyruvate decarboxylase in preparation of a genetically engineered escherichia coli with high yield of indole-3-acetic acid. The genetically engineered escherichia coli contains a recombinant plasmid, and the recombinant plasmid comprises the following genes: an aromatic amino acid aminotransferase gene, an indole-3-pyruvate decarboxylase AXC29253.1 gene, an indole-3-acetaldehyde dehydrogenase gene, and the genome of the escherichia coli is knocked out of a pyruvate formate-lyase gene pflB and a pyruvate oxidase gene poxB. Klebsiella The application provides the indole-3-pyruvate decarboxylase AXC29253.1 derived from sp.X13 to replace the existing decarboxylase, and combines an improved scheme of metabolic engineering modification of an escherichia coli chassis, so as to further improve the fermentation yield of IAA.

Description

Technical Field

[0001] This invention belongs to the field of microbial fermentation technology, and in particular relates to the application of a novel indole-3-pyruvate decarboxylase in the preparation of genetically engineered Escherichia coli with high production of indole-3-acetic acid. Background Technology

[0002] Indole-3-acetic acid (IAA), an important plant growth hormone, plays a crucial role in regulating plant physiological processes. Furthermore, IAA and its derivatives have broad application prospects in agriculture, root development regulation, and biomedicine. Traditionally, IAA is mainly obtained through chemical synthesis, but this method usually involves toxic raw materials, harsh reaction conditions, and severe environmental pollution, failing to meet the requirements of green and sustainable development. Therefore, developing efficient, environmentally friendly, and economical IAA biosynthetic methods has become one of the hot research directions in recent years.

[0003] With the rapid development of synthetic biology and metabolic engineering, significant progress has been made in the biosynthesis of IAA using genetically engineered microorganisms. Currently, CN111254104B discloses a method for expressing indole-3-acetic acid (IAA) via heterologous expression of key proteins in *E. coli* using the indole-3-pyruvic acid (IPyA) pathway. The indole-3-pyruvic acid pathway uses tryptophan as a precursor, which is catalyzed by aromatic amino acid aminotransferases to generate IPyA. Then, indole-3-pyruvic acid decarboxylase catalyzes the decarboxylation of IPyA to generate indole-3-acetaldehyde (IAAld). Finally, indole-3-acetaldehyde dehydrogenase oxidizes IAAld to IAA. The applicant previously disclosed a genetically engineered Escherichia coli strain for synthesizing IAA and its applications in CN121610434A. The strain was constructed by optimizing the combination of aromatic amino acid aminotransferase gene (SEQ ID NO.1), indole-3-pyruvate decarboxylase gene (SEQ ID NO.2), and indole-3-acetaldehyde dehydrogenase gene (SEQ ID NO.3) with a constitutive promoter and then transferring them into E. coli. At the genomic level, the tryptophan degradation gene TnaA and tryptophan repressor protein genes TrpR and TyrR were knocked out, and an engineered strain capable of synthesizing IAA de novo from glucose was successfully constructed.

[0004] However, the existing technologies still have room for further optimization. First, pyruvate is a key metabolic intermediate in the central carbon metabolism network of *E. coli*. It is not only the upstream source of phosphoenolpyruvate and erythrose-4-phosphate, precursors to tryptophan synthesis, but also the substrate for the first step in the indole-3-pyruvate pathway to IPyA. In strains where TnaA, TrpR, and TyrR were knocked out to relieve tryptophan degradation and feedback inhibition, the carbon flow splitting problem at the pyruvate node still exists, preventing the full realization of the theoretical carbon yield of IAA and limiting further yield increases. Second, in the aforementioned IAA synthesis pathway, the catalysis of IPyA to IAA1d by indole-3-pyruvate decarboxylase is the second step in the entire pathway and is also one of the potential rate-limiting links. Studies have shown that indole-3-pyruvate decarboxylases from different species exhibit significant differences in catalytic efficiency, substrate affinity, and tolerance to fermentation environments (such as pH, temperature, and product inhibition). While the decarboxylase disclosed in CN121610434A can achieve de novo synthesis of IAA, its catalytic efficiency in actual fermentation systems still has room for improvement. Therefore, finding novel indole-3-pyruvate decarboxylases with higher catalytic efficiency and better compatibility with upstream pathways is of great significance for further increasing the fermentation yield of IAA.

[0005] In summary, while existing IAA biosynthesis technologies based on the indole-3-pyruvate pathway have made significant progress in substrate utilization and ease of operation, they still face the dual bottlenecks of carbon flux loss due to pyruvate metabolic diversion and insufficient catalytic efficiency of key decarboxylases in the pathway. Summary of the Invention

[0006] To address the aforementioned issues, this invention provides an improved scheme that combines an indole-3-pyruvate decarboxylase AXC29253.1 derived from Klebsiella sp. X13 to replace existing decarboxylases with a chassis metabolic engineering modification of Escherichia coli, aiming to further increase the fermentation yield of IAA.

[0007] This invention provides a genetically engineered *Escherichia coli* bacterium containing a recombinant plasmid, the recombinant plasmid comprising the following genes: Aromatic amino acid aminotransferase gene, the nucleotide sequence of which is shown in SEQ ID NO.1; indole-3-pyruvate decarboxylase AXC29253.1 gene, the nucleotide sequence of which is shown in SEQ ID NO.2; indole-3-acetaldehyde dehydrogenase gene, the nucleotide sequence of which is shown in SEQ ID NO.3. The pyruvate formate lyase gene was knocked out in the genome of the *E. coli*. pflB and pyruvate oxidase gene poxB Among them, the pyruvate formate lyase gene pflB The nucleotide sequence is shown in SEQ ID NO.6; pyruvate oxidase gene poxB The nucleotide sequence is shown in SEQ ID NO.7.

[0008] Furthermore, the Escherichia coli is Escherichia coli BL21.

[0009] Furthermore, the vector backbone of the recombinant plasmid is the pET28a-Blank plasmid.

[0010] Furthermore, the expression of each gene in the recombinant plasmid is driven by a constitutive promoter; The promoter sequences of the aromatic amino acid aminotransferase gene and the indole-3-pyruvate decarboxylase AXC29253.1 gene are shown in SEQ ID NO.4, and the promoter sequence of the indole-3-acetaldehyde dehydrogenase gene is shown in SEQ ID NO.5.

[0011] This invention provides a method for constructing genetically engineered Escherichia coli, comprising the following steps: (1) Construction of recombinant plasmid: SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 are ligated to the vector backbone to obtain recombinant plasmid, and the recombinant plasmid is transformed into Escherichia coli to obtain Escherichia coli containing recombinant plasmid; (2) Transform the pCas9 plasmid into Escherichia coli BL21 to obtain Escherichia coli containing the pCas9 plasmid; (3) Knockout of the E. coli genome containing the pCas9 plasmid obtained in step (2) pflB and poxB Eliminate the Target plasmid and pCas9 plasmid to obtain the knockout in the genome. pflB and poxB Escherichia coli; (4) Transform the recombinant plasmid obtained in step (1) into the genome obtained in step (3) to knock out the recombinant plasmid. pflB and poxB Genetically engineered Escherichia coli provided by this invention was obtained from Escherichia coli.

[0012] This invention provides a method for synthesizing indole-3-acetic acid using genetically engineered Escherichia coli, comprising the following steps: (1) The genetically engineered Escherichia coli was inoculated into TB medium containing tryptophan and glucose for fermentation culture; (2) Collect the fermentation products and detect and quantify indole-3-acetic acid.

[0013] Furthermore, the amount of glucose added is 4 g / L; the amount of tryptophan added is 8 g / L.

[0014] This invention provides an application of genetically engineered Escherichia coli in the microbial fermentation production of indole-3-acetic acid.

[0015] Compared with the prior art, the present invention has the following beneficial effects: This invention discovered and screened an indole-3-pyruvate decarboxylase AXC29253.1 derived from Klebsiella sp. X13. When applied to the IAA synthesis pathway to replace existing decarboxylases, it can significantly increase the yield of IAA under the same fermentation conditions.

[0016] This invention further engineered the metabolism of Escherichia coli BL21, knocking out key genes in the pyruvate competitive consumption pathway. pflB and poxB This blocks the metabolic diversion of pyruvate to byproducts such as formic acid and acetic acid, redirecting more pyruvate to the first step of the IAA synthesis pathway. In the knockout... pflB and poxB Subsequently, the IAA production was significantly increased compared to the non-knockout strain, indicating that this metabolic engineering strategy effectively enhanced the synthesis efficiency of IAA.

[0017] This invention introduces indole-3-pyruvate decarboxylase AXC29253.1 and... pflB and poxB The metabolic engineering of double gene knockout was optimized. Experiments showed that *E. coli* using indole-3-pyruvate decarboxylase AXC29253.1 without metabolic engineering significantly increased IAA production compared to *E. coli* using the original indole-3-pyruvate decarboxylase; this was achieved through metabolic engineering. pflB and poxB The engineered strain using indole-3-pyruvate decarboxylase AXC29253.1 on a double gene knockout basis exhibited significantly higher IAA production than strains that only replaced indole-3-pyruvate decarboxylase AXC29253.1 without further modification. pflB and poxB The double gene knockout strain demonstrates the synergistic effect between metabolic engineering and enzyme element optimization.

[0018] This invention uses a constitutive promoter to drive the expression of genes in the IAA synthesis pathway, without the need for inducing agents such as IPTG, thus achieving efficient synthesis of IAA using tryptophan as a precursor.

[0019] This invention constructs genetically engineered *E. coli*, tandemly incorporating aromatic amino acid aminotransferase genes, indole-3-pyruvate decarboxylase (AXC29253.1), and indole-3-acetaldehyde dehydrogenase genes into a polycistronic structure and inserting them into an *E. coli* plasmid, forming a complete IAA synthetic pathway. Simultaneously, through optimized combination of constitutive promoters, efficient gene expression independent of inducers is achieved. Furthermore, the pyruvate formate lyase gene is knocked out using a CRISPR / Cas9 gene knockout system. pflB and pyruvate oxidase gene poxB This method blocks the metabolic diversion of pyruvate to byproducts such as formic acid and acetic acid, redirecting more pyruvate to the first step of the IAA synthesis pathway, ultimately achieving efficient synthesis of indole-3-acetic acid using tryptophan as a substrate. Attached Figure Description

[0020] Figure 1 This is a schematic diagram of the genetically engineered Escherichia coli recombinant plasmid containing indole-3-pyruvate decarboxylase AXC29253.1 in Example 1.

[0021] Figure 2 The image shows DNA electrophoresis diagrams of the pflB and poxB gene knockouts in Example 2, where M is a 5000 bp DNA marker; 1 is a single colony PCR amplification band of the pflB gene not knocked out; 2 is a single colony PCR amplification band of the pflB gene knocked out; 3 is a single colony PCR amplification band of the poxB gene not knocked out; and 4 is a single colony PCR amplification band of the poxB gene knocked out.

[0022] Figure 3 This is a diagram showing the results of shake-flask fermentation of genetically engineered Escherichia coli in Example 3. Detailed Implementation

[0023] Example 1 1. Constructing recombinant plasmids for genetically engineered E. coli Recombinant plasmids of genetically engineered *E. coli* were constructed using the In-Fusion ligation (Novizan, China) seamless ligation method: The aromatic amino acid aminotransferase gene amplification was obtained using the first primer pair (base sequences shown in SEQ ID NO. 8 and SEQ ID NO. 9) as a template; the indole-3-pyruvate decarboxylase gene amplification was obtained using the second primer pair (base sequences shown in SEQ ID NO. 10 and SEQ ID NO. 11) as a template; the indole-3-pyruvate dehydrogenase gene amplification was obtained using the third primer pair (base sequences shown in SEQ ID NO. 12 and SEQ ID NO. 13) as a template; and the indole-3-acetaldehyde dehydrogenase gene amplification was obtained using the fourth primer pair (base sequences shown in SEQ ID NO. 14 and SEQ ID NO. 15). As shown in NO.15, the *E. coli* vector backbone amplification product was obtained by amplifying the *E. coli* pET28a-Blank plasmid as a template. The promoter shown in SEQ ID NO.4 was ligated to the gene amplification product obtained by the first primer pair, the promoter shown in SEQ ID NO.4 was ligated to the gene amplification product obtained by the second primer pair, and the promoter shown in SEQ ID NO.5 was ligated to the gene amplification product obtained by the third primer pair. The three gene fragments after ligation of the promoters were then ligated to the *E. coli* vector backbone amplification product without the need for a linker, thus obtaining a genetically engineered *E. coli* recombinant plasmid. See details below. Figure 1 .

[0024] 2. Preparation of competent Escherichia coli through chemical transformation Escherichia coli BL21 was inoculated into antibiotic-free LB medium and activated overnight at 37°C. The next day, it was inoculated at 1% into 50 mL of liquid LB medium and cultured at 37°C and 220 rpm. When OD... 600 When the pH reached 0.6, the culture was stopped and the culture was quickly placed on ice to cool. The bacterial culture was then transferred to pre-chilled 50 mL centrifuge tubes and centrifuged at 3500 rpm for 10 min. The supernatant was discarded, and the bacterial cells were collected into EP tubes. The bacterial cells were washed twice with 2.5 mL of pre-chilled sterile 0.1 M CaCl2, centrifuged at 3500 rpm for 10 min again, and the supernatant was discarded again. The bacterial cells were collected, and finally, the bacterial cells were resuspended in 1 mL of pre-chilled 0.1 M CaCl2 (containing 10% glycerol). The cells were aliquoted into pre-chilled 1.5 mL centrifuge tubes at 100 μL each to obtain chemically transformed competent Escherichia coli.

[0025] 3. Transform the genetically engineered E. coli recombinant plasmid obtained in step 1 into the chemically transformed competent E. coli obtained in step 2 to obtain E. coli containing the genetically engineered E. coli recombinant plasmid without gene knockout.

[0026] Example 2 1. Constructing the target plasmid and homology repair template for the pflB gene The pCas9 plasmid was transformed into the chemically transformed competent Escherichia coli prepared in Example 1 to obtain Escherichia coli BL21 containing the pCas9 plasmid.

[0027] The expression of two genes, pflB (base sequence shown in SEQ ID NO.6) and poxB (base sequence shown in SEQ ID NO.7), was knocked out on the genome of Escherichia coli containing the pCas9 plasmid.

[0028] The specific experimental steps are as follows (taking pflB knockout as an example): Using the chemically transformed competent E. coli genome obtained in Example 1 as a template, PCR amplification was performed using the fifth primer pair (base sequences as shown in SEQ ID NO.16 and SEQ ID NO.17) to obtain the upstream homologous arm, and PCR amplification was performed using the sixth primer pair (base sequences as shown in SEQ ID NO.18 and SEQ ID NO.19) to obtain the downstream homologous arm; using the obtained upstream and downstream homologous arms as templates, the upstream primer of the fifth primer pair (base sequence as shown in SEQ ID NO.16) and the downstream primer of the sixth primer pair (base sequence as shown in SEQ ID NO.19) were used, along with the high-fidelity enzyme 2× Phanta UniFi Master Mix (Dye Plus)-P526 from Nanjing Novizan Biotechnology Co., Ltd., to obtain the pflB homology repair template (Donor DNA-pflB) through overlap extension PCR amplification. After the PCR amplification products were verified by agarose gel electrophoresis, they were purified and recovered using a full-gold DNA gel extraction kit according to the instructions to obtain the corresponding DNA solution.

[0029] Using the Target plasmid vector as a template, PCR amplification was performed with the seventh primer pair (base sequences as shown in SEQ ID NO.20 and SEQ ID NO.21) to obtain a linearized DNA fragment of the Target-N20-pflB plasmid containing the N20 sequence corresponding to the pflB gene (base sequence as shown in SEQ ID NO.22). Other sequences of the Target plasmid vector remained unchanged. The Target-N20-pflB plasmid was obtained by phosphorylation and self-circularization of the linearized DNA fragment. The first step of phosphorylation and self-ligation was the phosphorylation of the linearized DNA fragment. Using 2 μL of the linearized DNA fragment as a template, 1 μL of 10x Reaction Buffer A, 1 μL of 10 mM ATP, 0.5 μL of T4 Polynucleotide Kinase, and 5.5 μL of enzyme-free sterile water were added. After mixing by pipetting, the mixture was incubated at 37 °C for 20 min, followed by incubation at 75 °C for 10 min to obtain the phosphorylated Target-N20-pflB plasmid linearized DNA fragment. The second step of phosphorylation and self-ligation was the circularization and self-ligation of the phosphorylated linearized DNA fragment. Using 2 μL of the phosphorylated Target-N20-pflB plasmid linearized DNA fragment as a template, 1 μL of 10x T4 DNA Ligase Buffer and 1 μL of T4 DNA were added. Ligase and 6 μL of enzyme-free sterile water were mixed by pipetting and incubated at 22°C for 1 hour to obtain the Target-N20-pflB plasmid.

[0030] 2. Preparation of electrotransformation competent Escherichia coli The *E. coli* BL21 containing the pCas9 plasmid obtained in step 1 was inoculated into liquid LB medium containing kanamycin (25 ug / ml) and activated overnight at 30°C. The next day, it was transferred at a 1% ratio to 50 mL of liquid LB medium containing kanamycin (25 ug / ml) and arabinose (10 mM) and cultured at 30°C and 220 rpm. When OD... 600 When the pH reaches 0.4–0.6, stop the culture and immediately place the culture on ice for 15–30 min. Then, transfer the bacterial suspension to a pre-chilled 50 mL centrifuge tube and centrifuge at 3500 rpm for 10 min. Discard the supernatant and collect the bacterial cells into an EP tube. Resuspend the bacterial cells twice in 2.5 mL of pre-chilled sterile ultrapure water, centrifuge at 3500 rpm for 10 min, discard the supernatant again, and collect the bacterial cells. Finally, resuspend the bacterial cells in 1 mL of pre-chilled 10% glycerol and aliquot 100 μL into pre-chilled 1.5 mL centrifuge tubes to obtain electrotransformed competent Escherichia coli containing the pCas9 plasmid.

[0031] 3. Knockout and validation of the pflB gene The pflB homology repair template (Donor DNA-pflB) and Target-N20-pflB plasmid obtained in step 1 were electroporated into the electroporated competent E. coli containing the pCas9 plasmid obtained in step 2: Approximately 100 ng of Target-N20-pflB plasmid and approximately 400 ng of Donor DNA-pflB were added to every 50 μL of electroporated competent E. coli containing the pCas9 plasmid, and electroporation was performed under the following conditions: 2.5 kV, 5 ms. After electroporation, 900 μL of SOC or LB was added to the electroporated electroporated competent E. coli containing the pCas9 plasmid, and the cells were incubated at 30 °C and 220 rpm for 1 h for recovery. The cells were then plated on LB plates containing two antibiotics (kanamycin 25 μg / ml and chloramphenicol 50 μg / ml) and incubated overnight at 30 °C. Single clones were picked the day after electroporation and cultured using the eighth primer pair (base sequence as shown in SEQ ID). PCR amplification was performed on samples NO.23 and SEQ ID NO.24. The positive clone with the pflB gene knocked out amplified a 2479bp fragment, while the negative control without the pflB gene knocked out amplified a 3382bp fragment.

[0032] Verified positive clones with the pflB gene knocked out were inoculated into LB liquid medium containing 25 μg / ml kanamycin and cultured at 30 °C with shaking at 220 rpm. A small amount of bacterial culture was taken with an inoculation loop and streaked onto an LB plate containing 25 μg / ml kanamycin. Once single colonies grew on the plate, single colonies were picked and cultured separately into LB liquid medium containing 25 μg / ml kanamycin and LB liquid medium containing both 25 μg / ml kanamycin and 50 μg / ml chloramphenicol. Single colonies that grew only on the kanamycin monoclonal antibody medium and not on the dual antibody medium were considered positive clones with the Target-N20-pflB plasmid eliminated. These positive clones with the Target-N20-pflB plasmid eliminated were then propagated and cultured in LB liquid medium containing 25 μg / ml kanamycin at 30 °C and 220 rpm to obtain E. coli containing the pCas9 plasmid and with the pflB gene knocked out.

[0033] 4. Constructing the target plasmid and homology repair template for the poxB gene Using the chemically transformed competent *E. coli* genome obtained in Example 1 as a template, PCR amplification was performed using primer pair 9 (base sequences as shown in SEQ ID NO. 25 and SEQ ID NO. 26) to obtain the upstream homologous arm, and primer pair 10 (base sequences as shown in SEQ ID NO. 27 and SEQ ID NO. 28) to obtain the downstream homologous arm. Using the obtained upstream and downstream homologous arms as templates, the upstream primer of primer pair 9 (base sequence as shown in SEQ ID NO. 25) and the downstream primer of primer pair 10 (base sequence as shown in SEQ ID NO. 28) were used for overlap extension PCR amplification to obtain the poxB homology repair template (Donor DNA-poxB). After verification by agarose gel electrophoresis, the PCR amplification products were purified and recovered using a full-gold DNA gel extraction kit according to the instructions to obtain the corresponding DNA solution.

[0034] Using the Target plasmid vector as a template, PCR amplification was performed with the eleventh primer pair (base sequences as shown in SEQ ID NO.29 and SEQ ID NO.30) to obtain a linearized DNA fragment of the Target-N20-poxB plasmid containing the N20 sequence corresponding to the poxB gene (base sequence as shown in SEQ ID NO.31). Other sequences of the Target plasmid vector remained unchanged. The Target-N20-poxB plasmid was then obtained by phosphorylation and self-circularization amplification of the fragment. 5. Knockout and validation of the poxB gene The *E. coli* strains containing the pCas9 plasmid and with the pflB gene knocked out, obtained in step 3, were used to prepare electroporation competent *E. coli* strains containing the pCas9 plasmid and with the pflB gene knocked out, following the same electroporation conditions as in step 2. The poxB homology repair template (Donor DNA-poxB) and the Target-N20-poxB plasmid obtained in step 4 were then electroporated into these electroporation competent *E. coli* strains containing the pCas9 plasmid and with the pflB gene knocked out, under the same electroporation conditions as in step 3. PCR amplification was performed using the twelfth primer pair (base sequences shown in SEQ ID NO. 32 and SEQ ID NO. 33) for verification. The positive clones with the poxB gene knocked out amplified a 1949 bp fragment, while the negative control without the poxB gene knocked out amplified a 2800 bp fragment. The PCR verification results are as follows: Figure 2 As shown, bands 3 and 4 are the amplification products of the non-knockout and knockout poxB gene, respectively, and the band sizes are consistent with expectations.

[0035] Positive clones with the confirmed poxB gene knockout were inoculated into LB liquid medium containing 25 μg / ml kanamycin and cultured at 30 °C with shaking at 220 rpm. A small amount of bacterial culture was then streaked onto LB plates containing 25 μg / ml kanamycin using an inoculation loop. Once single colonies grew on the plates, these colonies were picked and cultured separately in LB liquid medium containing 25 μg / ml kanamycin and LB liquid medium containing both 25 μg / ml kanamycin and 50 μg / ml chloramphenicol. Single colonies that grew only on the kanamycin monoclonal antibody medium and not on the dual antibody medium were considered positive clones with the Target-N20-poxB plasmid eliminated. These positive clones with the Target-N20-poxB plasmid eliminated were then propagated in LB liquid medium containing 25 μg / ml kanamycin at 30 °C and 220 rpm to obtain E. coli containing the pCas9 plasmid and with both the pflB and poxB genes knocked out.

[0036] 6. Elimination of pCas9 plasmid The *E. coli* containing the pCas9 plasmid and with the pflB and poxB genes knocked out, obtained in step 5, were inoculated into antibiotic-free LB broth and incubated at 42 °C for 12–16 h. A small amount of bacterial culture was then streaked onto antibiotic-free LB plates using an inoculation loop. Single colonies were selected and streaked successively on LB plates containing 25 μg / ml kanamycin and antibiotic-free LB plates. When a single colony grew only on the antibiotic-free plate, it was considered a positive clone with the pCas9 plasmid eliminated and the pflB and poxB genes knocked out. These positive clones were then propagated and cultured in antibiotic-free LB broth at 37 °C and 220 rpm to obtain *E. coli* with the pflB and poxB genes knocked out, thus obtaining *E. coli* without the genetically engineered recombinant plasmid and with gene knockout.

[0037] 7. Genetically engineered E. coli The E. coli obtained in step 5, which does not contain the recombinant plasmid of genetically engineered E. coli and has undergone gene knockout, was used to prepare chemically transformed competent E. coli according to Example 1. Chemically transformed competent E. coli, which does not contain the recombinant plasmid of genetically engineered E. coli and has undergone gene knockout, was then transformed into the chemically transformed competent E. coli, which does not contain the recombinant plasmid of genetically engineered E. coli and has undergone gene knockout, to obtain genetically engineered E. coli.

[0038] Example 3 1. Fermentation of genetically engineered E. coli The genetically engineered *E. coli* obtained in Example 2 was inoculated into 5 ml of LB liquid medium containing 25 μg / ml kanamycin and cultured overnight in a shaker at 37 °C and 220 rpm to obtain a seed culture. The seed culture was then inoculated into 10 ml of liquid TB medium containing 50 μg / mL kanamycin, 4 g / L glucose, and 8 g / L tryptophan at a ratio of 1% and cultured in a shaker for 48 h to obtain the bacterial suspension. The culture conditions were the same as those for the seed culture. 1 ml of the bacterial suspension cultured for 48 h was collected to obtain the bacterial suspension to be tested.

[0039] TB culture medium formula (1 liter): Tryptone 12 g, Yeast Extract 24 g, Glycerol 4 mL, KH2PO4 2.31 g, K2HPO4·3H2O 12.54 g.

[0040] 2. Detection of indole-3-acetic acid yield After resuspending the bacterial suspension obtained in step 1, 300 μL was taken and centrifuged at 10,000 rpm for 3 min. The supernatant containing indole-3-acetic acid was collected, filtered through a 0.22 µm filter membrane, and transferred to a liquid chromatography bottle. The yield of indole-3-acetic acid was detected by high performance liquid chromatography. The chromatographic column was a C18 column, the mobile phase A was pure methanol, the mobile phase B was 0.2% formic acid water, the column temperature was 40 ℃, and the specific mobile phase ratios are shown in Table 1. The injection volume was 10 μL, the detection wavelength was 280 nm, and the total detection time for each sample was 26 min.

[0041] Table 1

[0042] 3. OD 600 Detection After resuspending the bacterial solution obtained in step 1 evenly, dilute the bacterial solution 50 times with ultrapure water to obtain a diluted bacterial solution. Pipette 2.5 ml of the diluted bacterial solution into a cuvette and use a visible spectrophotometer from Shanghai Yuanxi Instrument Co., Ltd. to detect OD600.

[0043] 4. Results of shake-flask fermentation of genetically engineered E. coli Group A recombinant strains are *E. coli* BL21 containing the recombinant plasmid from the previous patent (CN121610434A); Group B recombinant strains are *E. coli* BL21 containing the recombinant plasmid from this invention patent; Group C recombinant strains are *E. coli* BL21 with the pflB and poxB genes knocked out containing the recombinant plasmid from this invention patent. The difference between Group A and Group B lies in the recombinant plasmids used, specifically the indole-3-pyruvate decarboxylase; the difference between Group B and Group C lies in the recombinant strains used, specifically: Group B *E. coli* did not undergo gene editing, while Group C *E. coli* had the pflB and poxB genes knocked out.

[0044] First, the glycerol-containing bacteria corresponding to the three recombinant strains were streaked onto LB agar plates of the corresponding resistance types. All three groups were kanamycin resistant. The plates were activated overnight at 37 °C for 12 h. Single colonies were picked and cultured in 2 ml of LB liquid medium containing 25 μg / ml kanamycin at 37 °C and 220 rpm for 8 h to obtain activated bacterial solutions. Fermentation medium was prepared according to the TB medium composition described in Example 3 (with the addition of 4 g / L glucose and 8 g / L tryptophan). The medium was autoclaved at 115 °C for 30 min. After cooling, 50 μg / ml kanamycin was added and mixed thoroughly to complete the preparation of the fermentation medium. 10 ml of fermentation medium was dispensed into sterilized 100 ml Erlenmeyer flasks. At a ratio of 1%, 100 μl of activated bacterial solution was added to every 10 ml of fermentation medium. The flasks were sealed and fermented on a shaker at 37 °C and 220 rpm for 48 h.

[0045] After 48 hours of fermentation, 1 ml of the culture solution after 48 hours of culture was collected, which is the test culture solution obtained in step 1. The IAA yield and OD were then measured according to steps 2 and 3. 600 The test results are as follows Figure 3 As shown, Example 2 yielded genetically engineered Escherichia coli, namely... Figure 2 China's IAA production and OD 600 The highest yield of Group C Escherichia coli was 5.06 g / L of IAA and OD at 48 h. 600 It can reach 32.88.

[0046] Sequence information involved in the embodiments: Aromatic amino acid aminotransferase SEQ ID NO.1: Indole-3-pyruvate decarboxylase SEQ ID NO.2: Indole-3-acetaldehyde dehydrogenase SEQ ID NO.3: Promoter J23114 SEQ ID NO.4: TTTATGGCTAGCTCAGTCCTAGGTACAATGCTAGC; Promoter J23119 SEQ ID NO.5: TTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGC; Gene pflB SEQ ID NO.6: Gene poxB SEQ ID NO.7: SEQ ID NO.8: GTCCTAGGTACAATGCTAGCTAAAAGAGGAGAAATATACCATGACCCTCCCTGAAAGCAAAG; SEQ ID NO.9: AGCTAGCCATAAATTATTTTGAAATGCCGAACTCTTCGTACAG; SEQ ID NO.10: TAAAAGAGGAGAAATATACCATGCAACCGACTTACACTATTGGTG; SEQ ID NO.11: AGGACTGAGCTAGCTGTCAATCAGACGCGGCTGTTACG; SEQ ID NO.12: CAGTCCTAGGTATAATGCTAGCTCACACATACTAGAGAAGTTAAGAGGCAAGATATACCATGCCTACCCTGAACTTAGATCTTC; SEQ ID NO.13: CGGTGGCAGCAGCCAACTCATTAAATTGGGGCCGGCTGC; SEQ ID NO.14: TGAGTTGGCTGCTGCCA; SEQ ID NO.15: CGAGATCTCGATCCTCTACGC; SEQ ID NO.16: CAGAACAGACTGAGTCGGGATAGC; SEQ ID NO.17: GATCAAAGGCGATGTCCTGAACTATG; SEQ ID NO.18: TCAGGACATCGCCTTTGATCCCAGATTTACGGCAACGCAG; SEQ ID NO.19: CACAGCCTGGGAAGGTTTTACC; SEQ ID NO.20: TAATACTAGTTACGCAGTTTCATGACCAGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAG; SEQ ID NO.21: CCTGGTCATGAAACTGCGTAACTAGTATTATACCTAGGACTGAGCTAGCTG; SEQ ID NO.22: TACGCAGTTTCATGACCAGG; SEQ ID NO.23: GAGATCGAGCATTACCAGGTCG; SEQ ID NO.24: GGCTTTCCGGCGAGTATATGAC; SEQ ID NO.25: CGGGCGAAATGGATATCGTCG; SEQ ID NO.26: ATCAACCCAGCCAGCATCGGGACATGCCATGATTGATTTACGCAG; SEQ ID NO.27: CCGATGCTGGCTGGGTTGATATC; SEQ ID NO.28: GGCGACGTGGCGTTAAAAC; SEQ ID NO.29: TAATACTAGTGCGATGGAGATGAAAGCTGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAG; SEQ ID NO.30: CAGCTAGCTCAGTCCTAGGTATAATACTAGTGCGATGGAGATGAAAGCTGG; SEQ ID NO.31: GCGATGGAGATGAAAGCTGG; SEQ ID NO.32: CCACGGCATTAAAGATGCGC; SEQ ID NO.33: GCTTCACGTACCGTGATGACC。

[0047] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A genetically engineered Escherichia coli, characterized in that, The *E. coli* contains a recombinant plasmid, which includes the following genes: Aromatic amino acid aminotransferase gene, the nucleotide sequence of which is shown in SEQ ID NO.1; indole-3-pyruvate decarboxylase AXC29253.1 gene, the nucleotide sequence of which is shown in SEQ ID NO.2; indole-3-acetaldehyde dehydrogenase gene, the nucleotide sequence of which is shown in SEQ ID NO.

3. The pyruvate formate lyase gene was knocked out in the genome of the *E. coli*. pflB and pyruvate oxidase gene poxB Among them, the pyruvate formate lyase gene pflB The nucleotide sequence is shown in SEQ ID NO.6; pyruvate oxidase gene poxB The nucleotide sequence is shown in SEQ ID NO.

7.

2. The genetically engineered Escherichia coli according to claim 1, characterized in that, The Escherichia coli in question is Escherichia coli BL21.

3. The genetically engineered Escherichia coli according to claim 1, characterized in that, The vector backbone of the recombinant plasmid is pET28a-Blank plasmid.

4. The genetically engineered Escherichia coli according to claim 3, characterized in that, The expression of each gene in the recombinant plasmid is driven by a constitutive promoter; The promoter sequences of the aromatic amino acid aminotransferase gene and the indole-3-pyruvate decarboxylase AXC29253.1 gene are shown in SEQ ID NO.4, and the promoter sequence of the indole-3-acetaldehyde dehydrogenase gene is shown in SEQ ID NO.

5.

5. A method for constructing genetically engineered Escherichia coli as described in claim 1, characterized in that, Includes the following steps: (1) Construction of recombinant plasmid: SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 are ligated to the vector backbone to obtain recombinant plasmid, and the recombinant plasmid is transformed into Escherichia coli to obtain Escherichia coli containing recombinant plasmid; (2) Transform the pCas9 plasmid into Escherichia coli BL21 to obtain Escherichia coli containing the pCas9 plasmid; (3) Knockout of the E. coli genome containing the pCas9 plasmid obtained in step (2) pflB and poxB Eliminate the Target plasmid and pCas9 plasmid to obtain the knockout in the genome. pflB and poxB Escherichia coli; (4) Transform the recombinant plasmid obtained in step (1) into the genome obtained in step (3) to knock out the recombinant plasmid. pflB and poxB From Escherichia coli, the genetically engineered Escherichia coli of claim 1 is obtained.

6. A method for synthesizing indole-3-acetic acid using the genetically engineered *E. coli* according to any one of claims 1-4 or the genetically engineered *E. coli* constructed by the method described in claim 5, characterized in that... Includes the following steps: (1) The genetically engineered Escherichia coli was inoculated into TB medium containing tryptophan and glucose for fermentation culture; (2) Collect the fermentation products and detect and quantify indole-3-acetic acid.

7. The method according to claim 6, characterized in that, The amount of glucose added is 4 g / L; the amount of tryptophan added is 8 g / L.

8. The application of the genetically engineered Escherichia coli according to any one of claims 1-4 or the genetically engineered Escherichia coli constructed by the method of claim 5 in the microbial fermentation production of indole-3-acetic acid.

Images