luciferase immunoassay

Abstract

The present invention relates to a luciferase immunoassay. In particular, the present invention relates to a fusion protein comprising: - an N-terminal domain comprising a variable domain of a camelid heavy chain antibody (VHH) or a single chain variable fragment (scFV) and directed against an antibody of the immunoglobulin; and - a C-terminal domain comprising a polypeptide having luciferase activity: - having the amino acid sequence SEQ ID NO: 1 or - having an amino acid sequence identity of at least 80% with the amino acid sequence SEQ ID NO: 1.

Description

[0001] This application is a divisional application of Chinese patent application No. 202180030858.0, filed on April 26, 2021, entitled "Luciferin Enzyme-Linked Immunosorbent Assay". Technical Field

[0002] The present invention relates to a method for detecting immunoglobulins in a sample, a fusion protein for the method, and a mutant luciferase with improved properties that can be used particularly in the method. Background Technology

[0003] To test for evidence of past or present adaptive immune responses to infection in subjects, serological assays against infectious agents or allergens must be performed using rapid diagnostic tests or laboratory-based immunoassays.

[0004] A wide range of serological tests are available on the market. For example, laboratory-based immunoassays can be enzyme immunoassays (EIA), radioimmunoassays (RIA), fluorescence immunoassays (FIA), chemiluminescence immunoassays (CLIA), or electroluminescence assays (ECL).

[0005] However, whatever protocol is used for serological testing, it must meet safety, quality, and performance standards (regarding analytical and clinical sensitivity and specificity).

[0006] Most standard serological tests on the market for detecting and / or quantifying immunoglobulins indicating past or present infection are sensitive, but they require relatively large amounts of plasma (which can be problematic when testing young children) and are also limited by cost and the need for specific instruments to analyze the test results. Therefore, further development is needed to improve the sensitivity of serological tests while significantly reducing the required sample volume and cost, without sacrificing the robustness, reproducibility, and accuracy of the assay. Summary of the Invention

[0007] The applicant has now discovered that by combining the variable domain of the camel heavy chain antibody (VHH) with a derivative derived from... Oplophorus gracilirostris The luciferase fusion of the luciferase catalytic domain allows for reduced sample volume while maintaining the required specificity and sensitivity, increased dynamic range, and shorter assay time in the detection of specific immunoglobulins. The serological assay design of this application can be used for rapid diagnostic testing. Therefore, assays specific for detecting and / or quantifying immunoglobulins of interest in any infectious disease, as well as allergies or autoimmune diseases, can be designed.

[0008] Therefore, one subject of the present invention is a fusion protein comprising: - N-terminal domain, which contains variable domains or single-chain variable fragments (scFVs) as heavy chain antibodies against camel protein (VHH) and other antibodies. and - C-terminal domain, which contains a polypeptide with luciferase activity: - Having the amino acid sequence SEQ ID NO: 1 or - It has at least 80% amino acid sequence identity with the amino acid sequence SEQ ID NO: 1.

[0009] The applicant also found that using a specific mutant of NanoKAZ luciferase resulted in increasingly improved serological test results.

[0010] Therefore, the present invention also relates to a luciferase having at least 80% amino acid sequence identity with the amino acid sequence SEQ ID NO: 1 and comprising at least one amino acid substitution selected from: - Replace the tyrosine (Y) at position 18 of SEQ ID NO: 1 with arginine (R). - Replace the leucine (L) at position 48 of SEQ ID NO: 1 with lysine (K). - Replace the isoleucine (I) at position 56 of SEQ ID NO: 1 with alanine (A). - Replace the tyrosine (Y) at position 116 of SEQ ID NO: 1 with phenylalanine (F). - Replace the tryptophan (W) at position 134 of SEQ ID NO: 1 with an amino acid selected from threonine (T) and glutamic acid (E). - Replace the tryptophan (W) at position 163 of SEQ ID NO: 1 with an amino acid selected from threonine (T) and glutamic acid (E). and - Replace cysteine ​​(C) at position 166 of SEQ ID NO: 1 with serine (S). Attached Figure Description

[0011] Figure 1 This is a cartoon representation of an anti-IgE nanobody-luciferase tandem (sdAb026-nanoKAZ) that binds to the Fc region of IgE.

[0012] Figure 2The dilution series of recombinant IgE, IgG1, or IgG4 in PBS for the house dust mite allergen Der p 2 are shown using IgE LuLISA analysis. RLU: Relative light units.

[0013] Figure 3 The dilution series of recombinant human anti-ovalbumin (OVA) IgE in PBS are shown using IgE LuLISA analysis.

[0014] Figure 4 The sensitivity of comparing IgE LuLISA and IgE ELISA using recombinant anti-ovalbumin (OVA) IgE is shown.

[0015] Figure 5 The dynamic range and sensitivity of IgE LuLISA compared to standard ImmunoCAP are shown using recombinant OVA sIgE.

[0016] Figure 6 The dynamic range and sensitivity of IgE LuLISA compared to standard ImmunoCAP were shown using plasma samples from subjects with severe peanut allergy.

[0017] Figure 7 The effect of the concentration of the anti-IgE nanobody-luciferase fusion protein on the bioluminescent detection of IgE by LuLISA is shown. The gray area shows the values ​​obtained at the same sdAb026-nanoKAZ concentration used in all other experiments in this study.

[0018] Figure 8 This study demonstrates the detection of peanut sIgE using a LuLISA sequence of plasma dilutions from six peanut-allergic subjects. The plasma was diluted to a specified concentration in PBS and incubated with peanut extract bound to the plate. Bioluminescent detection of peanut sIgE levels was performed using LuLISA. Arrows indicate… Figure 9 The plasma dilutions used are shown. The gray area indicates the linear range of the peanut sIgE LuLISA assay.

[0019] Figure 9 The study showed the measurement of sIgE against total peanut extract using 1 µL of plasma from healthy donors and peanut-allergic subjects.

[0020] Figure 10 The study showed the measurement of sIgE against peanut allergen Arah 1 using 1 µL of plasma from healthy donors and peanut-allergic subjects.

[0021] Figure 11 The study showed the measurement of sIgE against peanut allergen Arah 2 using 1 µL of plasma from healthy donors and peanut-allergic subjects.

[0022] Figure 12 A comparison between LuLISA and ImmunoCAP for peanut sIgE in allergy patients is shown.

[0023] Figure 13 A comparison between LuLISA and ImmunoCAP for Arah 1 sIgE in allergic patients is shown.

[0024] Figure 14 A comparison between LuLISA and ImmunoCAP for Arah 2 sIgE in allergic patients is shown.

[0025] Figure 15 The results show the correlation between IgE LuLISA on the test strip (A), IgE LuLISA on the test strip and ImmunoCAP (B), and IgE LuLISA on the test strip and the plate (C).

[0026] Figure 16 The LuLISA whisker plot (whiskers, minimum, maximum; bins: second and third quartiles, separated by the median) shows the SARS-CoV2 protein N-specific IgG.

[0027] Figure 17 The image shows a whisker pattern of LuLISA for SARS-CoV2 protein S-specific IgG.

[0028] Figure 18 The correlation between titrations of SARS-CoV2 protein N-specific IgG and SARS-CoV2 protein S-specific IgG in sera from APHP-Cochin (n=20) and EFS (n=4) was shown.

[0029] Figure 19 The correlation between titrations of SARS-CoV1 protein N-specific IgG and SARS-CoV2 protein N-specific IgG in serum from APHP-Cochin (n=20) and EFS (n=4) was shown.

[0030] Figure 20 The correlation between the titration of SARS-CoV1 protein S-specific IgG and SARS-CoV2 protein S-specific IgG in serum from APHP-Cochin (n=20) and EFS (n=4) was shown.

[0031] Figure 21The correlation between the titration of SARS-CoV2 protein N-specific IgG in the rapid test (5 min) and the routine test (120 min) is shown, and the average of two replicate values ​​is given.

[0032] Figure 22 This is a schematic diagram of three embodiments of the method of the present invention (the antigen is fixed on the support by adsorption, covalent bond, and non-covalent bond). Detailed Implementation

[0033] luciferase mutant As used in this article, "luciferase" refers to a class of oxidases that produce bioluminescence. Bioluminescence is the emission of light produced in biochemical reactions involving the oxidation of substrates by enzymes.

[0034] Luciferases are typically found in lower organisms such as bacteria, fungi, insects, dinoflagellates, radiolarians, cnidarians, crustaceans, jellyfish, and cephalopods. Among these different luciferases, those from deep-sea shrimp are particularly abundant. Oplophorus The luciferase exhibits promising properties (Shimomura O, Masugi T, Johnson FH, Haneda Y., Properties and reaction mechanism of the bioluminescence system of the deep-sea shrimp). Oplophorus gracilirostris Biochemistry. March 21, 1978; 17(6): 994-8. However, the 19 kDa subunit (KAZ) with luciferase activity in this heterodimeric structure does not retain many of the desired characteristics of the native enzyme because it is unstable and poorly expressed without the regulatory subunit. The activity against the native substrate coelenterate has been increased sevenfold by replacing V44I, A54I and Y138I in the KAZ sequence with three amino acids (eKAZ) (Inouye S, Sato J, Sahara-Miura Y, Yoshida S, Hosoya T. Luminescence enhancement of the catalytic 19 kDa protein (KAZ) of Oplophorus luciferase by three amino acid substitutions. Biochem Biophys Res Commun. 2014; 445(1): 157-162.).

[0035] The enzyme folding has been optimized by mutating the following protein surface hydrophobic amino acids to hydrophilic residues: A4E, F68D, L72Q, M75K, P115E, and / or N166R.

[0036] Then, Hall et al. designed a method derived from Oplophorus Luciferases with improved stability, specifically the 19 kDa subunit, are called nanoLuc, NLuc, and nanoKAZ, and contain the following mutations: A4E, Q11R, Q18L, L27V, A33N, K43R, V44I, A54I, F68D, L72Q, M75K, I90V, P115E, Q124K, Y138I, and N166R (HallMP, Unch J, Binkowski BF, Valley MP, Butler BL, Wood MG, Otto P, Zimmerman K, Vidugiris G, Machleidt T, Robers MB, Benink HA, Eggers CT, Slater MR, Meisenheimer PL, Klaubert DH, Fan F, Encell LP, and Wood KV. An engineered luciferase reporter from a deep-sea shrimp utilizing a novelimidazopyrazinone substrate. ACS Chem Biol. 16 November 2012; 7(11): 1848-57.

[0037] However, the properties of nanoKAZ luciferase still need improvement.

[0038] The applicant has now discovered, particularly for the newly patented substrate, that certain mutants of nanoKAZ have improved solubility and / or catalytic activity and / or photon emission per mole of catalytic substrate compared to nanoKAZ (WO2018 / 197727, Coutant et al., 2019, 2020).

[0039] Therefore, the present invention relates to a luciferase having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% amino acid sequence identity with the amino acid sequence SEQ ID NO: 1 and comprising at least one amino acid substitution selected from: - Replace the tyrosine (Y) at position 18 of SEQ ID NO: 1 with arginine (R). - Replace the leucine (L) at position 48 of SEQ ID NO: 1 with lysine (K). - Replace the isoleucine (I) at position 56 of SEQ ID NO: 1 with alanine (A). - Replace the tyrosine (Y) at position 116 of SEQ ID NO: 1 with phenylalanine (F). - Replace the tryptophan (W) at position 134 of SEQ ID NO: 1 with an amino acid selected from threonine (T) and glutamic acid (E). - Replace the tryptophan (W) at position 163 of SEQ ID NO: 1 with an amino acid selected from threonine (T) and glutamic acid (E). and - Replace cysteine ​​(C) at position 166 of SEQ ID NO: 1 with serine (S).

[0040] For the purpose of comparing two closely related polynucleotide or polypeptide sequences, an alignment program (such as BLAST®, available at blast.ncbi.nlm.nih.gov, last accessed March 9, 2015) can be used with standard settings to calculate the “identity %” between a first and second sequence. The identity % is the number of identical residues divided by the number of residues in the reference sequence and multiplied by 100. The identity % figures mentioned above and in the claims are percentages calculated by this method. An alternative definition of identity % is the number of identical residues divided by the number of aligned residues and multiplied by 100. Alternative methods include using a gapped method, where gaps in the alignment, such as deletions of one sequence relative to another, are considered in the gap score or gap cost in the scoring parameters. For more information, see the BLAST® Factsheet, available at ftp.ncbi.nlm.nih.gov / pub / factsheets / HowTo_BLASTGuide.pdf, last accessed March 9, 2015.

[0041] Luciferase may contain at least one, at least two, at least three, at least four, at least five, at least six, or at least seven, or one, two, three, four, five, six, or seven, amino acid substitutions selected from the following: - Replace the tyrosine (Y) at position 18 of SEQ ID NO: 1 with arginine (R). - Replace the leucine (L) at position 48 of SEQ ID NO: 1 with lysine (K). - Replace the isoleucine (I) at position 56 of SEQ ID NO: 1 with alanine (A). - Replace the tyrosine (Y) at position 116 of SEQ ID NO: 1 with phenylalanine (F). - Replace the tryptophan (W) at position 134 of SEQ ID NO: 1 with an amino acid selected from threonine (T) and glutamic acid (E). - Replace the tryptophan (W) at position 163 of SEQ ID NO: 1 with an amino acid selected from threonine (T) and glutamic acid (E). and - Replace cysteine ​​(C) at position 166 of SEQ ID NO: 1 with serine (S).

[0042] In one embodiment, tryptophan (W) at position 134 of SEQ ID NO: 1 is replaced with threonine (T). In an alternative embodiment, tryptophan (W) at position 134 of SEQ ID NO: 1 is replaced with glutamic acid (E).

[0043] In one embodiment, tryptophan (W) at position 163 of SEQ ID NO: 1 is replaced with threonine (T). In an alternative embodiment, tryptophan (W) at position 163 of SEQ ID NO: 1 is replaced with glutamic acid (E).

[0044] In one embodiment, the tyrosine (Y) at position 116 of SEQ ID NO: 1 is replaced with phenylalanine (F).

[0045] In one embodiment, tryptophan (W) at position 134 of SEQ ID NO: 1 is replaced with threonine (T).

[0046] In one embodiment, tryptophan (W) at position 163 of SEQ ID NO: 1 is replaced with threonine (T).

[0047] In one embodiment, isoleucine (I) at position 56 of SEQ ID NO: 1 is replaced with alanine (A).

[0048] In one embodiment, tyrosine (Y) at position 116 of SEQ ID NO: 1 is replaced with phenylalanine (F), and tryptophan (W) at position 134 of SEQ ID NO: 1 is replaced with threonine (T).

[0049] In one embodiment, tyrosine (Y) at position 116 of SEQ ID NO: 1 is replaced with phenylalanine (F), and cysteine ​​(C) at position 166 of SEQ ID NO: 1 is replaced with serine (S).

[0050] In one embodiment, tyrosine (Y) at position 18 of SEQ ID NO: 1 is replaced with arginine (R), leucine (L) at position 48 of SEQ ID NO: 1 is replaced with lysine (K), tryptophan (W) at position 134 of SEQ ID NO: 1 is replaced with glutamic acid (E), and tryptophan (W) at position 163 of SEQ ID NO: 1 is replaced with glutamic acid (E).

[0051] In one embodiment, tyrosine (Y) at position 18 of SEQ ID NO: 1 is replaced with arginine (R), leucine (L) at position 48 of SEQ ID NO: 1 is replaced with lysine (K), tryptophan (W) at position 134 of SEQ ID NO: 1 is replaced with glutamic acid (E), tryptophan (W) at position 163 of SEQ ID NO: 1 is replaced with glutamic acid (E), and cysteine ​​(C) at position 166 of SEQ ID NO: 1 is replaced with serine (S).

[0052] In one embodiment, tyrosine (Y) at position 18 of SEQ ID NO: 1 is replaced with arginine (R), leucine (L) at position 48 of SEQ ID NO: 1 is replaced with lysine (K), tyrosine (Y) at position 116 of SEQ ID NO: 1 is replaced with phenylalanine (F), tryptophan (W) at position 134 of SEQ ID NO: 1 is replaced with glutamic acid (E), and tryptophan (W) at position 163 of SEQ ID NO: 1 is replaced with glutamic acid (E).

[0053] In one embodiment, tyrosine (Y) at position 18 of SEQ ID NO: 1 is replaced with arginine (R), leucine (L) at position 48 of SEQ ID NO: 1 is replaced with lysine (K), tyrosine (Y) at position 116 of SEQ ID NO: 1 is replaced with phenylalanine (F), tryptophan (W) at position 134 of SEQ ID NO: 1 is replaced with glutamic acid (E), tryptophan (W) at position 163 of SEQ ID NO: 1 is replaced with glutamic acid (E), and cysteine ​​(C) at position 166 of SEQ ID NO: 1 is replaced with serine (S).

[0054] The present invention also relates to a luciferase having an amino acid sequence selected from the following: SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, and SEQ ID NO: 17.

[0055] The amino acid sequences of various luciferases are disclosed in Table 1 below.

[0056] Table 1 Preferably, the luciferase has the amino acid sequences SEQ ID NO: 1 to SEQ ID NO: 11, more preferably SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10 or SEQ ID NO: 11. Most preferably, the luciferase has the amino acid sequences SEQ ID NO: 8, SEQ ID NO: 11 or SEQ ID NO: 6.

[0057] The present invention also relates to polypeptides having luciferase activity, comprising two or three amino acid sequences selected from the following: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, and SEQ ID NO: 17.

[0058] Such polypeptides may have amino acid sequences selected from the following: SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 and SEQ ID NO: 45.

[0059] The present invention also relates to a polypeptide having luciferase activity, having an amino acid sequence SEQ ID NO: 46.

[0060] Table 2 The luciferase of the present invention may have one or more heterologous amino acid sequences at the N-terminus, C-terminus, or both, which optionally interact directly or indirectly with the molecule of interest. The heterologous sequence may be a tag, such as a tag for purification purposes or a peptide or protein of interest. The luciferase may also be linked to an organic molecule, such as an organic molecule binder.

[0061] Affinity tags can be used at the C-terminus of luciferase amino acid sequences for purification, as secondary binding probes, in binding beads, and for binding solid substrates. Examples of amino acid sequences for such tags are given in Table 3 below.

[0062] Table 3 The peptides or proteins of interest may be selected from: variable domains (VHH), single-chain variable fragments (scFv), heavy chain variable regions (VH) of camel heavy chain antibodies, immunoglobulins (Ig), interleukins, cytokines, chemokines, receptor extracellular domains, peptide antigens, peptide allergens, receptor extracellular domains, viral capsid peptide fragments, bacterial surface peptide fragments, and cell surface peptide fragments, but are not limited to these.

[0063] The linker can be inserted between the amino and carboxyl luciferases of the peptide of interest (e.g., VHH, scFv, VH, Ig, but not limited to these) or an organic molecule binder to connect the two domains. The linker can have 0 to 10 residues.

[0064] In one implementation, the amino-terminal and carboxyl-terminal luciferase amino acid sequences of the peptide or organic molecule of interest used to connect the two domains can be directly linked without using a linker.

[0065] The amino acid sequence of the linker is disclosed in Table 4 below.

[0066] Table 4. Amino acid sequence of the linker When required or necessary for detection or measurement purposes, a linker is inserted between an amino-terminal protein-binding domain (VHH, scFv, VH, Ig, but not limited to these), an organic molecular binding agent, or a peptide sequence of interest, and a carboxyl-terminal luciferase to connect the two domains. This linker has a protease-specific cleavage site for the purpose of releasing luciferase. The amino acid sequences of such thrombin-specific cleavable linkers are shown below, having 5 to 14 residues. Thrombin cleavage sites are disclosed in Table 5 below.

[0067] Table 5. Thrombin cleavage sites In particular, the present invention also relates to fusion proteins comprising the luciferase of the present invention. The luciferase can be linked to a peptide of interest.

[0068] As mentioned above, the peptides of interest can be selected from: variable domains (VHH) of camel heavy chain antibodies, single-chain variable fragments (scFv), heavy chain variable regions (VH), immunoglobulins (Ig), interleukins, cytokines, chemokines, receptor extracellular domains, peptide antigens, peptide allergens, receptor extracellular domains, viral capsid peptide fragments, bacterial surface peptide fragments, and cell surface peptide fragments, but are not limited thereto.

[0069] Suitablely, the luciferase or fusion protein containing the luciferase of the present invention is recombinant. Recombinant means that the luciferase or fusion protein is a product of at least one of the following: a mutation or cloning step, or the production of a luciferase different from those found in nature (particularly those found in nature). Oplophorus Other procedures (different from luciferase).

[0070] The present invention also relates to polynucleotides encoding the luciferase of the present invention or fusion proteins comprising the luciferase of the present invention.

[0071] Suitablely, the polynucleotides of the present invention are recombinant. As described above, recombinant means that the polynucleotide is the product of at least one of the following: cloning, restriction or ligation steps, or other procedures that produce a polynucleotide different from those found in nature.

[0072] The polynucleotide can further encode a polypeptide of interest linked to a luciferase, wherein the polypeptide of interest and the luciferase can be expressed as a fusion protein.

[0073] Advantageously, the polynucleotide can be codon-optimized to express the luciferase of the present invention or a fusion protein containing the luciferase in a host cell.

[0074] The polynucleotide of interest may comprise nucleotide sequences selected from the following: SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 60, SEQ ID NO: 61, and SEQ ID NO: 62. These nucleotide sequences of the optimized polynucleotide expression embodiments are summarized in Table 6 below.

[0075] Table 6 The present invention also relates to a vector comprising the polynucleotides of the present invention.

[0076] As used herein, a vector (or plasmid) is a segregating element used to introduce heterologous DNA into a cell for expression or replication. The selection and use of such vectors are well known to those skilled in the art. Expression vectors include vectors capable of expressing DNA operatively linked to regulatory sequences (such as promoters) that can influence the expression of such DNA fragments. Therefore, an expression vector refers to a recombinant DNA construct, such as a plasmid, bacteriophage, recombinant virus, or other vector, which, upon introduction into a suitable host cell, induces the expression of the cloned DNA. Suitable expression vectors are well known to those skilled in the art.

[0077] A recombinant vector is a vector that contains recombinant polynucleotides.

[0078] Advantageously, the vector contains a polynucleotide operably linked to a promoter.

[0079] As used in this article, operational linkage refers to the functional relationship between DNA and regulatory and effector sequences of nucleotides (such as promoters, enhancers, transcription and translation termination sites, and other signaling sequences).

[0080] For example, operatively linking DNA to a promoter refers to the physical and functional relationship between DNA and a promoter such that transcription of this DNA is initiated from the promoter by an RNA polymerase that specifically recognizes, binds to, and transcribes the DNA.

[0081] As used in this article, a promoter is a DNA segment that controls the transcription of DNA that is operatively linked to it.

[0082] The polynucleotides or vectors of this invention can enter cells, typically prokaryotic or eukaryotic cells. The vectors can be retained in the cytoplasm, or the polynucleotides can be incorporated into the genome using lentiviral vectors or genome editing (i.e., CRISPR-Cas9, but not limited thereto).

[0083] Therefore, the present invention also relates to cells comprising the polynucleotides of the present invention or the expression vectors of the present invention.

[0084] In one embodiment, luciferase or a fusion protein containing luciferase is secreted by prokaryotic or eukaryotic cells and expressed in the cytoplasm or, in the case of bacteria, in the periplasm.

[0085] In one embodiment, luciferase or a fusion protein containing luciferase is synthesized in vitro using a transcription and translation kit.

[0086] This invention also relates to non-human transgenic animals comprising the cells, polynucleotides, or vectors of this invention.

[0087] The present invention also relates to a reagent kit comprising: - The luciferase, fusion protein containing the luciferase, polynucleotide, expression vector or cell of the present invention - Substrate of luciferase.

[0088] Preferably, the kit contains luciferase or fusion protein and substrate.

[0089] Coelenterate is a shrimp Oplophorus It is a natural substrate of luciferase, but the use of furimazine can improve the signal.

[0090] Therefore, the substrate can be selected from coelenterin, furimazine, or their derivatives.

[0091] Furimazine derivatives and their steady-state pro-substrate O-acetylated moieties are disclosed in patent application WO2018 / 197727 A1. These furimazine derivatives provide better bioluminescent signals in terms of intensity, signal-to-noise ratio, and / or duration.

[0092] Therefore, the substrate can be selected from: 8-Benzyl-2-((5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-Benzyl-2-((5-ethylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-Benzyl-2-((4,5-dimethylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-Benzyl-6-(2-fluorophenyl)-2-(furan-2-ylmethyl)imidazo[1,2-a]pyrazin-3(7H)-one 8-Benzyl-2-(3-methylbenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-Benzyl-2-(3-methoxybenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 2,8-Dibenzyl-6-(2-fluorophenyl)imidazo[1,2-a]pyrazin-3(7H)-one 8-Benzyl-6-(2,6-difluorophenyl)-2-(furan-2-ylmethyl)imidazo[1,2-a]pyrazin-3(7H)-one 8-Benzyl-6-phenyl-2-((5-(trifluoromethyl)furan-2-yl)methyl)imidazo[1,2-a]pyrazin-3(7H)-one 2,8-Dibenzyl-6-(2,6-difluorophenyl)imidazo[1,2-a]pyrazin-3(7H)-one 8-Benzyl-6-(2-fluorophenyl)-2-((5-methylfuran-2-yl)methyl)imidazo[1,2-a]pyrazin-3(7H)-one 8-Benzyl-2-((5-cyclopropylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-Benzyl-2-(3-fluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-Benzyl-2-((5-ethylfuran-2-yl)methyl)-6-(2-fluorophenyl)imidazo[1,2-a]pyrazin-3(7H)-one 8-Benzyl-6-(3-fluorophenyl)-2-((5-methylfuran-2-yl)methyl)imidazo[1,2-a]pyrazin-3(7H)-one 8-Benzyl-2-(2-fluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-Benzyl-2-((5-ethylthiophen-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-Benzyl-2-((4,5-dimethylfuran-2-yl)methyl)-6-(2-fluorophenyl)imidazo[1,2-a]pyrazin-3(7H)-one 2-Benzyl-8-(2-fluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 2-Benzyl-8-(3-fluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(3-Fluorobenzyl)-2-(furan-2-ylmethyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2-Fluorobenzyl)-2-(3-Methylbenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2-Fluorobenzyl)-2-(3-Methoxybenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2-Fluorobenzyl)-2-(furan-2-ylmethyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2-Fluorobenzyl)-2-((5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(3-Fluorobenzyl)-2-(3-Methoxybenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(3-Fluorobenzyl)-2-(3-Methylbenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 2-((5-ethylfuran-2-yl)methyl)-8-(3-fluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2-chlorobenzyl)-2-((5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(3-Fluorobenzyl)-2-((5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 2-((5-ethylfuran-2-yl)methyl)-8-(2-fluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(3-Fluorobenzyl)-6-(2-Fluorophenyl)-2-((5-methylfuran-2-yl)methyl)imidazo[1,2-a]pyrazin-3(7H)-one 8-(2,3-Difluorobenzyl)-2-(furan-2-ylmethyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2,3-difluorobenzyl)-2-((5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 2-Benzyl-8-(2,3-difluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2,6-difluorobenzyl)-2-((5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2,3-difluorobenzyl)-2-((4,5-dimethylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2,3-difluorobenzyl)-2-((5-ethylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2,6-difluorobenzyl)-2-((5-ethylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 2-((4,5-dimethylfuran-2-yl)methyl)-8-(2-fluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 2-((4,5-dimethylfuran-2-yl)methyl)-8-(3-fluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2,3-Difluorobenzyl)-2-((4-ethyl-5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2,3-difluorobenzyl)-2-((5-ethyl-4-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one, and 8-Benzyl-2-(furan-2-ylmethyl)-6-(3-hydroxyphenyl)imidazo[1,2-a]pyrazin-3(7H)-one.

[0093] These substrates are disclosed in WO2018 / 197727 A1 and have the following names: Q3, Q12, Q16, Q21, Q14, Q18, Q20, Q27, Q28, Q29, Q34, Q36, Q41, Q51, Q54, Q56, Q58, Q61, Q72, Q73, Q81, Q82, Q83, Q84, Q85, Q101, Q100, Q99, Q98, Q97, Q96, Q105, Q107, Q108, Q117, Q121, Q124, Q127, Q129, Q131, Q132, Q135, Q143 and Q149.

[0094] In a preferred embodiment, the substrate is 8-(2,3-difluorobenzyl)-2-((5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one (such as Q-108 disclosed in Table 1 on page 129 of WO2018 / 197727 A1).

[0095] The present invention also relates to a method for producing the luciferase of the present invention, the method comprising the following steps: - Provides a luciferase having the following amino acid sequence: SEQ ID NO: 1 or a variant thereof, said variant having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% amino acid sequence identity with SEQ ID NO: 1, and - At least 1, 2, 3, 4, 5, 6, or 7 steps must be selected from the following: - Replace the tyrosine (Y) at position 18 of SEQ ID NO: 1 with arginine (R). - Replace the leucine (L) at position 48 of SEQ ID NO: 1 with lysine (K). - Replace the isoleucine (I) at position 56 of SEQ ID NO: 1 with alanine (A). - Replace the tyrosine (Y) at position 116 of SEQ ID NO: 1 with phenylalanine (F). - Replace the tryptophan (W) at position 134 of SEQ ID NO: 1 with an amino acid selected from threonine (T) and glutamic acid (E). - Replace the tryptophan (W) at position 163 of SEQ ID NO: 1 with an amino acid selected from threonine (T) and glutamic acid (E). and - Replace the cysteine ​​(C) at position 166 of SEQ ID NO: 1 with serine (S), or a combination thereof.

[0096] The present invention also relates to a method for producing the luciferase of the present invention or a fusion protein comprising the luciferase of the present invention, the method comprising the following steps: - Introduce the vector of the present invention into cells under conditions that allow luciferase expression, and / or - The cells of the present invention are cultured under conditions that allow luciferase expression.

[0097] The present invention also relates to the use of the luciferase of the present invention or a fusion protein comprising the luciferase of the present invention in a luminescent reaction; said use includes the addition of a substrate containing the luciferase.

[0098] This invention provides a method comprising the following steps: (a) Exposing luciferase or fusion protein to substrate, and (b) Detection of luminescence.

[0099] Prior to exposure, the polynucleotides according to the invention can be introduced into cells and / or luciferase or fusion proteins can be expressed.

[0100] The method can be in vitro, ex vivo, or in vivo.

[0101] Fusion protein As described in the invention summary, the present invention relates to a fusion protein comprising: - N-terminal domain, which contains variable domains as camel heavy chain antibodies (VHH) or single-chain variable fragments (scFV) against immunoglobulins. and - C-terminal domain, which contains a polypeptide with luciferase activity: - Having the amino acid sequence SEQ ID NO: 1 or - Has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% amino acid sequence identity with the amino acid sequence SEQ ID NO: 1.

[0102] In one implementation, the fusion protein comprises - N-terminal domain, which contains single-chain variable segments (scFVs) targeting immunoglobulins. and - C-terminal domain, which contains a polypeptide with luciferase activity: - Having the amino acid sequence SEQ ID NO: 1 or - Has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% amino acid sequence identity with the amino acid sequence SEQ ID NO: 1.

[0103] Single-chain variable fragments (scFv) are fusion proteins in which the variable regions of the immunoglobulin heavy chain (VH) and light chain (VL) are linked by a linker.

[0104] In another embodiment, the fusion protein comprises: - N-terminal domain containing a variable domain of camel heavy chain antibody (VHH) against immunoglobulin. and - C-terminal domain, which contains a polypeptide with luciferase activity: - Having the amino acid sequence SEQ ID NO: 1 or - Has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% amino acid sequence identity with the amino acid sequence SEQ ID NO: 1.

[0105] VHH is the variable domain of heavy chain antibodies in camelids. In fact, a significant proportion of serum antibodies in camelids are homodimeric IgGs with a molecular weight of approximately 80 kD (Hamers-Casterman et al., 1993 Nature, 363, 446-448). These heavy chain immunoglobulins (Ig) contain three domains, and their variable region is called VHH. Recombinant VHH (approximately 12-14 kD in size) constitutes a complete antigen-binding domain and exhibits a broad antigen-binding repertoire. Its hypervariable region is expanded and exhibits unique characteristics, such as replacing three to four hydrophobic framework residues (which interact with VL in conventional antibodies) with more hydrophilic amino acids. To stabilize the enlarged CDR, the VHH can possess additional disulfide bonds between CDR1 and CDR3 in dromedary camels and between CDR2 and CDR3 in llamas, in addition to the typical disulfide bonds (Harmsen and DeHaard 2007 Appl Microbiol Biotechnol., 77, 13-22; Muyldermans 2001 J Biotechnol., 74, 277-302). The enlarged CDR3 ring can adopt a convex conformation, while conventional complementary sites are limited to concave or planar structures (Muyldermans 2001 J Biotechnol., 74, 277-302). These characteristics allow VHH to recognize unique epitopes that are poorly immunogenic to conventional antibodies (Lafaye et al., 2009 Mol Immuno., 46, 695-704; Wernery 2001 J Vet Med B Infect Dis Vet Public Health., 48, 561-568). Although VHH is a monovalent antibody by definition, excluding any affinity effects by default, its biological activity (measured in vitro as IC50) can be similar to that of conventional bivalent antibody molecules (Thys et al., 2010 Antiviral Res., 87, 257-264).

[0106] The VHH can be selected from known VHHs. Examples of known VHHs that can be used according to the present invention are disclosed in Table 7 below.

[0107] Table 7 Therefore, the VHH of the fusion protein according to the present invention may have an amino acid sequence selected from the following: SEQ ID NO: 57, SEQ ID NO: 58 and SEQ ID NO: 59.

[0108] The VHH used in this invention may also be selected from a library.

[0109] Methods for selecting antigen-specific VHHs from VHH libraries of immunized camels or llamas, such as phage display, have been described. The VHH gene is cloned into a phage display vector, antigen conjugates are obtained through panning, and the selected VHHs are expressed in bacteria. Recombinant VHHs offer several advantages over conventional antibody fragments (Fab or scFv) because only one domain needs to be cloned, and these VHHs are well expressed, highly soluble in water, and stable at high temperatures.

[0110] VHHs can also be custom-designed and screened from synthetic libraries derived from camel-derived VHH scaffolds or humanized scFv scaffolds.

[0111] For example, VHH can be obtained by a method including the following steps: (a) Immunize camel species with immunoglobulins or fragments thereof, preferably alpacas ( Lama pacos ), (b) Isolate peripheral lymphocytes from immunized camelids, obtain total RNA and synthesize the corresponding cDNA (the method is known in the art; see, for example, Lafaye et al., 1995 Res Immunol., 146, 373-82; Errata: 1996, Res Immunol., 147, 61). (c) Construct a cDNA fragment library encoding the VHH domain. (d) The cDNA encoding the VHH domain obtained in step (c) was transcribed into mRNA using PCR, the mRNA was converted into ribosome display format, and the VHH domain was selected by ribosome display.

[0112] A polynucleotide encoding VHH and a polynucleotide encoding a polypeptide with luciferase activity can be inserted into a vector. The polynucleotide encoding VHH and the polynucleotide encoding a polypeptide with luciferase activity are linked to express the fusion protein of the present invention.

[0113] The vector can then be introduced into cells, for example, by transforming bacterial cells to enable the cells to express the fusion protein.

[0114] The N-terminal and C-terminal domains of the fusion protein and / or VHH can be linked to a polypeptide with luciferase activity via a linker. Preferred linkers have an amino acid sequence selected from the following: GS, AAA, SEQ ID NO: 24, SEQ ID NO: 25, and SEQ ID NO: 26.

[0115] Fusion proteins may contain one or more heterologous amino acid sequences at the N-terminus, C-terminus, or both. In particular, they may contain tags, such as polyhistidine tags for purification purposes.

[0116] The present invention also relates to a polynucleotide encoding the fusion protein of the present invention and a vector comprising the polynucleotide.

[0117] Suitablely, the fusion protein of the present invention or its encoding polynucleotide is recombinant.

[0118] Advantageously, the vector contains a polynucleotide operably linked to a promoter.

[0119] Advantageously, codon optimization of polynucleotides can be performed to express fusion proteins.

[0120] The polynucleotides or vectors of the present invention can enter cells.

[0121] Therefore, the present invention also relates to cells comprising the polynucleotides of the present invention or the vectors of the present invention.

[0122] The immunoglobulins targeted by VHH can be derived from humans or non-human animals, with humans being the preferred source.

[0123] Immunoglobulins can be IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgD, or IgE. Preferably, the immunoglobulin is IgG, IgE, IgM, or IgA. The immunoglobulin of interest will depend on the purpose of the assay. For example, when the purpose of the assay is to diagnose allergy, IgE will be preferred primarily, followed by IgG. IgM can be used to diagnose recent infections in the blood. IgG can be used to diagnose earlier infections in the blood. IgA can be used to diagnose infections in the blood, mucous membranes, or saliva.

[0124] Immunoglobulins are typically targeted at antigens.

[0125] Antigens can be selected from allergens, viruses, bacteria, fungi, and parasites, or fragments or parts thereof.

[0126] For example, allergens can be components of the following (mainly proteins): milk (especially cow's milk), soy, eggs, wheat, cod, seafood, shellfish, fish, nuts, peanuts, house dust mites ( D. pteronyssinus ), Alternaria ( Alternaria Cats, dogs, grass or birch pollen, dust mites, anesthetics (cureus, but not limited to), antibiotics (amoxicillin, but not limited to), latex, fabrics, venom (from wasps and bees, but not limited to).

[0127] The virus can be, for example, severe acute respiratory syndrome coronavirus 2 (SARS CoV2) or severe acute respiratory syndrome coronavirus 1 (SARS CoV1). Viral fragments can contain proteins isolated from the virus, synthesized or expressed as recombinants, such as spike protein (S) or nucleoprotein (N), or fragments corresponding to structural or functional domains, or fragments of any size.

[0128] Immunoglobulins can also be autoantibodies.

[0129] In a preferred embodiment, VHH targets a constant fragment (Fc) of an immunoglobulin.

[0130] In one embodiment, the polypeptide having luciferase activity is a luciferase having the amino acid sequence SEQ ID NO: 1.

[0131] The polypeptide with luciferase activity can have at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% amino acid sequence identity with the amino acid sequence SEQ ID NO: 1.

[0132] In one embodiment, the polypeptide having luciferase activity is a mutant luciferase as disclosed above.

[0133] Therefore, the polypeptide having luciferase activity can have at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% amino acid sequence identity with the amino acid sequence SEQ ID NO: 1, and contains at least one amino acid substitution selected from: - Replace the tyrosine (Y) at position 18 of SEQ ID NO: 1 with arginine (R). - Replace the leucine (L) at position 48 of SEQ ID NO: 1 with lysine (K). - Replace the isoleucine (I) at position 56 of SEQ ID NO: 1 with alanine (A). - Replace the tyrosine (Y) at position 116 of SEQ ID NO: 1 with phenylalanine (F). - Replace the tryptophan (W) at position 134 of SEQ ID NO: 1 with an amino acid selected from threonine (T) and glutamic acid (E). - Replace the tryptophan (W) at position 163 of SEQ ID NO: 1 with an amino acid selected from threonine (T) and glutamic acid (E). and - Replace cysteine ​​(C) at position 166 of SEQ ID NO: 1 with serine (S).

[0134] The polypeptide having luciferase activity may have an amino acid sequence selected from the following: SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, and SEQ ID NO: 17.

[0135] The polypeptide with luciferase activity may also have an amino acid sequence selected from the following: SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45 and SEQ ID NO: 46.

[0136] The present invention also relates to a reagent kit comprising: - The fusion protein of the present invention, and - Substrates of peptides with luciferase activity.

[0137] As mentioned above, coelenterate is a shrimp Oplophorus It is a natural substrate of luciferase, but the use of furimazine can improve the signal.

[0138] Therefore, the substrate can be selected from coelenterin, furimazine, or their derivatives.

[0139] Derivatives of furimazine are disclosed in patent application WO2018 / 197727 A1. These furimazine derivatives provide better bioluminescent signals in terms of intensity, signal-to-noise ratio, and / or duration.

[0140] Therefore, the substrate can be selected from: 8-Benzyl-2-((5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-Benzyl-2-((5-ethylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-Benzyl-2-((4,5-dimethylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-Benzyl-6-(2-fluorophenyl)-2-(furan-2-ylmethyl)imidazo[1,2-a]pyrazin-3(7H)-one 8-Benzyl-2-(3-methylbenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-Benzyl-2-(3-methoxybenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 2,8-Dibenzyl-6-(2-fluorophenyl)imidazo[1,2-a]pyrazin-3(7H)-one 8-Benzyl-6-(2,6-difluorophenyl)-2-(furan-2-ylmethyl)imidazo[1,2-a]pyrazin-3(7H)-one 8-Benzyl-6-phenyl-2-((5-(trifluoromethyl)furan-2-yl)methyl)imidazo[1,2-a]pyrazin-3(7H)-one 2,8-Dibenzyl-6-(2,6-difluorophenyl)imidazo[1,2-a]pyrazin-3(7H)-one 8-Benzyl-6-(2-fluorophenyl)-2-((5-methylfuran-2-yl)methyl)imidazo[1,2-a]pyrazin-3(7H)-one 8-Benzyl-2-((5-cyclopropylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-Benzyl-2-(3-fluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-Benzyl-2-((5-ethylfuran-2-yl)methyl)-6-(2-fluorophenyl)imidazo[1,2-a]pyrazin-3(7H)-one 8-Benzyl-6-(3-fluorophenyl)-2-((5-methylfuran-2-yl)methyl)imidazo[1,2-a]pyrazin-3(7H)-one 8-Benzyl-2-(2-fluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-Benzyl-2-((5-ethylthiophen-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-Benzyl-2-((4,5-dimethylfuran-2-yl)methyl)-6-(2-fluorophenyl)imidazo[1,2-a]pyrazin-3(7H)-one 2-Benzyl-8-(2-fluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 2-Benzyl-8-(3-fluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(3-Fluorobenzyl)-2-(furan-2-ylmethyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2-Fluorobenzyl)-2-(3-Methylbenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2-Fluorobenzyl)-2-(3-Methoxybenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2-Fluorobenzyl)-2-(furan-2-ylmethyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2-Fluorobenzyl)-2-((5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(3-Fluorobenzyl)-2-(3-Methoxybenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(3-Fluorobenzyl)-2-(3-Methylbenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 2-((5-ethylfuran-2-yl)methyl)-8-(3-fluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2-chlorobenzyl)-2-((5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(3-Fluorobenzyl)-2-((5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 2-((5-ethylfuran-2-yl)methyl)-8-(2-fluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(3-Fluorobenzyl)-6-(2-Fluorophenyl)-2-((5-methylfuran-2-yl)methyl)imidazo[1,2-a]pyrazin-3(7H)-one 8-(2,3-Difluorobenzyl)-2-(furan-2-ylmethyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2,3-difluorobenzyl)-2-((5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 2-Benzyl-8-(2,3-difluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2,6-difluorobenzyl)-2-((5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2,3-difluorobenzyl)-2-((4,5-dimethylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2,3-difluorobenzyl)-2-((5-ethylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2,6-difluorobenzyl)-2-((5-ethylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 2-((4,5-dimethylfuran-2-yl)methyl)-8-(2-fluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 2-((4,5-dimethylfuran-2-yl)methyl)-8-(3-fluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2,3-Difluorobenzyl)-2-((4-ethyl-5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2,3-difluorobenzyl)-2-((5-ethyl-4-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one, and 8-Benzyl-2-(furan-2-ylmethyl)-6-(3-hydroxyphenyl)imidazo[1,2-a]pyrazin-3(7H)-one.

[0141] These substrates are disclosed in WO2018 / 197727 A1 and have the following names: Q3, Q12, Q16, Q21, Q14, Q18, Q20, Q27, Q28, Q29, Q34, Q36, Q41, Q51, Q54, Q56, Q58, Q61, Q72, Q73, Q81, Q82, Q83, Q84, Q85, Q101, Q100, Q99, Q98, Q97, Q96, Q105, Q107, Q108, Q117, Q121, Q124, Q127, Q129, Q131, Q132, Q135, Q143 and Q149.

[0142] In a preferred embodiment, the substrate is 8-(2,3-difluorobenzyl)-2-((5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one (such as Q-108 disclosed in Table 1 on page 129 of WO2018 / 197727 A1).

[0143] The kit may also contain reagents, controls, and / or supports for detecting luciferase activity.

[0144] Preferably, the antigen is immobilized on a support. The support may be a glass slide, plate (e.g., a multi-well plate), test paper (e.g., nitrocellulose test paper or PVDF membrane or paper), tube, disc, ring, rod, propeller, fiber, or fiber assembly.

[0145] The present invention also relates to the use of the fusion protein of the present invention for detecting and / or quantifying immunoglobulins in a sample.

[0146] Samples may be selected from, for example, whole blood, serum, plasma, cerebrospinal fluid, semen, urine, nasopharyngeal smear, oropharyngeal smear, vaginal smear, feces, sweat, saliva, tracheal lavage fluid, and bronchial lavage fluid.

[0147] The present invention also relates to a method for detecting the presence of immunoglobulins in a sample, the method comprising the following steps: (a) Contact the sample with the fusion protein of the present invention. (b) Adding a substrate of a polypeptide with luciferase activity, and (c) Detection of luminescence.

[0148] Typically, the polypeptide with luciferase activity is the polypeptide with luciferase activity of the fusion protein of the present invention.

[0149] Since the level of immunoglobulins in a sample can also be measured by emitting light, the present invention also relates to a method for quantifying the level of immunoglobulins in a sample, the method comprising the following steps: (a) Contact the sample with the fusion protein of the present invention. (b) Adding a substrate of a polypeptide with luciferase activity, and (c) Quantized luminescence.

[0150] Typically, the polypeptide with luciferase activity is the polypeptide with luciferase activity of the fusion protein of the present invention.

[0151] The method of the present invention may further include the steps of immobilizing the antigen to a support and / or providing a support on which the antigen is immobilized.

[0152] It can be immobilized through surface adsorption, chemical bonding, or non-covalent interactions.

[0153] The method may include the step of contacting the sample with the immobilized antigen.

[0154] The interaction between fusion proteins and immunoglobulins can be challenged by dilution, heating, or the addition of salt, acid, alkali, or organic or mineral buffers, or any competing agents, or by lateral flow or acoustic frequencies.

[0155] When detecting emission, the number of photons per second can ultimately be calculated based on its wavelength.

[0156] The method may further include the step of comparing the emitted light with a control.

[0157] The present invention also relates to a method for quantifying the immunoglobulin level at each affinity interval in a sample to assess the affinity range of a mixture of polyclonal immunoglobulins, the method comprising the steps of: (a) In the presence of a dilution series of free antigen, the sample is brought into contact with the immobilized antigen. (b) Contact the sample with the fusion protein of the present invention, and (c) Adding a substrate containing a polypeptide with luciferase activity, (d) Quantify luminescence and plot the relationship between light intensity and antigen concentration.

[0158] Typically, the immunoglobulin whose level is quantified is the immunoglobulin targeted by the antibody of the fusion protein. The antigen is the antigen targeted by the immunoglobulin. The polypeptide with luciferase activity is the luciferase-active polypeptide of the fusion protein of this invention.

[0159] The invention will be further illustrated by the following figures and embodiments. However, these embodiments and figures should not be construed as limiting the scope of the invention in any way.

[0160] Example Example 1: Mutant luciferase with improved properties NanoKAZ / nanoLuc is the result of enhanced mutagenesis, used to optimize enzyme production and light intensity, and has properties derived from... Oplophorus gracilirostris The minimum length of the luciferase catalytic domain. However, in addition to improving the enzyme's catalytic activity, four observations led to the discovery of a breakthrough that overcomes the following: 1) enzyme inactivation caused by reaction products, 2) reaction inhibition caused by high substrate concentration, 3) low quantum yield of oxidation reactions, and 4) the tendency of the enzyme to be adsorbed onto material surfaces (tubes, pores, membranes, etc.).

[0161] Materials and methods: nanoKAZ (SEQ NO: 1) is from Oplophorus gracilirostris The optimized sequence of the luciferase catalytic domain (WO2012 / 061530).

[0162] The gene nanoKAZ (SEQ NO: 33 [jaz526]) was synthesized by Eurofins (Germany) and has a carboxyl-terminal His6-tag and a flanking region corresponding to the pET23 sequence (Novagen). Complementary fragments were assembled using NEBuilder HiFi assembly premix (New England BioLabs) according to the Gibson method, and the PCR-purified pET23 vector and synthesized gene were assembled. Single or double mutations were introduced by PCR in SEQ ID NO: 2 [jaz544], 3 [jaz583], 4 [jaz584], 5 [jaz560], 6 [jaz585], and 7 [jaz619]. The gene SEQ NO: 40 [jaz536] was synthesized by Eurofins (Germany) and has a carboxyl-terminal His6-tag and a flanking region corresponding to the pET23 sequence (Novagen). Single or double mutations have been introduced by PCR in SEQ NO: 41 [jaz570], 42 [jaz572], and 43 [jaz573]. Multiple mutations were introduced by assembling complementary fragments of genes carrying specific mutations using the Gibson method with NEBuilder HiFi assembly premix (New-England Biolabs).

[0163] The following genes were synthesized by Eurofins (Germany) and have a carboxyl-terminal His6-tag and a flanking region corresponding to the pET23 sequence (Novagen): SEQ ID NO: 42 [JAZ621], which has a double repeat of SEQ ID NO: 1; SEQ ID NO: 43 [JAZ622], in which the tyrosine (Y) at position 116 is double-substituted with phenylalanine (F) in the double repeat of SEQ ID NO: 1; SEQ ID NO: 44 [JAZ476], which has a triple repeat of SEQ ID NO: 1; SEQ ID NO: 45 [JAZ620], in which the tyrosine (Y) at position 116 is triple-substituted with phenylalanine (F) in the triple repeat of SEQ ID NO: 1; and SEQ ID NO: 46 [Scoprii68], in which the tyrosine (Y) at position 116 is substituted with phenylalanine (F) in the Antares sequence covering SEQ ID NO: 1.

[0164] The product (5 mL) was used to transform NEB 5-α competent Escherichia coli and grown overnight in petri dishes on LB / agar / ampicillin. The isolated colonies were grown in liquid medium, and plasmids were isolated and sequenced for nucleotides to confirm the presence of mutations at the correct locations.

[0165] result: Referring to nanoKAZ / furimazine, a mutation of tyrosine residue 116 to phenylalanine (SEQ ID NO: 2 [JAZ544]) increased the catalytic activity of nanoKAZ for furimazine by 250% and for Q108 by 1400%. Mutating double or triple repetitions (SEQ ID NO: 45) of the catalytic domain increased catalytic activity by 2600% and 3500%, respectively. Substrate diffusion rate limited the expected 2-fold or 3-fold improvement (1400%) in single-domain activity. We have shown that luciferase activity decreases over time at a rate dependent on substrate properties (Coutant et al., 1999). Q80 activity decreases rapidly, while Q103 activity decreases slowly. Unfortunately, higher light emission leads to faster enzyme inactivation. There is a trade-off between light intensity (flash) and long (luminescent) lifetime. We have shown that the reduction is due to enzyme inactivation. The mutation of cysteine ​​at position 166 to the serine residue (SEQ ID NO: 7 [JAZ619]) reduces the rate of inactivation.

[0166] A mutation of tryptophan at position 134 near the hydrophobic back pocket to threonine (SEQ ID NO: 3 [JAZ583]) moderately reduces the inhibitory effect at high substrate concentrations. At room temperature and the furimazine concentration at the maximum reaction rate (54 mM), we counted 1 photon for every 1460 furimazine molecules catalyzed by one molecule of nanoKAZ (SEQ ID NO: 1). Substrate selection modulates this quantum yield from very low to moderate. Lower substrate concentrations result in higher quantum yields; however, unfortunately, lower reaction rates also lead to lower photon emissions. A mutation of tyrosine at position 116 to phenylalanine (SEQ ID NO: 2 [JAZ544]) moderately increases the photon emission count. Mutations in tryptophan at positions 134 (SEQ ID NO: 3 [JAZ583]) and 163 (SEQ ID NO: 4 [JAZ584]) protrude from the protein surface and are most effective in improving enzyme solubility and reducing surface adsorption (which affects measurements with high noise).

[0167] Combinations of mutations offer improved properties in terms of light intensity, lifetime, and solubility. The optimal trade-off should be selected based on the specific properties required for the application: light intensity / expected sensitivity, lifetime / experimental duration, and solubility / experimental conditions.

[0168] - SEQ ID NO: 1 [nanoKAZ, JAZ526] has 100% catalytic activity for furimazine and 250% for Q108.

[0169] - SEQ ID NO: 2 [JAZ544] The tyrosine (Y) at position 116 of SEQ ID NO: 1 is replaced. The catalytic activity against furimazine is 200% of that of SEQ ID NO: 1 and 1450% of that against Q108.

[0170] - SEQ ID NO: 3 [JAZ583] The tryptophan (W) at position 134 of SEQ ID NO: 1 is replaced with threonine (T). The catalytic activity against furimazine is 100% of that of SEQ ID NO: 1. - SEQ ID NO: 4 [JAZ584] The tryptophan (W) at position 163 of SEQ ID NO: 1 is replaced with threonine (T). The catalytic activity against furimazine is 50% of that of SEQ ID NO: 1.

[0171] - SEQ ID NO: 5 [JAZ560] The isoleucine (I) at position 56 of SEQ ID NO: 1 is replaced with alanine (A). The catalytic activity against furimazine is 120% of that of SEQ ID NO: 1 and 600% of that against Q108.

[0172] - SEQ ID NO: 6 [JAZ585] SEQ ID NO: 1 has tyrosine (Y) at position 116 replaced with phenylalanine (F) and tryptophan (W) at position 134 replaced with threonine (T). The catalytic activity against furimazine is 200% of that of SEQ ID NO: 1 and 1400% of that against Q108.

[0173] - SEQ ID NO: 7 [JAZ619] SEQ ID NO: 1 has tyrosine (Y) at position 116 replaced with phenylalanine (F) and cysteine ​​(C) at position 166 replaced with serine (S). The catalytic activity against furimazine is 200% of that of SEQ ID NO: 1.

[0174] - SEQ ID NO: 8 [JAZ536] SEQ ID NO: 1 has tyrosine (Y) at position 18 replaced with arginine (R), leucine (L) at position 48 replaced with lysine (K), tryptophan (W) at position 134 replaced with glutamic acid (E), and tryptophan 163 (W) at position 163 replaced with glutamic acid (R). The catalytic activity against furimazine is 80% of that of SEQ ID NO: 1.

[0175] - SEQ ID NO: 9 [JAZ570] SEQ ID NO: 1 has the following substitutions: tyrosine (Y) at position 18 is replaced with arginine (R), leucine (L) at position 48 is replaced with lysine (K), tryptophan (W) at position 134 is replaced with glutamic acid (E), tryptophan 163 (W) at position 163 is replaced with glutamic acid (E), and cysteine ​​(C) at position 166 is replaced with serine (S). The catalytic activity against furimazine is 150% of that in SEQ ID NO: 1.

[0176] - SEQ ID NO: 10 [JAZ572] In SEQ ID NO: 1, tyrosine (Y) at position 18 is replaced with arginine (R), leucine (L) at position 48 is replaced with lysine (K), tryptophan (W) at position 134 is replaced with glutamic acid (E), tryptophan 163 (W) at position 163 is replaced with glutamic acid (E), and tyrosine (Y) at position 116 is replaced with phenylalanine (F). The catalytic activity against furimazine is 180% of that in SEQ ID NO: 1.

[0177] - SEQ ID NO: 11 [JAZ573] In SEQ ID NO: 1, tyrosine (Y) at position 18 is replaced with arginine (R), leucine (L) at position 48 is replaced with lysine (K), tryptophan (W) at position 134 is replaced with glutamic acid (E), tryptophan (W) at position 163 is replaced with glutamic acid (E), tyrosine (Y) at position 116 is replaced with phenylalanine (F), and cysteine ​​(C) at position 166 is replaced with serine (S). The catalytic activity against furimazine is 150% of that in SEQ ID NO: 1.

[0178] Several sequences allow for signal enhancement through doubly or triple-repeated catalytic domains. They are primarily used in in vitro or in vivo imaging applications requiring high light intensity for real-time imaging, rapid kinetics, or deep tissue observation. Their application in assays is not useful for diagnostics because they increase signal and noise. If the substrate concentration is low, the diffusion rate of the substrate to the active site significantly limits activity.

[0179] - SEQ ID NO: 42 [JAZ621] A double repeat of SEQ ID NO: 1. The catalytic activity against furimazine is 150% of that of SEQ ID NO: 1.

[0180] - SEQ ID NO: 43 [JAZ622] In the double repeat of SEQ ID NO: 1, tyrosine (Y) at position 116 is double-substituted with phenylalanine (F). The catalytic activity against furimazine is 560% of that of SEQ ID NO: 1 and 2600% of that against Q108.

[0181] - SEQ ID NO: 44 [JAZ476] Triple replicate of SEQ ID NO: 1. Catalytic activity against furimazine was 250% of that of SEQ ID NO: 1.

[0182] - SEQ ID NO: 45 [JAZ620] In the triplet repeat of SEQ ID NO: 1, the tyrosine (Y) at position 116 is triple-substituted with phenylalanine (F). The catalytic activity against furimazine is 2500% of that of SEQ ID NO: 1 and 3500% of that against Q108.

[0183] By using sequences from 1 to 15 and one of Antares or Scorpii (SEQ NO: 48), two color applications can be performed using a single substrate but with two luciferases as reporter genes, wherein the color application is performed by using sequences from nanoKAZ to mOrange (derived from...). Discosoma Energy resonance transfer emission of redshifted photons of red fluorescent protein of genus species (Shaner Nc, Campbell Re, Steinbach Pa, Giepmans Bng, Palmer Ae, Tsien Ry (2004). Nature Biotechnology, 22(12), 1567-1572).

[0184] - SEQ ID NO: 46 [Scorpii68] In the Antares chimera, tyrosine (Y) at position 116 of SEQ ID NO: 1 is replaced with phenylalanine (F) (Chu J, Oh Y, Sens A, Ataie N, Dana H, Macklin JJ, LavivT, Welf ES, Dean KM, Zhang F, Kim BB, Tang CT, Hu M, Baird MA, Davidson MW, Kay MA, Fiolka R, Yasuda R, Kim DS, Ng HL, Lin MZ. Nat Biotechnol. 2016 Jul; 34(7): 760-7). The activity for Q108 is 800%, but at 562 nm, while nanoKAZ emits photons at 460 nm. In addition to two color applications using a single substrate, Scorpii is effective as a reporter gene for in vivo imaging of redshifted light through thicker tissues.

[0185] Example 2: A bioluminescent method for measuring allergen-specific IgE Materials and methods Human blood plasma Plasma samples from patients with peanut allergy were obtained as part of their participation in an institutional review board-approved clinical trial of oral immunotherapy for peanut allergy in children and adults (peanut oral immunotherapy study: safety, efficacy and discovery; ClinicalTrials.gov ID: NCT02103270, USA). Peanut allergy was defined as a response to a double-blind, placebo-controlled food challenge (response induced by ≤500 mg of peanut protein) and a positive response to a peanut skin prick test (lump ≥5 mm). Plasma samples from healthy donors were obtained from the French blood bank (Etablissement Français du Sang, EFS).

[0186] Fusion protein anti-IgE sdAb026-nanoKAZ Design and synthesis of plasmid (pET23-sdAb026-nanokaz) encoding anti-IgE nanobody-luciferase fusion protein nanoKAZ is from Oplophorus gracilirostris The optimized sequence of the luciferase catalytic domain (WO2012 / 061530).

[0187] The nanoKAZ gene, synthesized by Eurofins (Germany), has a carboxyl-terminal His6-tag and a flanking region corresponding to the pET23 sequence (Novagen). The pET23 plasmid was amplified using forward and reverse oligonucleotides (forward: 5'CTCGAGCACCACCACCACCACCAC3' (SEQ ID NO: 47); reverse: 5'GGTATATCTCCTTCTTAAAGTTAAAC3' (SEQ ID NO: 48), Eurofins), Q5 DNA polymerase, and dNTP mixture (New England BioLabs). PCR products were purified by agarose gel electrophoresis (1%, Macherey Nagel). The purified pET23 vector and the synthesized gene (pET23-nanoKAZ) were assembled using NEBuilder HiFi assembly premix (New England BioLabs).

[0188] The sIgE binding region is derived from a humanized heavy chain antibody (single-domain antibody, sdAb026) selected from alpacas targeting sIgE (Jabs F, Plum M, Laursen NS, Jensen RK, Molgaard B, Miehe M et al., Trapping IgE in a closed conformation by mimicking CD23 binding prevents and disrupts FcepsilonRI interaction. Nat Commun 2018; 9:7, WO2014 / 087010 A1). sdAb026 recognizes the constant Cε3 region of human IgE. The affinity of sdAb026 for IgE is similar to that of the therapeutic anti-IgE antibody omalizumab (KD values ​​of 1.4 nM and 2.6 nM, respectively, 3,5), and it has been reported to inhibit the interaction between IgE and two receptors, FcεRI and CD23.

[0189] Gene sdab026 Synthesized by Eurofins, it has flanking regions corresponding to the pET23-nanoKAZ sequence. The synthetic gene sdab026 was amplified using the corresponding forward and reverse oligonucleotides (forward: 5'ATGGTCTTCACACTCGAAGATTTC3' (SEQ ID NO: 49); reverse: 5'CATGGTATATCTCCTTCTTAAAGTTAAA3' (SEQ ID NO: 50), Eurofins), using Q5 DNA polymerase and a dNTP mixture.

[0190] PCR products were purified by agarose gel electrophoresis. The purified pET23-nanoKAZ vector and the synthetic gene sdAb026 were assembled using NEBuilder HiFi assembly premix (New-England Biolabs).

[0191] The assembly product (5 mL) was used to transform NEB 5-α competent Escherichia coli and grown overnight in petri dishes on LB / agar / ampicillin. The isolated colonies were grown in liquid medium, and plasmids were isolated and sequenced to confirm the presence of the sdabs026-nanoKAZ insert.

[0192] The complete sequence of the anti-IgE nanobody luciferase tandem sdAb026-nanoKAZ ([anti-IgE nanobody]-[nanoKAZ]-[His6]) is shown in Table 8 below: Table 8 The estimated molecular weight (MW) of sdAb026-nanoKAZ calculated from the sequence is 34.1 kD.

[0193] Expression, purification, and validation of anti-IgE nanobody-luciferase fusion protein (sdAb026-nanoKAZ) pET23-sdab026-nanokaz is used for transformation of E. coli ( E. coli BL21 (DE3, New-England Biolabs) was used to achieve high expression in *E. coli*. Cells were grown at 18°C ​​and IPTG (Sigma-Aldrich) was added to induce the production of sdAb026-nanoKAZ. After harvesting cells by centrifugation (1.5 L), the precipitate was resuspended in 50 mM Tris-HCl pH 8.0, 50 mM NaCl containing a protease inhibitor (Sigma-Aldrich) and lysozyme (0.1 mg / mL, Sigma-Aldrich). Cells were disrupted by freeze-thaw cycles. DNase I (Sigma-Aldrich) was then added to remove DNA from the sample.

[0194] Centrifuge the crude extract at 1250 g for 30 min. Collect the supernatant and add NaCl (500 mM), imidazole (20 mM, Sigma-Aldrich), and Triton X-100 (0.1%, Sigma-Aldrich). Using an AKTA pure chromatography system (GE-Healthcare), load the clarified lysis buffer at 4 mL / min onto a equilibrated Hi-Trap 5 mL column (GE-Healthcare). Wash the column with 20 column volumes of run buffer (50 mM Tris-HCl pH 8.0, 50 mM NaCl, 20 mM imidazole) at 5 mL / min. Elute sdAb026-nanoKAZ with an imidazole gradient of 20 mM to 200 mM in 50 mM Tris-HCl pH 8.0 and 50 mM NaCl at 5 mL / min, and collect 1 mL fraction in a 96-well plate (GE-Healthcare). The catalytic activity of the fractions against 27 μM furimazine was analyzed using a Hydex spectrophotometer by diluting the fractions 107-fold in PBS. Highly active fractions were pooled and loaded onto a 1 mL HiTrap Q column (GE-Healthcare) equilibrated with 50 mM Tris-HCl pH 8.0 and 50 mM NaCl. Proteins were eluted at 1 mL / min using an AKTA-pure chromatographic system at 18°C ​​with 50 mM MES pH 6.5 and 50 mM NaCl. 500 µL fractions were collected in 96-well plates, and their activity was determined as described above. Highly active fractions were pooled. Aliquots (10 µL) were loaded onto stain-free SDS gels (4-15% Mini-PROTEAN® TGX Stain-Free). TM Protein gels (Bio-Rad) are used to assess the quality of purified proteins.

[0195] The gel was activated by UV transmission irradiation for 5 min (Bio-Gel Doc XR imaging system). Tryptophan residues underwent a UV-induced reaction with the trihalogen compound, generating an imaging fluorescence signal. UV spectra (240–300 nm) were obtained and used to assess the concentration of sdAb026-nanoKAZ from solution absorbance at 280 nm. The specific activity against furimazine in PBS at 23°C was approximately 10. 15The enzyme yielded photons / second / mg of sdAb026-nanoKAZ. Optimal activity was achieved with substrate (furimazine) concentrations ranging from 10 to 30 µM (a plateau occurs approximately 10 times KM = 2 µM). Above 30 µM, the substrate dipole moment quenched the photon emission of the catalytic substrate at the active site outside the nanoKAZ catalytic site. The quenching efficiency depended on the substrate dipole moment. Substrate-catalyzed random inactivation of nanoKAZ occurred, and the enzyme lifetime depended on both the substrate and the catalytic rate. The light emission intensity was optimized using optimal conditions based on the kinetic parameters of specific substrates through thorough enzymatic studies of nanoKAZ and its 30 mutants, and catalysis on 172 different substrates.

[0196] IgE luciferase immunosorbent assay (LuLISA) protocol At room temperature, flat-bottomed white 96-well plates (Fluoronunc C96 Maxisorp, Nunc) were subjected to adsorption for 2 hours in 50 µL / well NaHCO3 50 mM buffer pH 9.5 (Sigma) containing 10 µg / mL peanut extract (F171, Greerlaboratories), 10 µg / mL Ara H1 (NA-AH1-1, Indoor Technology), 10 µg / mL Ara H2 (RP-AH2-1, Indoor Technology), 5 µg / mL ovalbumin (OVA, Sigma-Aldrich), or 1 µg / mL house dust mite DER p2 (2B12NA-DP2-1, Indoor Technology). Target immobilization is a major factor in the success or failure of the method, as the maximum number of targets should be immobilized while providing allergenic domains that can bind to sIgE. Adsorption on Maxisorp® plates facilitates charge interactions. Alternative adsorption methods include covalent binding of targets via carboxyl, amine, or thiol moieties, or glycosylation on the functionalized pore surface. Empty the wells and saturate the coating with 100 µg / mL bovine serum albumin (Sigma) in NaHCO3 at room temperature for 1 hour. Wash the wells four times with 100 µL PBS / Tween 20 0.1%. Dilute recombinant anti-OVA human chimeric IgE (clone X4A4D12 / G9 / H8, a gift from Arkab), anti-house dust mite p2 human chimeric IgE (clone CH1, a gift from Arkab), or plasma from peanut-allergic subjects in PBS or consorted healthy donor plasma as shown. Incubate the sample dilutions for 1 hour at room temperature in the respective allergen-coated wells (50 µL / well). Wash the wells four times with 100 µL PBS / Tween 20 0.1%. Purified sdAb026-nanoKAZ 1 ng / mL (1.10) was loaded into PBS at room temperature. 9 RLU.s -1 .mL -1 (50 µL / well) and incubate for 30 min. Wash wells four times with 100 µL PBS / Tween 20 0.1%. At this step, the plate can be stored in PBS until measurement. Empty each well and load 50 µL of 27 µM (approximately 10 times the KM of nanoKAZ, 2 µM) furimazine (8-benzyl-2-(furan-2-ylmethyl)-6-phenylimidazo[1,2-a]pyrazine-3(7H)-one) and read immediately. Shake the plate on the track for 5 seconds and integrate the light emission intensity per well for 1 second using a multi-well plate spectrophotometer (LB960 Centro, Berthold).

[0197] For processing affinity spectra from LuLISA competitive assays, use a mixture of 0.5 μL of serum or plasma sample of equal concentration in 50 μL, and perform a 3x3 dilution series of free allergens in PBS from 10 μM to 0.7 pM along the wells of a 384-well plate coated with 16 allergens, or a 10x10 dilution series of free allergens in PBS from 10 μM to 1 pM along the wells of a 96-well plate coated with 8 allergens. Values ​​should be adapted to IgE affinity. Incubate for 1 to 3 hours to reach or most closely approach equilibrium. Wash wells four times with 100 µL PBS / Tween 20 0.1%. Purified sdAb026-JAZ572 (1 ng / mL) is preferred over sdAb026-nanoKAZ for higher signal and lower background, especially for high concentrations of free allergens, while IgE binds poorly to immobilized allergens during such a long incubation period. Finally, Tween 20 0.1%, BSA 0.1 mg / mL, or gelatin 0.1 mg / mL can be used to reduce background. Milk should be avoided for IgE assays in patients with potential allergies. Wash wells four times with 100 µL PBS / Tween 20 0.1%. Empty each well and load 50 µL of 13.5 µMhikazine-108 (8-benzyl-2-(furan-2-ylmethyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one), then read immediately. Shake the plate on the track for 1 second and integrate the light emission intensity per well for 0.5 seconds using a multi-well plate spectrophotometer (LB960 Centro, Berthold). The relationship between bioluminescence intensity and target concentration is shown in a bar graph.

[0198] IgE ImmunoCAP ImmunoCAP analysis was performed on the transported samples by Phadia, Thermo Fisher.

[0199] IgE ELISA scheme As described above, coat clear flat-bottomed 96- or 384-well plates (Maxisorp, Nunc) at room temperature for 2 hours. Empty the wells and saturate the coating with 100 µg / mL bovine serum albumin (Sigma) in 50 µL PBS at room temperature for 1 hour. Wash the wells four times with 100 µL PBS / Tween 20 0.1% (Sigma). Dilute recombinant anti-OVA human chimeric IgE (clone X4A4D12 / G9 / H8, a gift from Arkab), anti-house dust mite p2 human chimeric IgE (clone CH1, a gift from Arkab), or plasma from peanut-allergic subjects in PBS and incubate at room temperature in wells coated with their respective allergens for 1 hour, 50 mL / well. Wash the wells four times with 100 µL PBS / Tween 20 0.1%. 50 µL of alkaline phosphatase-conjugated goat IgG anti-human IgE (1:700 dilution in PBS, Sigma-Aldrich) was loaded into each well and incubated at room temperature for 1 hour. The wells were washed four times with 100 µL of PBS / Tween 200.1%. All wells were emptied, and 50 µL of 1 mg / mL phosphatase substrate pNPP (disodium 4-nitrophenyl phosphate, Sigma-Aldrich) was added to each well. The wells were incubated at room temperature for 3 hours or overnight at 4°C. The absorbance was measured at 405 nm using a multi-well spectrophotometer (Sapphire, Tecan) and compared with LuLISA results.

[0200] Statistical analysis Unpaired Mann-Whitney U test was used to compare differences in IgE levels between plasma samples from healthy donors and peanut-allergic subjects. A p-value <0.05 was considered statistically significant.

[0201] fingertip blood sample The project application was set up using a healthy volunteer to conduct tests on blood samples taken from a narrowed cohort of allergy patients at Trousseau Hospital for IgE LuLISA assays and parallel ImmunoCAP and ELISA.

[0202] After disinfecting the fingertip with alcohol, the test was performed using a lancing device equipped with a sterile, disposable scalpel, a method commonly used for glucose testing by diabetic patients themselves. 1 µL of blood was aspirated and mixed with 50 µL of PBS, BSA (50 µg / mL), heparin (10 UI / mL), and sdAb026-nanoKAZ (1 ng) solution pre-loaded into a 1000 µL disposable pipette tip (the tip end being a paper filter with a polyethylene filter frame). The diluted blood was filtered through the tip end and loaded into a 96-well plate pre-coated with a specific allergen and incubated at room temperature for 5 min. The wells were washed with PBS, and 100 µL of luciferase substrate (furimazine analogue) was added. Bioluminescence was immediately measured over 1 second using a plate spectrophotometer (LB960 Centro, Berthold). Measurements were performed simultaneously with negative and positive controls for internal calibration.

[0203] result Allergen-specific IgE can be sensitively and specifically detected by luciferase-linked immunosorbent assay (LuLISA). To establish a proof-of-concept for the specific detection of sIgE using LuLISA, dilution series of recombinant IgE, IgG1 (major IgG subclass), or IgG4 (major IgG subclass overproduced during allergen-specific immunotherapy) against the house dust mite allergen Derp 2 were prepared in PBS. The three groups of samples were analyzed using an IgE LuLISA.

[0204] As expected, the concentration-dependent signal appeared only in samples containing anti-Derp2sIgE, with a detection limit of approximately 5 × 10⁻⁶. -13 MsIgE (approximately 1 pg / mL; approximately 0.0004 kUA / L) Figure 2 ).

[0205] Similar experiments were performed on recombinant human anti-ovalbumin IgE. Recombinant human anti-ovalbumin (OVA) IgE was diluted to a specified concentration in PBS and incubated with plate-bound OVA. Antibody levels were bioluminescently detected using anti-IgE sdAb026-nanoKAZ via LuLISA.

[0206] High sensitivity was also achieved against recombinant anti-ovalbumin (OVA) IgE; LuLISA could detect concentrations of anti-OVA IgE as low as 5 pg / mL (approximately 0.002 kUA / L). Figure 3 and Figure 4 ).

[0207] Dilute recombinant anti-ovalbumin (OVA) IgE in PBS to the specified concentration. Assess OVA sIgE levels using aliquots from the same dilution using either LuLISA or ELISA. LuLISA is significantly more sensitive than standard ELISA for sIgE detection. Figure 4 ).

[0208] Next, using recombinant OVA sIgE diluted in plasma from 30 healthy donors, the dynamic range and sensitivity of IgELuLISA were compared with those of standard ImmunoCAP. Figure 5 This head-to-head comparison showed that LuLISA significantly improved analytical sensitivity (approximately 250-fold) compared to ImmunoCAP. Figure 5 ).

[0209] A similar experiment was conducted using a series of dilutions of plasma samples from subjects with severe peanut allergies (which were then diluted again in a pool of plasma from 30 healthy donors). Figure 6 ImmunoCAP allows for the detection of peanut sIgE in plasma diluted up to 4050 times, while peanut sIgE is still detectable by LuLISA in allergic plasma diluted 100,000 to 300,000 times. Figure 6 ).

[0210] The effect of the concentration of the anti-IgE nanobody-luciferase fusion protein on the bioluminescent detection of IgE by LuLISA was then investigated. 1 µL of plasma from peanut-allergic subjects (peanut-specific IgE ImmunoCAP value: 2186 kU / L) was diluted in 50 µL PBS and incubated with plate-bound peanut extract (PBS alone served as a control). Bioluminescent detection of peanut-specific IgE levels by LuLISA was performed at a specified concentration of the anti-IgE nanobody-luciferase tandem (sdAb026-nanoKAZ). At a fixed (1:50) dilution of this peanut-allergic plasma sample, the dilution series of the anti-IgE nanobody-luciferase fusion protein yielded a concentration-dependent signal, confirming a very low bioluminescent background signal for IgE by LuLISA. Figure 7 ).

[0211] In summary, these results demonstrate that IgE LuLISA possesses very high sensitivity and specificity, and therefore has the potential to be used to quantify IgE in samples from patients with very low sIgE levels. The main advantage of IgE LuLISA compared to ImmunoCAP is that it requires a significantly smaller sample volume. Figure 6Peanut sIgE was still detectable in samples from peanut-allergic patients using initial patient samples smaller than 1 nanoliter. Therefore, even with limited patient sample volumes, IgELuLISA can be used to envision very large-scale sIgE screening against a potential allergen array.

[0212] The method was then further validated by measuring sIgE against total peanut extract or against the major peanut allergens Ara h 1 and Ara h 2 using 1 µL plasma from 31 healthy donors (obtained from the French blood bank EFS, with unknown allergic status) and 82–105 peanut-allergic subjects (collected when they joined the following study approved by the Institutional Review Board: peanutoral immunotherapy study: safety, efficacy and discovery trial; ClinicalTrials.gov Identifier: NCT02103270).

[0213] A dilution series from a reference sample with titrated high peanut sIgE was used for calibration of the assay to ensure that all plasma samples were analyzed within the detection linearity range of our method. Figure 8 ).

[0214] As expected, significantly higher levels of peanut sIgE, Ara h 1 sIgE, and Ara h 2 IgE were detected in plasma samples from peanut-allergic subjects compared to healthy donors. Figure 9 , Figure 10 and Figure 11 ).

[0215] Head-to-head comparisons of LuLISA and ImmunoCAP in allergy patients showed a high correlation between the two methods (peanut sIgE, Ara h 1 sIgE, and Ara h 2 sIgE were R...). 2 =0.89, 0.84 and 0.83) Figure 12 , Figure 13 and Figure 14 These correlations were calculated using all plasma samples with sIgE levels above the ImmunoCAP detection limit (0.1 kUA / L). This was the case for all samples with peanut sIgE. However, 17 out of 82 samples (19.7%) with Arah 1 sIgE and 3 out of 96 samples (3.1%) with Arah 2 sIgE were below the ImmunoCAP detection limit (…). Figure 12 , Figure 13 and Figure 14However, as assessed by a double-blind, placebo-controlled food challenge (DBPCFC) and skin prick test, all of these subjects showed a clear clinical responsiveness to peanuts (Table 9).

[0216] Table 9 In summary, these results demonstrate that IgE LuLISA has high sensitivity and accuracy for the clinical detection of sIgE, and requires very little plasma volume.

[0217] Besides ImmunoCAP, several other methods for detecting sIgE have been reported, including IMMULITE and the more recent isotype-specific agglutination PCR (ISAP) (Hamilton RG et al., 2008; Tsai CT et al., 2018). IMMULITE appears to be the closest to LuLISA because it uses a chemiluminescent method to detect sIgE. However, the reported limit of detection for sIgE by IMMULITE is the same as that of ImmunoCAP (0.1 kUA / L). Similar to LuLISA, sIgE can be detected by ISAP using 1 µl of clinical sample. However, the two tests are based on different methods because ISAP requires chemically synthesized allergen-DNA (for each type of allergen) and a secondary anti-IgE antibody-DNA conjugate for detecting sIgE by quantitative PCR.

[0218] IgE LuLISA is a test strip (lateral flow) used to test serum IgE in infants with cow's milk allergy. Results are shown in... Figure 15 middle.

[0219] These tests are designed to demonstrate the application of LuLISA in emergency situations, such as detecting specific IgE in patients undergoing surgery for curare (anesthetic), amoxicillin (antibiotic), and latex (glove), or detecting allergies to milk compounds in newborns in pediatric emergencies.

[0220] This allows for the adaptation of finger-prick blood sampling to sIgELuLISA in patients receiving omarumab treatment in a routine and timely manner, enabling adjustment of the injection dose based on the amount of free sIgE detected.

[0221] Compared to ELISA, LuLISA requires less sample volume and has expanded performance, allowing for broader applications such as plotting affinity profiles or spectra for sera potentially containing more than one IgE molecule species. LuLISA uses a series of allergen dilutions mixed with constant concentrations of serum for competitive testing. IgE detection is related to light intensity. IgE detection at each allergen concentration range is a method to assess whether there are very high (below picomolar), high (nanomolar), moderate (10 to 100 nanomolar), or low (micromolar and above) affinity immunoglobulins for the allergen. Higher affinity, saturation, and aggregation of IgE receptors on the surface of mast cells, basophils, and macrophages result in stronger histamine and cytokine responses and a higher risk of anaphylactic shock. Affinity profiles are used to track relevant patients undergoing desensitization therapy, guiding treatment strategies to stop the challenge of increasing allergen levels, controlling short-term responses with antihistamines, or clearing high-affinity IgE with IgG Fc receptor binding site competitors (omalizumab).

[0222] In summary, IgE LuLISA is a novel, highly sensitive method for detecting sIgE, requiring only a very small (1 µL or less) plasma sample volume. Compared to classic colorimetric (ELISA) or fluorescent (ImmunoCAP) IgE detection methods, the use of bioluminescence significantly improves sensitivity and provides an extended concentration dynamic range. This method is fully automated and utilizes commercially available plates and standard photometers for bioluminescent IgE detection. Therefore, IgE LuLISA should be more cost-effective than conventional ImmunoCAP.

[0223] Example 3: Luciferase immunosorbent assay for SARS-CoV-2 serology Materials and methods: Human plasma and serum Samples were obtained from serum from the CORSER cohort (n=164; IcareB), serum from longitudinal follow-up in the observation and monitoring protocol of the Intensive Medicine and Resuscitation service at Cochin, Assistance Publique des Hôpitaux de Paris (APHP) (n=20), and serum and plasma (frozen plasma n=20, frozen serum n=20) from healthy donors collected in December 2019 from the French Blood Bank (Etablissement Français du Sang, EFS). Pre-pandemic frozen serum from 664 healthy donors was obtained from the French Blood Bank (Etablissement Français du Sang, EFS).

[0224] Fusion protein anti-IgG nanobody-luciferase Design and synthesize plasmids encoding anti-IgG nanobody-luciferase fusion protein (pET23-fc1-nanoKAZ or pET23-fc10-nanoKAZ, encoded as fc1 in SEQ ID NO: 62, fc10 in SEQ ID NO: 63, and jaz572 in SEQ ID NO: 10, respectively; or pET23-fc1-jaz572 or pET23-fc10-jaz572, encoded as fc1 in SEQ ID NO: 62, fc10 in SEQ ID NO: 63, and jaz572 in SEQ ID NO: 10, respectively). nanoKAZ is from Oplophorus gracilirostris Optimized sequence of the luciferase catalytic domain of (WO2012 / 061530). Jaz572 (SEQ ID NO: 10) is derived from nanoKAZ and has enhanced catalytic activity to increase photon emission and signal, and reduced aggregation and surface adsorption behavior to reduce noise and contribute to a better signal-to-noise ratio.

[0225] The genes nanoKAZ and JAZ572 were synthesized by Eurofins (Germany) and contain a carboxyl-terminal His6-tag and a flanking region corresponding to the pET23 sequence (Novagen). The pET23 plasmid was amplified using forward and reverse oligonucleotides (forward: 5'CTCGAGCACCACCACCACCACCAC3' (SEQ ID NO: 47); reverse: 5'GGTATATCTCCTTCTTAAAGTTAAAC3' (SEQ ID NO: 48), Eurofins), using Q5 DNA polymerase and dNTP mixture (New England BioLabs). PCR products were purified by agarose gel electrophoresis (1%, Macherey Nagel). The purified pET23 vector and the synthesized gene (pET23-nanoKAZ or pET23-jaz572) were assembled using NEBuilder HiFi assembly premix (New England BioLabs).

[0226] The IgG binding portion is derived from an IgG-selective humanized heavy chain antibody (single-domain antibody) (US 10,259,886 B2). FC1 recognizes constant fragment regions of human IgG1, IgG2, IgG3, and IgG4, with the following dissociation constants at equilibrium: KD values ​​of 0.57 nM, 1.73 nM, 47.8 nM, and 0.30 nM, respectively, and a KD of 3.25 nM for all IgGs (US 10,259,886 B2). FC10 recognizes constant fragment regions of human IgG1, IgG2, IgG3, and IgG4, with the following dissociation constants at equilibrium: KD values ​​of 2.62 nM, 7.29 nM, 8.99 nM, and 12.3 nM, respectively, and a KD of 3.25 nM for all IgGs (US 10,259,886 B2).

[0227] Gene fc1 and fc10 Synthesized by Eurofins, it contains flanking regions corresponding to the pET23-nanoKAZ sequence. The synthesized gene has been amplified using the corresponding forward and reverse oligonucleotides and a mixture of Q5 DNA polymerase and dNTPs. fc1 or fc10 .

[0228] PCR products were purified by agarose gel electrophoresis. The purified pET23-nanoKAZ and pET23-jaz572 vectors and the synthesized gene were assembled using NEBuilder HiFi assembly premix (New-England Biolabs). fc1 or fc10 .

[0229] The assembly product (5 mL) was used to transform NEB 5-α competent *E. coli* and grown overnight in petri dishes on LB / agar / ampicillin. The isolated colonies were grown in liquid medium, and plasmids were isolated and sequenced to confirm the presence of fc1-nanoKAZ or fc10-nanoKAZ, fc1-jaz573, or fc10-jaz573 inserts.

[0230] The complete sequences of the anti-IgG nanobody luciferase tandem FC1-nanoKAZ or FC10-nanoKAZ ([anti-IgG nanobody]-[nanoKAZ]-[His6]) are shown in examples in Table 10 below: Table 10 The estimated molecular weights (MW) of FC1-nanoKAZ and FC10-nanoKAZ calculated from their sequences are 34,115 and 33,588 Daltons, respectively.

[0231] The expression, purification, and validation of the anti-IgG nanobody-luciferase fusion protein were performed in the same manner as the anti-IgE nanobody-nanoKAZ (sdAb026-nanoKAZ). Protocol for detecting SARS-CoV-2 protein N and S-specific IgG using luciferase enzyme-linked immunosorbent assay (LuLISA) IgG luciferase immunosorbent assay (LuLISA) protocol Adsorption is achieved by coating flat-bottomed white 96- or 384-well plates (Fluoronunc C96 Maxisorp, Nunc) with 1 μg / mL of nucleoprotein, spike protein, or fragment thereof in 50 μL / well phosphate-buffered saline at pH 7.4 (Sigma) for 2 hours at room temperature or overnight at 4°C. Adsorption on Maxisorp® plates facilitates charge-electric interactions. Alternative adsorption methods include covalent binding of the target via carboxyl, amine, or thiol moieties, glycosylation on the functionalized well surface, or coating with polylysine. The wells are then emptied, but neutralization with BSA (1 mg / mL) or 3% skim milk is not always necessary. The wells are washed 3 to 6 times with 100 µL PBS / Tween 200.1%. At room temperature, incubate diluted serum (typically 1 / 200), plasma, or body fluid in their respective antigen-coated wells for 30 min to 1 hour in phosphate-buffered saline, 50 µL / well, ultimately containing 3% skim milk, 1 mg / mL bovine serum albumin, 1-3% bovine serum, and / or 0.1% Tween 20. Wash the wells three to six times with 100 µL PBS / Tween 20 0.1%. Purified VHH-nanoKAZ 1 ng / mL (5.10) is added to the phosphate-buffered saline. 7 RLU.s -1 .mL -1The final solution was loaded with 3% skim milk, 1 mg / mL bovine serum albumin or 1-3% bovine serum and / or 0.1% Tween 20 (50 µL / well) and incubated at room temperature for 20-30 min. The wells were washed four times with 100 µL PBS / Tween 20 0.1%. The plate could be stored in PBS until measurement. Each well was emptied and loaded with 50 µL of 27 µM furimazine (8-benzyl-2-(furan-2-ylmethyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one) or 13 µM Q108, and read immediately. The plate was shaken on the track for 5 seconds, and the light emission intensity per well was integrated over 0.5-1 second using a multi-well plate spectrophotometer (LB960 Centro, Berthold).

[0232] result SARS-CoV2 protein N-specific IgG has been titrated by luciferase-linked immunosorbent assay (LuLISA) in serum from the CORSER cohort (n=164; IcareB), in serum from longitudinal follow-up in the observation and monitoring protocol of the intensive care and rehabilitation services at Cochin, Assistance Publique des Hôpitaux de Paris (APHP) (n=20), and in serum and plasma (frozen plasma n=20, frozen serum n=20) from healthy donors sampled in December 2019 from the French Blood Bank (EFS).

[0233] The results are shown in Figure 16 middle.

[0234] SARS-CoV2 spike protein (S)-specific IgG has been titrated by LuLISA in serum (n=20) from longitudinal follow-up of the observation and monitoring protocol of the intensive care and rehabilitation services of Cochin, Assistance Publique des Hôpitaux de Paris (APHP), and in frozen serum (n=4) from healthy donors of EFS.

[0235] The results are shown in Figure 17 middle.

[0236] The correlation between titrations of SARS-CoV2 protein N-specific IgG and SARS-CoV2 protein S-specific IgG in sera from APHP-Cochin (n=20) and EFS (n=4) is shown in the figure. Figure 18 middle.

[0237] Then, the specific IgGs for SARS-CoV1 protein N and SARS-CoV2 protein N, as well as SARS-CoV1 protein S and SARS-CoV2 protein S, were compared between patient serum (APHP-Cochin n=20) and frozen serum from healthy donors (EFS n=4).

[0238] The results are shown in Figure 19 and Figure 20 middle.

[0239] Serum from APHP-Cochin (n=20) and EFS (n=4), in duplicate, can be used for emergency testing on 96-well plates within 5 minutes by reducing incubation time: for serum at room temperature or even better at 37°C, incubate for 3 minutes, followed by 17 seconds for each wash (Zoom HT plate washer, Berthold), and 1 minute for anti-IgG VHH-nanoKAZ. Coefficient of determination R0 2 The value is 0.75. The results are shown in... Figure 21 middle.

[0240] This invention relates to the following embodiments: 1. A fusion protein comprising: - N-terminal domain, which contains variable domains or single-chain variable fragments (scFVs) as heavy chain antibodies against camel protein (VHH) and other antibodies. and - C-terminal domain, which contains a polypeptide with luciferase activity: - Having the amino acid sequence SEQ ID NO: 1 or - It has at least 80% amino acid sequence identity with the amino acid sequence SEQ ID NO: 1.

[0241] 2. The fusion protein according to Project 1, wherein the polypeptide having luciferase activity has an amino acid sequence selected from the following: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, and SEQ ID NO: 17.

[0242] 3. The fusion protein according to Project 1 or 2, wherein the VHH targets a constant fragment (Fc) of an immunoglobulin.

[0243] 4. The fusion protein according to any one of items 1 to 3, wherein the antibody is VHH.

[0244] 5. The fusion protein according to any one of items 1 to 4, wherein the immunoglobulin is IgE against an allergen.

[0245] 6. The fusion protein according to any one of items 1 to 4, wherein the immunoglobulin is an IgM or IgG against protein N or S of severe acute respiratory syndrome coronavirus 2.

[0246] 7. A reagent kit comprising: - The fusion protein according to any one of items 1 to 6, and - Substrates of peptides with luciferase activity.

[0247] 8. The use of any one of the fusion proteins in Items 1 to 6 for the detection and / or quantification of immunoglobulins in a sample.

[0248] 9. A method for detecting the presence of immunoglobulins in a sample, the method comprising the following steps: (a) Contact the sample with the fusion protein described in any one of items 1 to 6. (b) Adding a substrate of a polypeptide with luciferase activity, (c) Detection of luminescence.

[0249] 10. A method for quantifying the level of immunoglobulins in a sample, the method comprising the steps of: (a) Contact the sample with the fusion protein described in any one of items 1 to 6. (b) Adding a substrate of a polypeptide with luciferase activity, (c) Quantized luminescence.

[0250] 11. A method for quantifying the level of immunoglobulins at each affinity interval in a sample to assess the affinity range of a mixture of polyclonal immunoglobulins, the method comprising the steps of: (a) In the presence of a dilution series of free antigen, the sample is brought into contact with the antigen. (b) Contact the sample with the fusion protein described in any one of items 1 to 6. (c) Adding a substrate containing a polypeptide with luciferase activity, and (d) Quantify luminescence and plot the relationship between light intensity and antigen concentration.

[0251] 12. A luciferase having at least 80% amino acid sequence identity with the amino acid sequence SEQ ID NO: 1, and comprising at least one amino acid substitution selected from: - Replace the tyrosine (Y) at position 18 of SEQ ID NO: 1 with arginine (R). - Replace the leucine (L) at position 48 of SEQ ID NO: 1 with lysine (K). - Replace the isoleucine (I) at position 56 of SEQ ID NO: 1 with alanine (A). - Replace the tyrosine (Y) at position 116 of SEQ ID NO: 1 with phenylalanine (F). - Replace the tryptophan (W) at position 134 of SEQ ID NO: 1 with an amino acid selected from threonine (T) and glutamic acid (E). - Replace the tryptophan (W) at position 163 of SEQ ID NO: 1 with an amino acid selected from threonine (T) and glutamic acid (E). and - Replace the cysteine ​​(C) at position 166 of SEQ ID NO: 1 with serine (S).

[0252] 13. A luciferase having an amino acid sequence selected from the following: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, and SEQ ID NO: 17.

[0253] 14. Use of the luciferase described in item 12 or 13 in luminescence reactions.

[0254] 15. A method comprising the following steps: (a) Exposing the luciferase described in item 12 or 13 to the substrate, and (b) Detection of luminescence.

[0255] 16. A kit comprising the luciferase described in item 12 or 13, and - The substrate of the luciferase.

[0256] 17. The kit according to item 7 or 16, wherein the substrate is 8-(2,3-difluorobenzyl)-2-((5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one.

[0257] References Throughout this application, various references describe the prior art to which this invention pertains. The disclosures of these references are incorporated herein by reference.

[0258] Coutant EP, Gagnot G, Hervin V, Baatallah R, Goyard S, Jacob Y, RoseT, Janin YL. Bioluminescence Profiling of NanoKAZ / NanoLuc Luciferase Using aChemical Library of Coelenterazine Analogues. Chemistry. 2020 Jan 16; 26(4): 948-958. Jabs F, Plum M, Laursen NS, Jensen RK, Molgaard B, Miehe M, et al. Trapping IgE in a closed conformation by mimicking CD23 binding prevents anddisrupts FcepsilonRI interaction. Nat Commun 2018;9:7. Canonica GW, Ansotegui IJ, Pawankar R et al. A WAO - ARIA - GA(2)LENconsensus document on molecular-based allergy diagnostics. World AllergyOrgan J. 2013;6(1):17. van Hage M, Hamsten C, Valenta R. ImmunoCAP assays: Pros and cons inallergology. J Allergy Clin Immunol. 2017;140(4):974-977. Inouye S, Sato J, Sahara-Miura Y, Yoshida S, Hosoya T. Luminescence enhancement of the catalytic 19 kDa protein (KAZ) of Oplophorus luciferase by three amino acid substitutions. Biochem Biophys Res Commun. 2014;445(1):157-162. Gasser P, Tarchevskaya SS, Guntern P et al. The mechanistic and functional profile of the therapeutic anti-IgE antibody ligelizumab differs from omalizumab. Nat Commun. 2020;11(1):165. Mukai K, Gaudenzio N, Gupta S et al. Assessing basophil activation by using flow cytometry and mass cytometry in blood stored 24 hours before analysis. J Allergy Clin Immunol. 2017;139(3):889-899 e811. Hamilton RG, Franklin Adkinson N, Jr. In vitro assays for the diagnosis of IgE-mediated disorders. J Allergy Clin Immunol. 2004;114(2):213-225; quiz 226. Tsai CT, Mukai K, Robinson PV et al. Isotype-specific agglutination-PCR (ISAP): A sensitive and multiplex method for measuring allergen-specific IgE. J Allergy Clin Immunol.2018;141(5):1901-1904 e1915. Li TM, Chuang T, Tse S, Hovanec-Burns D, El Shami AS. Development and validation of a third generation allergen-specific IgE assay on the continuous random access IMMULITE 2000 analyzer. Ann Clin Lab Sci. 2004;34(1):67-74. Tomabechi Y, Hosoya T, Ehara H, Sekine SI, Shirouzu M, Inouye S. Crystal structure of nanoKAZ: The mutated 19 kDa component of Oplophorus luciferase catalyzing the bioluminescent reaction with coelenterazine. Biochem Biophys Res Commun. 2016;470(1):88-93. Shimomura O, Masugi T, Johnson FH, Haneda Y., Properties and reaction mechanism of the bioluminescence system of the deep-sea shrimp Oplophorus gracilirostris . Biochemistry. March 21, 1978;17(6):994-8. Hall MP, Unch J, Binkowski BF, Valley MP, Butler BL, Wood MG, Otto P,Zimmerman K, Vidugiris G, Machleidt T, Robers MB, Benink HA, Eggers CT,Slater MR, Meisenheimer PL, Klaubert DH, Fan F, Encell LP, Wood KV shrimp utilizing a novelimidazopyrazinone substrate. ACS Chem Biol. 11 / 16 / 2012:7(11):1848-5

Claims

1. A luciferase having at least 95% amino acid sequence identity with the amino acid sequence SEQ ID NO: 1, and comprising at least one amino acid substitution selected from: - Replace the tyrosine (Y) at position 18 of SEQ ID NO: 1 with arginine (R). - Replace the leucine (L) at position 48 of SEQ ID NO: 1 with lysine (K). - Replace the tyrosine (Y) at position 116 of SEQ ID NO: 1 with phenylalanine (F). - Replace the tryptophan (W) at position 134 of SEQ ID NO: 1 with an amino acid selected from threonine (T) and glutamic acid (E), and - Replace the tryptophan (W) at position 163 of SEQ ID NO: 1 with an amino acid selected from threonine (T) and glutamic acid (E).

2. The luciferase according to claim 1, wherein, The luciferase has an amino acid sequence selected from the following: SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO:

16.

3. A method comprising the following steps: (a) Exposing the luciferase according to claim 1 to a substrate, and (b) Detection of luminescence.

4. A kit comprising the luciferase according to claim 1 and The substrate of the luciferase.

5. The kit according to claim 4, wherein, The substrate is 8-(2,3-difluorobenzyl)-2-((5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one.

6. The luciferase according to claim 1, wherein, The tryptophan (W) at position 134 of SEQ ID NO: 1 will be replaced with glutamic acid (E) and / or the tryptophan (W) at position 163 of SEQ ID NO: 1 will be replaced with glutamic acid (E).

7. The luciferase according to claim 1, wherein, The tyrosine (Y) at position 18 of SEQ ID NO: 1 will be replaced with arginine (R), the leucine (L) at position 48 of SEQ ID NO: 1 will be replaced with lysine (K), the tryptophan (W) at position 134 of SEQ ID NO: 1 will be replaced with glutamic acid (E), and the tryptophan (W) at position 163 of SEQ ID NO: 1 will be replaced with glutamic acid (E).

8. The luciferase according to claim 1, wherein, The tyrosine (Y) at position 18 of SEQ ID NO: 1 will be replaced with arginine (R), the leucine (L) at position 48 of SEQ ID NO: 1 will be replaced with lysine (K), the tyrosine (Y) at position 116 of SEQ ID NO: 1 will be replaced with phenylalanine (F), the tryptophan (W) at position 134 of SEQ ID NO: 1 will be replaced with glutamic acid (E), and the tryptophan (W) at position 163 of SEQ ID NO: 1 will be replaced with glutamic acid (E).

9. The luciferase according to claim 1, wherein, The tyrosine (Y) at position 18 of SEQ ID NO: 1 will be replaced with arginine (R), the leucine (L) at position 48 of SEQ ID NO: 1 will be replaced with lysine (K), the tyrosine (Y) at position 116 of SEQ ID NO: 1 will be replaced with phenylalanine (F), the tryptophan (W) at position 134 of SEQ ID NO: 1 will be replaced with glutamic acid (E), the tryptophan (W) at position 163 of SEQ ID NO: 1 will be replaced with glutamic acid (E), and the cysteine ​​(C) at position 166 of SEQ ID NO: 1 will be replaced with serine (S).

10. A fusion protein comprising: - N-terminal domain, which contains a variable domain or single-chain variable fragment (scFV) antibody as a camel heavy chain antibody (VHH), wherein the antibody targets immunoglobulin and - C-terminal domain, which contains the luciferase as described in claim 1.

11. A reagent kit comprising: - The fusion protein according to claim 10, and - Substrates of peptides with luciferase activity.

12. A method for detecting the presence of immunoglobulins in a sample, comprising the following steps: (a) Contact the sample with the fusion protein according to claim 10, (b) Adding a substrate of a polypeptide with luciferase activity, (c) Detection of luminescence.

13. A method for quantifying the level of immunoglobulins in a sample, comprising the following steps: (a) Contact the sample with the fusion protein according to claim 10, (b) Adding a substrate of a polypeptide with luciferase activity, (c) Quantized luminescence.

14. A method for quantifying the affinity range of immunoglobulins at each affinity interval in a sample to assess the affinity range of a mixture of polyclonal immunoglobulins, comprising the steps of: (a) Contacting the sample with the antigen in the presence of a dilution series of free antigen. (b) Contact the sample with the fusion protein according to claim 10. (c) Adding a substrate containing a polypeptide with luciferase activity, (d) Quantized luminescence, and (e) Plot the relationship between luminescence intensity and antigen concentration to quantify the affinity range of immunoglobulins for antigens in the sample.

15. A fusion protein comprising: - N-terminal domain, which contains peptide antigens and - C-terminal domain, which contains the luciferase as described in claim 1.

16. A reagent kit comprising: - The fusion protein according to claim 15, and - Substrates of peptides with luciferase activity.

17. A method for detecting the presence of antibodies in a sample, comprising the following steps: (a) Contact the sample with the fusion protein according to claim 15, (b) Adding a substrate of a polypeptide with luciferase activity, (c) Detecting luminescence, The antibody mentioned above targets the peptide antigen.

18. A recombinant polynucleotide encoding the luciferase of claim 1.

19. A vector comprising the recombinant polynucleotide of claim 18.

20. A cell comprising the polynucleotide of claim 18.

21. The luciferase according to claim 1, wherein, The luciferase further comprises at least one amino acid substitution selected from the following: - Replace isoleucine (I) at position 56 of SEQ ID NO: 1 with alanine (A), and - Replace cysteine ​​(C) at position 166 of SEQ ID NO: 1 with serine (S).

Images