Genetically engineered recombinant bacteria for biodegradation of nylon 6,6 and application thereof

Abstract

The application provides a genetically engineered recombinant bacteria for biodegradation of nylon 6,6, an expression vector, a degradation method and application. The recombinant bacteria takes Brevibacillus brevis as a host, expresses a codon-optimized manganese peroxidase gene driven by a medium-strength PaprE promoter, and fuses an endogenous CWP signal peptide and a (GGS)4 flexible linker to realize efficient secretory expression of MnP. After 30 days of fermentation of the recombinant bacteria, the weight loss rate of nylon 6,6 with a molecular weight of 40000 reaches 43.5%, which is 2.34 times that of a wild-type strain, and the melting point of nylon after degradation is reduced by 10.6-12.8 DEG C; meanwhile, the problem of ROS explosion and inclusion body accumulation caused by a strong promoter is effectively alleviated, and the proliferation of the bacteria and the secretion of the enzyme are balanced; the codon optimization, CWP signal peptide and linker synergistically enhance the secretion efficiency of MnP.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, specifically, it relates to a genetically engineered recombinant bacterium that degrades nylon 6,6 by biological means and its application. Background Technology

[0002] Nylon 6,6 (scientific name: polyhexamethylene adipamide) is widely used in textiles, automobiles, electronics, and packaging due to its excellent mechanical properties, abrasion resistance, and chemical corrosion resistance. The nylon 6,6 molecular chain is maintained by a dense crystalline structure and numerous intermolecular hydrogen bonds. The amide bonds are highly stable, making it extremely difficult to degrade in nature. The accumulation of nylon 6,6 waste has caused serious microplastic pollution. Traditional incineration and landfill treatments have drawbacks, including the generation of toxic gases, land occupation, and degradation cycles lasting decades to centuries. Therefore, developing a nylon 6,6 biodegradation technology with mild reaction conditions and environmental friendliness has significant environmental and economic value.

[0003] In the field of biodegradation of nylon 6,6, existing technologies mainly follow two technical routes, but both have insurmountable problems.

[0004] The first approach involves screening wild-type bacterial strains with nylon degradation activity from natural environments (such as activated sludge, compost, and nylon production wastewater). Some studies have reported this (see Neha Tiwari et al.'s "Biodegradation of micro-sized nylon 6,6 using..."). Brevibacillus brevis "A Soil Isolate for Cleaner Ecosystem", Journal of Cleaner Production, 2022, 134457, describes the use of short-lived Bacillus strains isolated from soil. Brevibacillus brevis Wild-type bacteria degraded nylon 6,6 microplastics, but even after 35 days of shake-flask culture, the weight loss of nylon 6,6 microplastics was only about 22%. The degradation of nylon by wild-type bacteria relies on endogenous enzymes encoded by their own genomes, mainly amidases and proteases, which are endogenous hydrolases that act on amide bonds. These enzymes break amide bonds through hydrolysis, primarily attacking low-molecular-weight oligomers or polymer chain ends, but have almost no direct cleavage ability on the alkyl backbone of high-molecular-weight nylon main chains. Therefore, wild-type strains generally suffer from insufficient degradation depth, long cycles, and low efficiency, making them unsuitable for industrial-scale processing.

[0005] The second approach utilizes oxidoreductase systems capable of non-specifically oxidizing and breaking down the carbon chain backbone of polymers. Among these, manganese peroxidase (MnP) secreted by white-rot fungi can produce highly oxidizing Mn... 3+Organic acid complexes have attracted attention for attacking and breaking C-C bonds and ether bonds in polymers. CN113897378A discloses the use of heterologous expression of MnP derived from white-rot fungi for the degradation of polyethylene films, demonstrating that MnP can etch and oxidize the C-C backbone of polyolefin plastics. However, this technical route still has the following prominent problems: Firstly, MnP, as an oxidase containing a heme cofactor and relying on disulfide bonds and metal-coordinated folding, readily forms inactive inclusion bodies in conventional heterologous expression systems (such as *E. coli*). Studies have shown (refer to Ángel De LaCruz Pech-Canul et al., "Functional Expression and One-Step Protein Purification of Manganese Peroxidase 1 (rMnP1) from...") Phanerochaete chrysosporium Using the E.coli -Expression System》, International Journal of Molecular Sciences, 2020, 21(2): 416), MnP is mostly expressed in the form of inclusion bodies in Escherichia coli, and requires tedious denaturation, renaturation and affinity purification to obtain active protein, resulting in high preparation cost and low activity recovery rate.

[0006] Secondly, in constructing recombinant engineered bacteria, existing technologies generally follow the technical bias of "the higher the expression intensity, the better the degradation effect," tending to use strong promoters to drive high-level expression of exogenous genes. However, high-level heterologous synthesis of MnP inevitably exacerbates the metabolic burden on host cells, especially creating fierce competition for resources in heme precursor synthesis, protein folding, and secretion pathways. In addition, the large-scale synthesis of complex-folding MnP by strong promoters in a short period of time is more likely to induce intracellular reactive oxygen species bursts and large accumulations of inclusion bodies, leading to inhibited host cell growth, sharp reduction in biomass, and ultimately a decrease in total enzyme activity and degradation efficiency per unit volume of fermentation broth. Current technologies lack a systematic optimization solution for the expression intensity of MnP in hosts such as Bacillus shortbreadenia to balance cell growth and enzyme protein secretion, thereby improving the overall degradation effect of high-molecular-weight nylon.

[0007] In summary, existing nylon 6,6 biodegradation technologies still suffer from problems such as low degradation efficiency of wild-type strains, easy formation of inclusion bodies and low activity recovery rate of MnP heterologous expression, and decline in overall degradation performance due to host metabolic burden caused by high-level expression of strong promoters. These issues hinder the practical application of nylon 6,6 waste biological treatment technologies. Summary of the Invention

[0008] The purpose of this invention is to overcome the problems of low degradation efficiency, poor heterologous expression activity, and heavy metabolic burden in existing nylon 6,6 biodegradation technologies, thereby providing a genetically engineered recombinant bacterium that efficiently secretes and expresses manganese peroxidase and has excellent comprehensive degradation performance, as well as its applications.

[0009] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a genetically engineered recombinant bacterium for the biological degradation of nylon 6,6, said recombinant bacterium being *Bacillus shorthair* (…). Brevibacillus brevis (The host is transferred into the expression box to obtain it;) The expression cassette includes, from the 5' end to the 3' end, the PaprE promoter, the CWP signal peptide coding sequence, and the manganese peroxidase MnP gene optimized with short Bacillus codons. The 3' end of the MnP gene is fused with a nucleotide sequence encoding the (GGS)4 flexible linker; The coding sequence of the MnP gene, which has been optimized with short Bacillus codons, is shown in SEQ ID NO:1; The coding sequence of the CWP signal peptide is shown in SEQ ID NO:2; The PaprE promoter was obtained from Bacillus subtilis strain AL009126.3 using primers shown in SEQ ID NO:14 and SEQ ID NO:15. Bacillus subtilis The promoter nucleotide sequence obtained by genomic DNA amplification.

[0010] According to a preferred embodiment of the present invention, the expression cassette is integrated into an expression vector with pNCMO2 plasmid as its backbone.

[0011] In a second aspect, the present invention provides an expression vector comprising, from the 5' end to the 3' end, a PaprE promoter, a CWP signal peptide coding sequence, and a manganese peroxidase MnP gene optimized with short Bacillus codons; The 3' end of the MnP gene is fused with a nucleotide sequence encoding the (GGS)4 flexible linker; The coding sequence of the MnP gene, which has been optimized with short Bacillus codons, is shown in SEQ ID NO:1; The coding sequence of the CWP signal peptide is shown in SEQ ID NO:2; The PaprE promoter was obtained from Bacillus subtilis strain AL009126.3 using primers shown in SEQ ID NO:14 and SEQ ID NO:15. Bacillus subtilis The promoter nucleotide sequence obtained by genomic DNA amplification.

[0012] A third aspect of the present invention provides a method for degrading nylon 6,6, comprising the following steps: S1. The genetically engineered recombinant bacteria described above are inoculated into a fermentation medium with nylon 6,6 as the sole carbon source. S2. The genetically engineered recombinant bacteria are fermented and cultured under aerobic conditions; S3. The genetically engineered bacteria express and secrete manganese peroxidase, thereby degrading the nylon 6,6.

[0013] According to a preferred embodiment of the present invention, the molecular weight of the nylon 6,6 is 10,000 to 40,000.

[0014] Preferably, the fermentation conditions in step S2 are 30°C, 120 rpm aerobic shaking culture, and the fermentation time is 25-35 days.

[0015] Furthermore, the degradation products of the nylon 6,6 include adipic acid derivatives and / or hexamethylenediamine derivatives.

[0016] Furthermore, the nylon 6,6 is a thin film with a thickness of 50 μm and a size of 5 mm × 5 mm.

[0017] Furthermore, the fermentation medium comprises: 6.65 g / L nylon 6, 0.02 g / L MgSO4, 0.02 g / L CaCl2, 0.15 g / L MnSO4, 0.1 g / L KH2PO4, 0.1 g / L K2HPO4, 0.1 g / L NH4Cl, 0.05 g / L FeCl3, and 0.1 g / L NaCl.

[0018] A fourth aspect of the present invention provides the application of the genetically engineered recombinant bacteria described above in the degradation of nylon 6,6.

[0019] The beneficial effects of this invention are as follows: 1. This invention employs a moderate-strength PaprE promoter to drive codon-optimized MnP gene expression in recombinant bacteria. B. brevis -PaprE fermentation for 30 days resulted in a weight loss rate of 43.5% for nylon 6,6 with a molecular weight of 40,000, which is 2.34 times that of the wild-type strain and higher than that of strong promoter strains and weak promoter strains, achieving efficient biodegradation of high molecular weight nylon 6,6.

[0020] 2. This invention effectively alleviates the problem of host cell ROS burst and large accumulation of inclusion bodies driven by strong promoters. The intracellular ROS fluorescence intensity and inclusion body content of the PaprE promoter strain are much lower than those of the strong promoter strain, and the maximum biomass of the strain is significantly better than that of the strong promoter strain, thus achieving synergistic optimization of cell proliferation and enzyme secretion.

[0021] 3. Through the synergistic combination of short Bacillus codon optimization, endogenous CWP signal peptide, and (GGS)4 flexible linker, the extracellular MnP enzyme activity reached 25.4 U / mL, while the intracellular inclusion body content was only 16.2 mg / L. The resolution control experiment showed that codon optimization or the absence of flexible linker led to a significant decrease in enzyme activity, while the absence of endogenous signal peptide or flexible linker led to a significant increase in inclusion body content, fully verifying the synergistic effect of the three. After degradation, the melting point of nylon 6,6 decreased by 10.6~12.8℃ and the relative viscosity decreased by 0.72~0.87, confirming the effective oxidative cleavage of the nylon backbone by MnP. Detailed Implementation

[0022] The present invention will be further described below with reference to specific embodiments. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0023] Unless otherwise specified, the experimental methods in the following embodiments are conventional methods, performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions.

[0024] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0025] Example 1, Recombinant bacteria B.brevis -P2、 B.brevis -P5 and B.brevis -PaprE Construction This embodiment uses Bacillus shortness of breath. (Brevibacillus brevis) The codons of the manganese peroxidase (MnP) gene were optimized, and three recombinant Bacillus shortbread strains were constructed, each driven by a different promoter (P2, P5, and PaprE).

[0026] 1.1 Optimization of the manganese peroxidase (MnP) gene According to Bacillus shortiformis (Brevibacillus brevis)The frequency table of high-frequency codons for secretory proteins was used to optimize the original coding gene of manganese peroxidase from white-rot fungi. The optimization was carried out according to the following rules without changing the amino acid sequence: (1) rare codons were replaced with high-frequency codons preferred by Bacillus simulans; (2) sequences homologous to the ribosome binding site (SD) and stem-loop secondary structures of the 5′ mRNA were eliminated to avoid translational repression at the transcriptional level; (3) the translation rate of the first 15 codons of the gene was weakened to avoid ribosome blockade and promote smooth translation elongation; (4) a nucleotide sequence encoding the (GGS)4 flexible linker optimized by the dedicated codons was fused to the 3′ end of the gene to improve the intracellular solubility and extracellular secretion efficiency of the protein.

[0027] The optimized MnP gene coding sequence, which incorporates the (GGS)4 flexible linker, is shown in SEQ ID NO:1. It was synthesized by Qingke Biotechnology Co., Ltd. and amplified using primers F1 and R1.

[0028] 1.2 Construction of expression vector and recombinant strain (1) Carrier linearization Using plasmid pNCMO2 (NovoPro ID: V017507) as the backbone vector, primers F2 and R2 were designed to perform reverse PCR on the vector, excising the original promoter and signal peptide coding sequences in the vector, and linearizing the circular expression plasmid.

[0029] (2) Amplification of promoter and signal peptide Using plasmid pNCMO2 as a template, promoter P2 was amplified by primers F3 and R3; The plasmid pNY326 (purchased from BioVector Plasmid Vector Strains Cell Protein Antibody Gene Preservation Center, catalog number: pNY326-BLA Bacillus brevis expression vector control plasmid) was used. Brevibacillus Using the expression plasmid as a template, the weak promoter P5 was amplified by primers F4 and R4; Bacillus subtilis ( Bacillus subtilis subsp Using the genomic DNA of *Subtilis subtilis* str. 168 (GenBank accession number: AL009126.3) as a template, the intermediate promoter PaprE was amplified by primers F5 and R5.

[0030] Using the genomic DNA of Bacillus brevis (product number: TS274519, purchased from Ningbo Taisto Biotechnology Co., Ltd.) as a template, the coding sequence of the endogenous CWP signal peptide of Bacillus brevis was amplified using primers F6 and R6. The signal peptide sequence is shown in SEQ ID NO:2.

[0031] (3) Three expression cassettes were constructed by fusion PCR. Following the sequence "promoter-signal peptide-MnP", the three fragments were fused using overlap extension PCR. When designing primers for each fragment amplification, the ligation sites of adjacent fragments were designed to have a 15-25 bp overlap sequence. Taking the construction of the fusion expression cassette P2-CWP-MnP as an example, the specific steps are as follows: First round of PCR: Using the promoter fragment P2, signal peptide fragment (CWP), and MnP gene fragment obtained in step (2) as templates, PCR amplification was performed using their respective upstream and downstream primers to obtain three fragments with overlapping ends. The PCR products were detected by 1% agarose gel electrophoresis and purified using a gel extraction kit.

[0032] Second-round PCR (fusion PCR): The promoter fragment, signal peptide fragment, and MnP fragment purified from the first-round PCR were mixed in equal molar ratios as a template. External primers (i.e., upstream primers for each promoter fragment and downstream primers for the MnP fragment) were added for PCR amplification. The amplified products were identified by 1% agarose gel electrophoresis, and the target band was recovered to obtain the fusion expression cassette P2-CWP-MnP.

[0033] By replacing the promoter fragment in the first round of PCR with P2 or PaprE, the fusion expression cassettes P5-CWP-MnP and PaprE-CWP-MnP can be obtained, respectively.

[0034] (4) Connection between expression box and carrier Following the instructions in the ClonExpress Ultra One Step Cloning Kit, the gene fragment obtained from fusion PCR was ligated into a circular form with a double-digested linearized vector fragment to obtain the recombinant product. The recombinant product was transformed into *E. coli* DH5α competent cells, and positive clones were screened using neomycin-resistant plates. Positive clones were selected for colony PCR and sequencing verification. After confirming the sequences were correct, they were named pNCMO2-P2 (sequence shown in SEQ ID NO:3), pNCMO2-P5 (sequence shown in SEQ ID NO:4), and pNCMO2-PaprE (sequence shown in SEQ ID NO:5), respectively.

[0035] (5) Plasmid transformation 50 μL of freshly prepared *Bacillus brevis* (product number: TS274519, purchased from Ningbo Taisto Biotechnology Co., Ltd.) was used for electroporation of competent cells. Plasmids pNCMO2-P2, pNCMO2-P5, and pNCMO2-PaprE were added for electroporation transformation, and the transformation medium was rapidly revived after electroporation. The revived bacterial culture was appropriately diluted and plated on neomycin-resistant plates, and incubated overnight at 37°C. Positive clones were selected as the successfully constructed recombinant bacterial strain. B. brevis -P2、 B. brevis -P5 and B. brevis -PaprE. The primer sequences used in Example 1 are shown in Table 1.

[0036] Table 1. Primer sequences used in Example 1

[0037] Example 2: Method for determining the enzyme activity of recombinant strains This embodiment establishes a method for determining the activity of MnP extracellular enzymes.

[0038] 2.1. Recombinant strains B. brevis -P2、 B. brevis -P5 and B. brevis -PaprE and the starting strain B. brevis (Product No.: TS274519, purchased from Ningbo Taisto Biotechnology Co., Ltd.) were inoculated into LB liquid medium (neomycin needs to be added to the LB liquid medium for culturing recombinant strains, but not for culturing the starting strains that have not undergone any genetic modification), and cultured at 30℃ and 120rpm with aerobic shaking for a total of 48h.

[0039] 2.2 Centrifuge and collect the fermentation supernatant.

[0040] 2.3 MnP enzyme activity assay: The reaction system contained 50 mM sodium malonate buffer (pH 4.5), 0.1 mM MnSO4, 0.5 mM H2O2, 1 mM 2,6-dimethoxyphenol, and 100 μL enzyme solution. The change in absorbance at 470 nm over 1 min was measured (εm). 470 =49,600 M - ¹cm - ¹). One enzyme activity unit (U) is defined as the amount of enzyme required to oxidize 1 μmol of substrate per minute.

[0041] Example 3: Experimental detection method for metabolic damage mechanism of strains by promoters of different strengths This embodiment reveals the differences in host metabolic damage caused by MnP expression driven by promoters of different strengths by detecting intracellular reactive oxygen species (ROS) levels and inclusion body protein content.

[0042] 3.1. The recombinant strain B. brevis -P2、 B. brevis -P5 and B. brevis -PaprE and the starting strain B. brevis (Product No.: TS274519, purchased from Ningbo Taisto Biotechnology Co., Ltd.) were inoculated into LB liquid medium (neomycin needs to be added to the LB liquid medium for culturing recombinant strains, but not for culturing the starting strains without any genetic modification), and cultured aerobically at 30℃ and 120rpm for a total of 48h.

[0043] 3.2 Centrifuge and collect the fermentation supernatant.

[0044] 3.3 Intracellular reactive oxygen species (ROS) level: The DCFH-DA fluorescent probe method was used to make the final concentration of the fluorescent probe DCFH-DA 10 μM. It was incubated at 30℃ in the dark for 30 min. The excitation wavelength of the microplate reader was 488 nm and the emission wavelength was 530 nm. The relative fluorescence unit (RFU) was read.

[0045] 3.4 Total intracellular inclusion body protein content: Insoluble precipitate was separated after bacterial cell lysis and quantified using a BCA kit (purchased from Beyotime Biotechnology Co., Ltd., catalog number P0011), unit mg / L.

[0046] Table 2. Experimental results of metabolic damage mechanisms of strains by promoters of different strengths.

[0047] Table 2 shows that the ROS fluorescence intensity (650 RFU) and inclusion body content (95.7 mg / L) of the *B. brevis*-P2 strain driven by the strong promoter P2 were significantly higher than those of other strains. This indicates that when the strong promoter drives the synthesis of large amounts of exogenous MnP in a short period of time, the disulfide bond and metal coordination folding system are severely overloaded, leading to an explosion of oxidative stress and a large accumulation of inclusion bodies. Notably, the intracellular inclusion body content of the strain with the moderate-strength PaprE promoter (16.2 mg / L) was lower than that of the strain with the weak promoter P5 (22.7 mg / L). This suggests that the protein synthesis rate driven by the PaprE promoter is more matched with the host's secretory folding capacity, resulting in smoother translation elongation and thus reduced misfolding and aggregation. While the P5 promoter has lower transcriptional strength, it may have caused abnormal folding of some peptide chains due to poor mRNA structure or translation initiation efficiency. These results indicate that a weaker promoter does not necessarily mean a lighter metabolic burden; the key lies in the compatibility between the promoter and the host's secretory system.

[0048] Example 4: Experiment on the degradation of nylon 6,6 by recombinant strains In this embodiment, nylon 6,6 with different molecular weights (40,000, 20,000, 10,000) was used as the sole carbon source to investigate the fermentation degradation ability of the starting strain and three recombinant strains. The degradation effect was comprehensively evaluated by weight loss rate, biomass, MnP enzyme activity and degradation products (adipic acid / hexamethylenediamine derivative).

[0049] The nylon 6,6 film used in this embodiment has the following specifications: a thickness of 50 μm and a size of 5 mm × 5 mm.

[0050] 4.1 Fermentation and degradation experiments of recombinant strains using nylon 6,6 (substrate A) with a molecular weight of 40,000 as a carbon source. (1) Preparation of fermentation medium: Nylon 6,6 (substrate A) with a molecular weight of 40,000 was used, 5 g / L, MgSO4 0.02 g / L, CaCl2 0.02 g / L, MnSO4 0.15 g / L, KH2PO4 0.1 g / L, K2HPO4 0.1 g / L, NH4Cl 0.1 g / L, FeCl3 0.05 g / L, NaCl 0.1 g / L, pH 7.0.

[0051] (2) Inoculation and fermentation: The recombinant strain was inoculated and fermented. B. brevis -P2、 B. brevis -P5 and B. brevis -PaprE and the starting strain B. brevis The seed culture was inoculated into 100 mL of the above fermentation medium at an inoculation rate of 5% (v / v) and cultured aerobically at 30°C and 120 rpm.

[0052] (3) Sampling and testing: Sampling and analysis were performed every 5 days for a total of 30 days of fermentation.

[0053] (4) Detection in degradation experiment 1) Biomass determination: Measure the OD of the fermentation broth. 600 value.

[0054] 2) Determination of weight loss rate of Nylon 6,6: Take out the Nylon 6,6 film, wash it 3 times with 70% ethanol, dry it overnight in a 50℃ oven until constant weight, and then load it to calculate the weight loss rate: Weight loss rate (%) = (initial weight - final weight) / initial weight × 100%.

[0055] 3) Degradation product analysis: HPLC analysis was used. After centrifuging the fermentation broth at 12,000 rpm, the supernatant was collected, filtered through a 0.22 μm filter membrane, and the sample was diluted with the mobile phase to a concentration within the range of the standard curve plotted with the standard. Adipic acid derivatives and hexamethylenediamine derivatives were detected separately.

[0056] Adipic acid derivative detection conditions: The chromatographic column was a Thermo Fisher C18 reversed-phase column (3 μm, 150 × 4.6 mm); the mobile phase was 0.1% formic acid aqueous solution: methanol = 60:40 (v / v), with isocratic elution; the column temperature was 30℃; the flow rate was 1.0 mL / min; the PDA diode array detector was used, with a detection wavelength of 210 nm; and the injection volume was 20 μL.

[0057] Hexamethylenediamine derivative detection conditions: The chromatographic column was a Thermo Fisher C18 reversed-phase column (3 μm, 150 × 4.6 mm); the mobile phase was acetonitrile: 0.1% formic acid aqueous solution = 20:80 (v / v), isocratic elution; the column temperature was 30℃; the flow rate was 1.0 mL / min; the PDA diode array detector was used, with a detection wavelength of 254 nm; and the injection volume was 20 μL.

[0058] Adipic acid standard curve: y = 202.54x - 14.245, R² = 0.9982; Hexamethylenediamine standard curve: y = 169.72x - 13.483, R² = 0.9973.

[0059] Table 3. Biomass, enzyme activity, and weight loss of nylon 6,6 (molecular weight 40,000) after 30 days of fermentation by different strains

[0060] Table 3 shows that after 30 days of fermentation using nylon 6,6 with a molecular weight of 40,000 as the sole carbon source, the moderate-intensity PaprE promoter strain... B. brevis The weight loss rate of PaprE reached 43.5%, which is 2.34 times that of the wild-type starting strain (18.6%) and about 27% higher than that of the strong promoter P2 strain (34.2%). Although the MnP enzyme activity of the strong promoter P2 strain (26.3 U / mL) was slightly higher than that of the PaprE strain (25.4 U / mL), its maximum cell biomass (OD) was significantly higher. 600 =1.32) was significantly lower than that of the PaprE strain (OD). 600=1.78), indicating that the high level of MnP synthesis driven by the strong promoter places an excessive metabolic burden on the host cell, severely inhibiting cell proliferation and resulting in a decrease in total enzyme activity and actual degradation efficiency per unit volume of fermentation broth. The weak promoter P5 strain, due to insufficient expression, showed an enzyme activity of only 10.1 U / mL and a weight loss rate of only 21.3%. These results indicate that the moderate-strength PaprE promoter can balance normal cell proliferation with efficient MnP secretion, resulting in the optimal overall degradation performance.

[0061] 4.2 Fermentation and degradation experiments of recombinant strains using nylon 6,6 (substrate B) with a molecular weight of 20,000 as a carbon source. Except that the molecular weight of nylon 6,6 in the fermentation medium is 20,000, the other contents are the same as in Example 4.1.

[0062] 4.3 Fermentation and degradation experiments of recombinant strains using nylon 6,6 (substrate C) with a molecular weight of 10,000 as a carbon source. Except that the molecular weight of nylon 6,6 in the fermentation medium is 10,000, the other contents are the same as in Example 4.1.

[0063] Table 4. Nylon 6,6-hydroxyl groups of different molecular weights B.brevis - Content (mg / L) of adipic acid and hexamethylenediamine derivatives in the fermentation broth of PaprE strain after 30 days of fermentation.

[0064] As shown in Table 4, as the molecular weight of nylon 6,6 decreases from 40,000 to 10,000, B. brevis The adipic acid derivative content in the PaprE fermentation broth increased from 42.7 mg / L to 128.5 mg / L, and the hexamethylenediamine derivative content increased from 31.5 mg / L to 94.2 mg / L. These results indicate that lower molecular weight nylon substrates possess greater segmental flexibility and accessibility, making them more readily absorbed by MnP-generated active Mn³. + - Organic acid complexes attack and break down, thus significantly increasing the release of degradation products.

[0065] Example 5: Thermal analysis of nylon 6,6 substrate after degradation by the strain This embodiment uses differential scanning calorimetry (DSC) and the Ubbelohde viscometer method to analyze the viscosity of the sample. B.brevis The melting point (Tm) and relative viscosity (Rv) of nylon 6,6 after degradation by the PaprE strain were measured to corroborate the degradation effect from the perspective of polymer chain breakage and molecular weight reduction.

[0066] 5.1 Determination of the melting point of degraded nylon 6,6 The melting point of degraded nylon 6,6 was determined by differential scanning calorimetry (DSC), and the specific operation was performed in accordance with GB / T1946,6.3-2009 standard.

[0067] Before testing, accurately weigh 5 mg of dried degraded nylon 6,6 sample, place it in a standard aluminum crucible and seal it, and use an empty crucible as a reference. High-purity nitrogen (≥99.999%) was purged throughout the test as a protective gas at a flow rate of 50 mL / min to prevent high-temperature oxidation of the sample.

[0068] The heating program was set as follows: First, the temperature was increased from room temperature to 280 °C at a rate of 10 °C / min and held for 3 min to eliminate thermal history; then, the temperature was decreased to room temperature at a rate of 10 °C / min, and the crystallization curve was recorded; finally, the temperature was increased to 280 °C a second time at a rate of 10 °C / min, and the melting curve of the second heating was recorded. The peak temperature of the endothermic melting peak in the second heating scan curve was taken as the melting point (Tm) of the degraded nylon 6,6.

[0069] 5.2 Determination of the relative viscosity of degraded nylon 6,6 (Ubbelohde viscometer method) The relative viscosity (Rv) of degraded nylon 6,6 was determined according to GB / T 12006.1-2009 using the Ubbelohde viscometer method. 96% concentrated sulfuric acid was used as the solvent. 0.5 g of dried degraded nylon 6,6 sample was accurately weighed and placed in a 50 mL volumetric flask. Approximately 30 mL of concentrated sulfuric acid was added, and the mixture was kept at a constant temperature below 60°C and shaken until completely dissolved. After cooling to 25°C, the solution was diluted to the mark with the same batch of solvent and shaken well. The Ubbelohde viscometer was vertically fixed in a 25.0°C constant temperature water bath. An appropriate amount of sample solution was injected into the viscometer, and the time (t) for the solution to flow through the upper and lower graduations was measured. The measurement was repeated three times, and the average value was taken, with a deviation not exceeding 0.2 seconds. The time (t0) for pure solvent to flow through the viscometer was measured using the same method. The relative viscosity was calculated using the formula Rv = t / t0.

[0070] Table 5. Nylon 6,6-hydroxyl groups of different molecular weights B.brevis - Changes in melting point and relative viscosity of PaprE strain after 30 days of fermentation

[0071] As shown in Table 5, B. brevisFollowing PaprE fermentation degradation, the melting points of nylon 6,6 with three different initial molecular weights decreased by 10.6℃, 11.7℃, and 12.8℃, respectively, while their relative viscosities decreased by 0.87, 0.82, and 0.72, respectively. The decrease in melting point reflects a reduction in the crystal regularity and crystal size of nylon 6,6, while the decrease in relative viscosity directly indicates a decrease in the polymer's viscosity-average molecular weight. Both factors jointly confirm that the nylon 6,6 polymer backbone underwent significant breakage under MnP-mediated oxidation. The degree of degradation became more pronounced with decreasing initial molecular weight of nylon 6,6, a trend consistent with the changes in degradation product content shown in Table 4.

[0072] Example 6: Resection control experiment to verify the synergistic effect of codon optimization, CWP signal peptide, and (GGS)4 flexible linker. In this embodiment, under the premise of uniformly using the moderate strength PaprE promoter, multiple control engineered bacteria were constructed by systematically dissecting and replacing the MnP gene (wild-type / optimized), signal peptide (plasmid original signal peptide / endogenous CWP), and (GGS)4 flexible linker (present / absent) to verify the synergistic effect of codon optimization, endogenous CWP signal peptide, and (GGS)4 flexible linker in enhancing MnP secretion expression and nylon 6,6 degradation.

[0073] 6.1 Vector and Promoter Following the construction method of Example 1, the medium-strength PaprE promoter was used uniformly, and only the MnP gene, signal peptide, and whether or not the fusion (GGS)4 flexible linker were replaced; the operation procedures for the vector backbone (pNCMO2 shuttle plasmid), neomycin resistance marker, homologous recombinase system, and electroporation competent cells were consistent with those of Example 1.

[0074] 6.2 Gene Fragments and Amplification Primers (1) Original wild-type MnP gene: The original MnP coding sequence of white-rot fungus (CGMCC No. 41170) without short Bacillus codon optimization, and the amplification primers are as follows: F7: CGTTTGCGGCGGTGTGCCCGGA (its sequence is shown in SEQ ID NO:18); R7: CGCCGGGCCGTTAAACT (its sequence is shown in SEQ ID NO:19).

[0075] (2) The specific coding sequences of the codon-optimized MnP gene (3′ end fused with (GGS)4 flexible linker) and the endogenous CWP signal peptide are shown in Example 1.

[0076] 6.3 Construction of control engineered bacteria The vector construction process was exactly the same as in Example 1: fragment amplification → overlap extension fusion PCR to obtain the complete expression cassette → homologous recombination ligation to linearize the pNCMO2 vector → transformation into DH5α competent cells → colony PCR and sequencing verification of positive clones → extraction of recombinant plasmids and electroporation transformation into Bacillus shortness of breath → screening for positive single clones on neomycin-resistant plates. After antibiotic selection and sequencing verification of sequence correctness, the following 5 groups of strains were obtained, with the following differences in plasmid modification: (1) Control engineered bacteria 1: pNCMO2-PaprE-CWP-wild MnP (without linker); (2) Control engineered bacteria 2: pNCMO2-PaprE-CWP-optimized MnP (without linker); (3) Control engineered bacteria 3: pNCMO2-PaprE-plasmid original signal peptide-optimized MnP-(GGS)4Linker; (4) Control engineered bacteria 4: pNCMO2-PaprE-CWP-wild MnP-(GGS)4Linker; (5) Experimental engineered bacteria (i.e., the strains constructed in Example 1) B. brevis -PaprE strain): pNCMO2-PaprE-CWP-optimized MnP-(GGS)4Linker.

[0077] 6.4 Fermentation Culture and Sample Detection (1) Preparation of culture medium: Nylon 6 with a molecular weight of 40,000, 65 g / L, and other components are the same as in Example 4.1.

[0078] (2) Inoculation and fermentation: The seed liquids of each control engineered bacteria and the experimental engineered bacteria were inoculated into the above culture medium at an inoculation rate of 5% (v / v) and cultured aerobically at 30℃ and 120 rpm.

[0079] (3) Sampling and testing: Sampling and analysis were performed every 5 days for a total of 30 days of fermentation.

[0080] (4) MnP enzyme activity (U / L): The detection method is the same as in Example 2; one enzyme activity unit (U) is defined as the amount of enzyme required to oxidize 1 μmol of substrate per minute.

[0081] (5) Intracellular inclusion body content (mg / L): Insoluble precipitate was separated after bacterial cell lysis and quantified using a BCA kit, in mg / L.

[0082] (6) Nylon 6,6 weight loss rate (%): Take out the nylon 6,6 film, wash it 3 times with 70% ethanol, dry it overnight in a 50℃ oven until constant weight and weigh it, calculate the weight loss rate: weight loss rate (%) = (initial weight - final weight) / initial weight × 100%.

[0083] Table 6. Results of the multi-group split-control experiment

[0084] As shown in Table 6, under the premise of uniformly using the PaprE promoter, only when the codon-optimized MnP gene, the endogenous CWP signal peptide, and the (GGS)4 flexible linker are all present (experimental engineered bacteria) did the recombinant bacteria exhibit the highest extracellular MnP enzyme activity (25.6 U / mL) and the highest nylon 6,6 weight loss rate (42.8%). In addition, the intracellular inclusion body content remained at a low level (16.2 mg / L, which is comparable to the inclusion body content of the control engineered bacteria 4, but the enzyme activity is much higher than the latter). Specifically, the absence of codon optimization (control engineered bacteria 4) reduced enzyme activity to 13.4 U / mL and weight loss to 23.5%; the absence of the (GGS)4 flexible linker (control engineered bacteria 2) increased inclusion body content to 51.8 mg / L and reduced weight loss to 28.7%; and replacing the endogenous CWP signal peptide with the plasmid-derived signal peptide (control engineered bacteria 3) caused inclusion body content to surge to 95.3 mg / L, indicating poor compatibility between the exogenous signal peptide and the Bacillus brevis secretion pathway, leading to the misfolding and aggregation of a large number of proteins within the cell. These results fully demonstrate the synergistic effect of codon optimization, the endogenous CWP signal peptide, and the (GGS)4 flexible linker; the absence of any single element significantly weakens the secretory expression efficiency and substrate degradation capacity of MnP.

[0085] The above description is only a partial embodiment of the present invention and is not intended to limit the scope of the present invention. Various changes can be made to the above embodiments of the present invention. All simple and equivalent changes and modifications made based on the description of the present invention fall within the protection scope of the present invention. All aspects not described in detail in this invention are conventional technical content.

Claims

1. A genetically engineered recombinant bacterium for biological degradation of nylon 6,6, characterized in that, The recombinant bacteria is Bacillus shortiflorus (Bacillus brevis) Brevibacillus brevis (The host is transferred into the expression box to obtain it;) The expression cassette includes, from the 5' end to the 3' end, the PaprE promoter, the CWP signal peptide coding sequence, and the manganese peroxidase MnP gene optimized with short Bacillus codons. The 3' end of the MnP gene is fused with a nucleotide sequence encoding the (GGS)4 flexible linker; The coding sequence of the MnP gene, which has been optimized with short Bacillus codons, is shown in SEQ ID NO:1; The coding sequence of the CWP signal peptide is shown in SEQ ID NO:2; The PaprE promoter was obtained from Bacillus subtilis strain AL009126.3 using primers shown in SEQ ID NO:14 and SEQ ID NO:

15. Bacillus subtilis The promoter nucleotide sequence obtained by genomic DNA amplification.

2. The recombinant bacterial strain according to claim 1, characterized in that, The expression cassette is integrated into an expression vector with pNCMO2 plasmid as its backbone.

3. An expression carrier, characterized in that, The expression vector includes, from the 5' end to the 3' end, the PaprE promoter, the CWP signal peptide coding sequence, and the manganese peroxidase MnP gene optimized with short Bacillus codons. The 3' end of the MnP gene is fused with a nucleotide sequence encoding the (GGS)4 flexible linker; The coding sequence of the MnP gene, which has been optimized with short Bacillus codons, is shown in SEQ ID NO:1; The coding sequence of the CWP signal peptide is shown in SEQ ID NO:2; The PaprE promoter was obtained from Bacillus subtilis strain AL009126.3 using primers shown in SEQ ID NO:14 and SEQ ID NO:

15. Bacillus subtilis The promoter nucleotide sequence obtained by genomic DNA amplification.

4. A method for degrading nylon 6,6, characterized in that, Includes the following steps: S1. The genetically engineered recombinant bacteria of claim 1 are inoculated into a fermentation medium with nylon 6,6 as the sole carbon source; S2. The genetically engineered recombinant bacteria are fermented and cultured under aerobic conditions; S3. The genetically engineered bacteria express and secrete manganese peroxidase, thereby degrading the nylon 6,6.

5. The method according to claim 4, characterized in that, The molecular weight of the nylon 6,6 is 10,000 to 40,000.

6. The method according to claim 4, characterized in that, The fermentation conditions described in step S2 are 30℃, 120rpm aerobic shaking culture, and a fermentation time of 25~35 days.

7. The method according to claim 4, characterized in that, The degradation products of the nylon 6,6 include adipic acid derivatives and / or hexamethylenediamine derivatives.

8. The method according to claim 4, characterized in that, The nylon 6,6 is a thin film with a thickness of 50 μm and a size of 5 mm × 5 mm.

9. The method according to claim 4, characterized in that, The fermentation medium contains: 6.65 g / L nylon 6, 0.02 g / L MgSO4, 0.02 g / L CaCl2, 0.15 g / L MnSO4, 0.1 g / L KH2PO4, 0.1 g / L K2HPO4, 0.1 g / L NH4Cl, 0.05 g / L FeCl3, and 0.1 g / L NaCl.

10. The use of the genetically engineered recombinant bacteria according to claim 1 or 2 in the degradation of nylon 6,6.

Images