A method for producing grass carp sperm based on morpholino antisense oligonucleotide, a detection primer set and application thereof

Abstract

The application discloses a method for producing grass carp sperm by using goldfish as a surrogate, a detection primer set and application, and belongs to the technical field of fish genetic breeding. The method comprises the following steps: preparing a sterile goldfish receptor without endogenous germ cells by embryo microinjection of a morpholino antisense oligonucleotide; screening a suitable grass carp; obtaining a testis of the grass carp and treating the testis by using a protease to obtain a grass carp spermatogonial stem cell suspension; and transplanting the grass carp spermatogonial stem cell suspension into a sterile goldfish fry, so that the donor grass carp sperm can be produced after the receptor goldfish matures. Compared with a traditional breeding method, the method provided by the application can significantly shorten the time for obtaining grass carp gametes, improve the breeding efficiency, and provide a set of efficient and reliable grass carp cross-species sperm production technical system and a new method for aquaculture breeding.

Description

Technical Field

[0001] This invention belongs to the field of aquaculture and fish genetic breeding technology, and particularly relates to a method for goldfish surrogacy to produce grass carp sperm based on morpholino antisense oligonucleotides, as well as the detection primer set and application. Background Technology

[0002] Fish reproductive stem cell transplantation technology refers to the implantation of donor reproductive stem cells (such as primordial germ cells, spermatogonial stem cells, or oogonial stem cells) into a recipient fish. Once the recipient fish matures and produces functional gametes from the donor, this technology is also figuratively called "surrogate reproduction." Fish reproductive stem cell transplantation was first successfully implemented in the zebrafish (Ciruna et al., 2002). After more than twenty years of development, the technology has achieved a series of breakthroughs, including the establishment of transplantation systems using embryos, larvae, and adult fish as recipients, broadening the selection range of donor reproductive stem cells, and improving recipient screening and processing methods (Ye Huan et al., 2020). Practice has proven that this technology has significant application potential in shortening the sexual maturity cycle of fish, sex-controlled breeding, and the protection of rare and endangered species, and has been successfully applied in various freshwater and marine fish species.

[0003] Grass carp (Ctenopharyngodon idella) is the largest single-species aquaculture economic fish in my country, but its germplasm degradation is becoming increasingly prominent, seriously hindering the healthy and sustainable development of the grass carp aquaculture industry. Grass carp have a long initial sexual maturity cycle (4-5 years), and traditional breeding methods are slow in developing new varieties. Therefore, there is an urgent need to develop new breeding technologies to accelerate the creation of new grass carp germplasm. Although some studies have reported the production of grass carp sperm through endogamy using sterile recipient zebrafish (Ye et al., 2026), the limited sperm production (approximately 1 μL) is due to the fact that zebrafish germ cells only develop into males after removal, and the small size of zebrafish restricts its application in grass carp breeding and production.

[0004] Goldfish (Carassius auratus), small fish of the Cyprinidae family, reach sexual maturity in just 5 months. They produce far more eggs and sperm than zebrafish, and can be artificially bred year-round under controlled conditions. More importantly, sex differentiation in goldfish does not depend on the presence of germ cells; even in the early stages of embryonic development where germ cells are completely absent, sterile individuals can still develop into both females and males (Goto et al., 2012). Therefore, goldfish have unique advantages as recipients in grass carp reproductive stem cell xenotransplantation research. Thus, utilizing goldfish as recipients for surrogacy to obtain grass carp gametes holds promise for fully leveraging these advantages, overcoming the existing technological bottleneck of the long reproductive cycle of grass carp, and providing a new solution for efficient grass carp breeding and germplasm resource preservation.

[0005] However, several technical challenges remain in performing reproductive stem cell transplantation between different species. First, it is necessary to effectively isolate and obtain grass carp reproductive stem cells while maintaining their viability. Second, it is necessary to prepare sterile goldfish without endogenous germ cells as recipients to eliminate competition and provide "vacant sites" for donor cell colonization. Finally, it is necessary to establish sensitive and reliable detection methods to identify whether the transplanted goldfish gonads have successfully colonized and produced germ cells or gametes from the donor grass carp.

[0006] Traditional methods for detecting germ cells in transplanted fish often rely on interspecies genomic DNA differential analysis. For example, after the transplanted fish produces mature gametes, the genomic DNA of the gamete cells is analyzed to confirm its species origin. However, this method is not rigorous for chimeric gonads that have not yet produced mature gametes. Even if DNA fragments of the donor species are detected in the gonads of the recipient fish, it cannot be determined that the DNA necessarily originated from the donor's germ cells (the same fragments may be present in the DNA of other somatic cells). Germ cells have specific gene expression profiles, so a more reliable method is to detect transcripts (mRNA) of genes specifically expressed in the germ cells of the donor species. For example, the vasa gene is highly specifically expressed in germ cells. Primers designed to differentiate the sequence of the vasa gene between the donor grass carp and the recipient goldfish can be used for RT-PCR detection, which can sensitively determine whether germ cells from the donor grass carp are present in the recipient gonads. Furthermore, when the donor is a male fish, the species origin and function of the sperm can be confirmed by morphological examination and molecular detection (such as amplifying sperm DNA with species-specific primers) of the sperm produced by the recipient fish. The combination of these techniques helps to comprehensively assess the success of cross-species germline transplantation.

[0007] However, to date, there have been no publicly reported cases of grass carp reproductive stem cells being transplanted into goldfish and producing grass carp gametes. Whether reproductive cell transplantation between different species, especially between different genera, can successfully colonize and produce gametes remains uncertain. Summary of the Invention

[0008] To address the aforementioned technological gaps, the present invention aims to provide a method for producing grass carp sperm via goldfish surrogacy based on morpholino-based antisense oligonucleotides, along with a detection primer set and its applications. This invention, through the method of producing grass carp sperm via goldfish surrogacy, can obtain grass carp sperm in a shorter time, significantly improving breeding efficiency. This invention effectively solves the problems of long grass carp breeding cycles, low breeding efficiency, and the lack of effective detection methods for cross-species germ cell transplantation in existing technologies, and has broad application prospects.

[0009] To achieve the above objectives, the present invention is implemented through the following solution:

[0010] This invention provides a morpholino antisense oligonucleotide for goldfish surrogacy to produce grass carp sperm, the sequence of which is shown in SEQ ID No. 16.

[0011] The present invention also provides the application of the aforementioned morpholino antisense oligonucleotide in the production of grass carp sperm by goldfish surrogacy.

[0012] Furthermore, the method for goldfish surrogacy to produce grass carp sperm specifically includes the following steps:

[0013] S1: The morpholino antisense oligonucleotide was microinjected into the 1-cell stage of the fertilized eggs of goldfish larvae to block the migration of endogenous primordial germ cells in the goldfish embryo, thereby preparing sterile recipient goldfish larvae without endogenous germ cells as transplant recipients.

[0014] S2: Use grass carp to prepare a suspension of grass carp spermatogonial stem cells as a transplant donor;

[0015] S3: Transplant the grass carp spermatogonial stem cell suspension into the infertile goldfish fry to obtain transplanted goldfish;

[0016] S4: The transplanted goldfish are raised normally, and the raised transplanted goldfish are able to produce grass carp sperm.

[0017] Furthermore, in step S3, the grass carp spermatogonial stem cell suspension is transplanted to the primordium of the reproductive crest of the infertile goldfish fry via microinjection, and the amount of grass carp spermatogonial stem cell suspension used is 1-2 μL / goldfish fry.

[0018] Furthermore, the preparation of the grass carp spermatogonial stem cell suspension includes the following steps:

[0019] (1) Select sexually immature grass carp and take their testicular tissue;

[0020] (2) The testis tissue was cut into pieces and placed in a protease digestion solution for enzymatic hydrolysis, incubation and filtration to obtain spermatogonial stem cells. The spermatogonial stem cells were resuspended and washed to obtain a grass carp spermatogonial stem cell suspension.

[0021] Furthermore, the components and mass percentages of the protease digestion solution specifically include: trypsin 0.2-0.3%, collagenase H 1-3%, fetal bovine serum 1-5%, and DNase I 0.05-0.1% by mass of the protease digestion solution; the pH of the protease digestion solution is approximately 7.0-8.0; and the total volume of the protease digestion solution is 3-6 times that of the testicular tissue.

[0022] Furthermore, the goldfish fry mentioned in step S1 are selected from goldfish fry that are less than 5 days old after hatching; the grass carp in step S2 weighs 2.8~3.8kg.

[0023] Furthermore, in step S3, the grass carp spermatogonial stem cell suspension is transplanted to the primordium of the reproductive crest of the infertile goldfish fry via microinjection, and the amount of grass carp spermatogonial stem cell suspension used is 1-2 μL / goldfish fry.

[0024] The present invention also provides a primer set for detecting germ cells derived from grass carp or goldfish. The primer set includes mRNA-specific primers for the vasa gene of grass carp and goldfish. The sequences of the mRNA-specific primers for the vasa gene of grass carp are shown in SEQ ID No. 1 and SEQ ID No. 2, and the nucleotide sequence of the amplified grass carp-specific fragment is shown in SEQ ID No. 11. The sequences of the mRNA-specific primers for the vasa gene of goldfish are shown in SEQ ID No. 3 and SEQ ID No. 4, and the nucleotide sequence of the amplified goldfish-specific fragment is shown in SEQ ID No. 12.

[0025] The present invention also provides a primer set for detecting germ cells derived from grass carp or goldfish, the primer set comprising specific primers and universal primers for the vasa gene of grass carp and goldfish. The sequences of the specific primers for the grass carp vasa gene fragment are shown in SEQ ID No. 1 and SEQ ID No. 2, and the nucleotide sequence of the amplified grass carp-specific fragment is shown in SEQ ID No. 11; the sequences of the DNA-specific primers for the goldfish vasa gene fragment are shown in SEQ ID No. 7 and SEQ ID No. 8, and the nucleotide sequence of the amplified goldfish-specific fragment is shown in SEQ ID No. 14; the sequences of the universal primers are shown in SEQ ID No. 9 and SEQ ID No. 10.

[0026] This invention also provides the application of the primer set described above in the identification and detection of recipient goldfish germ cells.

[0027] Furthermore, the PCR reaction system for detecting grass carp sperm produced by goldfish using the aforementioned primer set specifically includes: 20.0 µL: 10 µL of 2 × Phanta Flash Master Mix, 8.2 µL of dd H2O, 1 μL of cDNA template, and 0.4 μL each of upstream and downstream primers; the reaction conditions are: 98℃ for 3 min; 98℃ for 10 s, 60℃ for 20 s, with 35 cycles; extension at 72℃ for 4 s; 72℃.

[0028] Compared with the prior art, the present invention has the following advantages and positive effects:

[0029] 1. This invention provides a method for producing grass carp sperm through goldfish surrogacy, which can significantly shorten the breeding cycle and improve breeding efficiency. Grass carp require 4-5 years to reach sexual maturity, resulting in a long breeding cycle. This invention transplants grass carp spermatogonial stem cells into early-maturing goldfish, utilizing their "surrogate reproduction" to obtain functional grass carp gametes earlier, greatly shortening the breeding time and accelerating the genetic improvement process.

[0030] 2. Compared to the recipient zebrafish (whose semen volume is approximately 1 μL), the recipient goldfish produces a larger amount of grass carp semen (an average of 754 μL), making it more suitable for actual grass carp breeding and production.

[0031] 3. This invention establishes a multi-level detection system to achieve full-process monitoring of transplantation. After transplantation, this invention utilizes fluorescent labeling, gonadal tissue sections, species-specific vasa gene detection, and scanning electron microscopy to confirm that donor grass carp spermatogonial stem cells have successfully colonized the gonads of recipient goldfish, and that these cells proliferate and develop. By comprehensively employing PKH26 fluorescent labeling, tissue section observation, and species-specific vasa gene RT-PCR identification, this invention can rapidly and accurately track donor cell survival, colonization, and gametogenesis at different stages after transplantation, overcoming the lag problem of traditional reliance on offspring genotype confirmation.

[0032] 4. This invention improves the colonization success rate by optimizing the transplantation window and cell preparation. The optimal transplantation window is selected as 5 days after hatching in goldfish, when the recipient's germinal crest is not yet fully formed, facilitating donor cell embedding. Simultaneously, grass carp testis tissue during the active proliferation phase of spermatogonia is preferred. Highly active stem cells are obtained through digestion and separation, significantly improving the efficiency of germline chimera formation. Grass carp testis tissue at this stage is more suitable as a transplantation donor. This invention establishes a highly efficient and reliable grass carp cross-species sperm production technology system by integrating innovative methods such as rapid reproduction, recipient infertility, precise detection, and transplantation optimization, providing a new approach for aquaculture breeding. Attached Figure Description

[0033] Figure 1 Images show early gonadal development characteristics in goldfish; A, D, and G are images of goldfish larvae at 3, 5, and 7 days after hatching, respectively; B, E, and H are HE-stained images of cross-sections of the primordial genital ridge at the corresponding developmental stages; C, F, and I are magnified areas in B, E, and H, respectively; PGC represents primordial germ cells, and SC represents somatic cells; the scale bar in A, D, and G is 1 mm, in B, E, and H it is 100 μm, and in C, F, and I it is 20 μm.

[0034] Figure 2Sterile recipient goldfish were prepared by knocking down the dnd gene; where A represents goldfish embryos injected with only GFP-nanos3 3'UTR mRNA; and B represents goldfish embryos injected with both dnd-MO and GFP-nanos3 3'UTR mRNA. Goldfish embryos; C and D represent the ovarian and testicular tissue structure characteristics of wild-type goldfish 50 days after hatching; E and F represent the ovarian and testicular tissue structure characteristics of sterile goldfish 50 days after hatching; G and I represent the ovarian and testicular appearance characteristics of 5-month-old wild-type goldfish; H and J represent the ovarian and testicular tissue structure characteristics of 5-month-old wild-type goldfish; G and I represent the ovarian and testicular appearance characteristics of 5-month-old sterile goldfish; L and N represent the ovarian and testicular tissue structure characteristics of 5-month-old sterile goldfish; O represents the expression characteristics of germ cell-specific genes and gonadal cell-related genes in wild-type and sterile goldfish; OC represents the ovarian cavity; PO represents the primary oocyte; SG represents the spermatogonium; PSP represents the primary spermatocyte; SSP represents the secondary spermatocyte; SPD represents the spermatid; SL represents the spermatogonium; the scale bar in A and B is 0.5 mm; the scale bar in C, D, E, F, J and N is 50 μm; the scale bar in G, I, K and M is 1. cm; the scale bars for H and L are 100 μm.

[0035] Figure 3 Histological characteristics of grass carp testes at different developmental stages; where A represents the testicular genomic characteristics of 1.5-year-old grass carp; B represents the testicular genomic characteristics of 2.5-year-old grass carp; C represents the testicular genomic characteristics of 3.0-year-old grass carp; ASG represents type A spermatogonia; BSG represents type B spermatogonia; PSP represents primary spermatocytes; the scale bar in A, B, and C is 50 μm.

[0036] Figure 4 To illustrate the transplantation of grass carp spermatogonial stem cells into sterile recipients; A is an immunofluorescence image of Vasa antibody in donor grass carp testis tissue; B is a single prepared grass carp testis cell; C is PKH26-labeled donor grass carp testis cells; D is the transplantation of donor grass carp testis cells into the peritoneal cavity of sterile goldfish larvae; E is observation under a fluorescence microscope after cell injection; isolated SG represents a single, dispersed spermatogonium; paired SG represents paired spermatogonium; the scale bar in A, B, and C is 20 μm; the scale bar in E is 0.5 mm.

[0037] Figure 5Grass carp spermatogonial stem cells were chimeric into the gonads of recipient goldfish and differentiated into testes and ovaries. A and C represent the gonads of the transplant group and control group 21 days post-transplantation under white light, respectively. B and D represent the gonads of the transplant group and control group 21 days post-transplantation under red fluorescence, respectively. E and F represent the histological characteristics of the ovaries and testes of the control group 3 months post-transplantation, respectively. G and H represent the histological characteristics of the ovaries and testes of the infertile group 3 months post-transplantation, respectively. I and J represent the histological characteristics of the ovaries and testes of the successfully transplanted group 3 months post-transplantation, respectively. The scale bar in AE, G, and I is 50 μm; the scale bar in F, H, and J is 20 μm.

[0038] Figure 6 To validate the RNA-specific primers for the vasa gene in donor grass carp and recipient goldfish; O-1, O-2, and O-3 were ovaries from different individuals; T-1, T-2, and T-3 were testes from different individuals; N was the negative control; Civasa-specific primers were specific primers for the vasa gene in grass carp; Civasa-specific primers were specific primers for the vasa gene in goldfish; β-actin was the positive control.

[0039] Figure 7 To detect transplant chimeras using RNA-specific primers for the vasa gene in donor grass carp and recipient goldfish; TP-1, TP-2, TP-3, TP-4, TP-5, TP-6, TP-7, TP-8, TP-9, TP-10, TP-11, and TP-12 were gonadal tissues from different individuals 3 months post-transplantation; M was a DNA marker; Civasa was a grass carp vasa gene-specific primer; Cavasa was a goldfish vasa gene-specific primer; β-actin was a positive control.

[0040] Figure 8 Specific primers were used to validate the vasa gene DNA level of the donor grass carp and recipient goldfish; F-1, F-2, and F-3 were different female individuals; M-1, M-2, and M-3 were different male individuals; N was the negative control; Civasa-specific primers were grass carp vasa gene-specific DNA primers; Civasa-specific primers were goldfish vasa gene-specific DNA primers; and vasa common primers were the positive control.

[0041] Figure 9Results of analysis of donor grass carp semen produced by recipient goldfish. A shows the DNA level identification of sperm produced by transplanted recipient goldfish; TP-Sp1, TP-Sp2, TP-Sp3, TP-Sp4, TP-Sp5, TP-Sp6, TP-Sp7, TP-Sp8, and TP-Sp9 are semen produced by different transplanted individuals; Ci-Sp is semen produced by grass carp; Ca-Sp is semen produced by goldfish; N is the negative control; B, D, and F are scanning electron microscope images of sperm produced by grass carp, goldfish, and transplanted individuals, respectively; C, E, and G are magnified views of the rectangular regions in B, D, and F, respectively; H is a comparison of the head area of ​​sperm produced by grass carp, goldfish, and transplanted individuals; I is a comparison of the concentration and volume of semen produced by goldfish and transplanted individuals; the scale bar in B, D, and F is 5 μm; the scale bar in C, E, and G is 1 μm.

[0042] Figure 10 Key sperm motility parameters measured by a computer-aided sperm motility analysis system: PMOT (progressive sperm motility percentage), VSL (linear velocity), VCL (curvilinear velocity), and VAP (average path velocity). Detailed Implementation

[0043] The method of the present invention will be further described below with reference to the accompanying drawings and specific embodiments. It should be understood that the following embodiments are intended to help understand the technical solution of the present invention, but do not limit the scope of the invention. Without departing from the principles of the present invention, those skilled in the art can adjust or equivalently substitute the implementation steps according to actual needs, and these changes should also be considered to fall within the protection scope of the present invention.

[0044] Example 1

[0045] This embodiment provides a method for producing grass carp sperm through goldfish surrogacy. The specific implementation steps are as follows:

[0046] Step S1: Determining the transplant window period

[0047] In this embodiment, early gonadal development in goldfish larvae was studied. Samples of goldfish larvae were taken at 3, 5, and 7 days after hatching, fixed in Born's solution, embedded in paraffin, and serially sectioned, followed by hematoxylin-eosin (HE) staining. The formation and distribution of the genital ridges in larvae of each age were observed using an optical microscope.

[0048] The results show that ( Figure 1Three days after hatching, in goldfish larvae (average total length approximately 6.13 mm), the genital ridge has not yet formed, but a small number of PGCs (primordial germ cells) can be observed migrating to the site of genital ridge formation. Five days after hatching (approximately 7.02 mm in total length), the genital ridge forms, but the PGCs are not yet completely encapsulated by somatic cells. By seven days after hatching (approximately 8.44 mm in total length), the genital ridge has further developed, the number of PGCs has significantly increased, and they are completely encapsulated by surrounding somatic cells. Based on the above histological observations, the stage when the genital ridge is just beginning to form and the PGCs are not yet completely encapsulated by somatic cells is determined as the optimal transplantation window. That is, transplanting donor reproductive stem cells before the 5th day after hatching of goldfish larvae is preferred, as this can improve the success rate of donor cell colonization in the recipient.

[0049] Step S2: Preparation of sterile recipient goldfish

[0050] This embodiment designs and compares the effects of different morpholino antisense oligonucleotide sequences in preparing sterile goldfish fry. The experimental results are shown in Table 1.

[0051] Table 1. Effects of different morpholino antisense oligonucleotide sequences on the preparation of sterile goldfish fry.

[0052]

[0053] The experimental results in Table 1 show that the larvae prepared by the sequence TCCATGCCGCTGTCCACCTGTGATG have a high sterility rate, so it was selected as the antisense oligonucleotide in the following experiments.

[0054] Synthesized dnd gene morpholino antisense oligonucleotides (with the nucleotide sequence TCCATGCCGCTGTCCACCTGTGATG, as shown in SEQ ID NO.16) were injected into goldfish 1-cell stage fertilized eggs. Simultaneously, to visually assess whether PGCs were effectively removed, GFP-nanos33′UTR mRNA (approximately 400 pg / embryo) for marking germ cells was co-injected into the same fertilized egg. This method can rapidly determine the efficiency of complete removal of endogenous germ cells in goldfish. Figure 2 (As shown in A and B). At 50 dph, the gonadal histological characteristics of wild-type (WT) and gene knockdown group goldfish individuals were compared.

[0055] The results showed that in WT goldfish, the ovaries contained a large number of primary oocytes. Figure 2 As shown in C), the testes contain a large number of spermatogonial stem cells ( Figure 2As shown in D). In the dnd-MO treatment group, the infertility rate was as high as 88.89%; no germ cells were seen in the histological sections of the gonads of infertile individuals, only somatic cells and stromal cells were seen, and the gonads showed a structure similar to that of the ovary and testis ( ). Figure 2 (E and F). A comprehensive analysis was conducted on the external morphology, histological structure, and expression of related genes in the gonads of 5-month-old goldfish recipients. External morphological observations showed that the ovaries of 5-month-old WT goldfish at stage IV were bluish-gray, with clearly visible rice-grain-like egg particles (E and F). Figure 2 (G), while the male testes develop to stage V, and are milky white (G). Figure 2 In the middle I group, the gonads of infertile individuals in the dnd-MO group showed delayed development, appearing as thin, transparent, thread-like tissues, making it difficult to distinguish sex with the naked eye. Figure 2 (Middle K and M).

[0056] Histological section results showed that in the WT ovary, primary oocytes developed to stage IV ( Figure 2 (H), while the testes contain primary spermatocytes, secondary spermatocytes, and a large number of sperm, exhibiting typical pre-sexual maturation germ cell development characteristics (H). Figure 2 (J). The gonads in the dnd-MO injection group exhibited two different phenotypes. Type I gonads had ovarian-like tissue structures, forming an ovarian cavity, but lacked germ cells. Figure 2 Type II gonads are composed of spermatogonial lobules without germ cells. Figure 2 (Middle N). Both types of gonads do not contain germ cells, but somatic cell morphology is normal. The infertility rate in the MO group at this stage was 94.44%.

[0057] The above results indicate that dnd-MO-mediated germ cell loss can persist until pre-sexual maturity. The expression characteristics of sex differentiation-related genes in the gonads of each group were analyzed using RT-PCR. The results showed that the internal reference gene β-actin was stably expressed in all samples. Figure 2 The germ cell-specific gene vasa was detected only in the gonads of WT individuals, but not in the gonads of dnd-MO individuals, indicating that germ cells were completely absent in the experimental group individuals. Figure 2 In the testicular somatic cell-related genes cyp11b and gsdf, the expression levels were high in WT male fish and type II gonads; conversely, the ovarian differentiation-related gene foxl2 was highly expressed in WT ovaries and type I gonads. Figure 2 (O).

[0058] In summary, the expression patterns of sex differentiation-related genes in the gonads of WT and dnd-MO individuals are consistent with their external morphological and histological structural characteristics.

[0059] Step S3: Screening of donor grass carp testes during developmental stages

[0060] Five healthy, sexually immature grass carp were selected at each stage, and their testicular tissue was harvested. The freshly harvested grass carp testes were immediately fixed in Bouin's solution, followed by stepwise dehydration with ethanol and paraffin embedding. The paraffin blocks of the testes were sectioned (section thickness 5 μm) and stained with hematoxylin and eosin (HE).

[0061] Microscopic observation of testis sections revealed that when the grass carp's body length and weight were 1453.4±101.22 g and 50.5±1.46 cm respectively, the testes had not yet formed spermatogonium, and the reproductive cells were mainly type A spermatogonia (…). Figure 3 (A) When the grass carp's body length and weight are 3508.33±491.64 g and 63.83±3.62 cm respectively, the testis lobules have already formed, and the reproductive cells are mainly type A and type B spermatogonia (A and B spermatogonia). Figure 3 (B) When the grass carp's body length and weight are 6758.33±610.12 g and 82±5.29 cm respectively, the testes at this stage mainly contain a large number of type B spermatogonia and primary spermatocytes ( Figure 3 (C). In the subsequent implementation steps, grass carp testes weighing approximately 3 kg were selected for the extraction of spermatogonial stem cells.

[0062] Step S4: Preparation of grass carp spermatogonial stem cells

[0063] Based on the results of step S3, grass carp testes at a suitable stage were used for the preparation of spermatogonial stem cells. Figure 4(Method A) The specific method is as follows: Fresh grass carp testis tissue is rinsed in sterile, ice-cold physiological saline to remove blood. After removing excess connective tissue, the testis is shredded into small pieces using ophthalmic scissors in a sterile Petri dish. The shredded testis tissue is then transferred to a protease digestion solution (DEME medium contains 0.25% trypsin, 1% collagenase H, 5% fetal bovine serum, and 0.05% DNase I, pH approximately 7.8), with a total digestion volume approximately 4-5 times that of the testis tissue. The digestion solution containing the tissue is incubated at 30°C for approximately 1.5-2.0 hours. During incubation, the suspended tissue cell solution is gently pipetted approximately 10 times every 15-30 minutes using a sterile pipette to promote gradual dissociation of the tissue into single cells, but care must be taken to avoid cell damage. After digestion, a final concentration of 10% fetal bovine serum is added to terminate the reaction. The resulting cell suspension was filtered sequentially through 100 μm and 42 μm pore size filters to remove undigested tissue fragments. The filtered cell suspension was centrifuged at 4 ℃ and 300 × g for 10 min, and washed 2–3 times with DMEM. After discarding the supernatant, the cell pellet was resuspended in an appropriate amount of DMEM, and samples were taken for cell counting. The morphological characteristics of the cells were observed under a microscope.

[0064] To facilitate subsequent tracking and identification, donor spermatogonial stem cells were labeled in vivo using the fluorescent dye PKH26. Cells were resuspended in a special staining dilution buffer, and PKH26 red fluorescent dye (working concentration approximately 10 μmol / L) was added. The cells were incubated at room temperature in the dark for 5 minutes to ensure thorough staining. An equal volume of culture medium was then added to terminate staining, and the cells were centrifuged at 300×g for 5 minutes to pellet the cells. The supernatant was discarded, and the cells were resuspended in fresh culture medium and washed twice to remove free dye. Finally, the labeled grass carp spermatogonial stem cells were suspended in an appropriate amount of DMEM culture medium and placed on ice for transplantation. Figure 4 (B and C in the middle).

[0065] Step S5: Perform reproductive stem cell transplantation

[0066] After completing the preparation of the donor cells, reproductive stem cell transplantation will be carried out. Goldfish larvae 4-5 days after hatching will be selected for the transplantation procedure. The goldfish larvae will first be placed in 0.1% MS-222 solution for approximately 30 seconds to stop swimming, and then transferred to a culture dish pre-lined with 2% agarose gel for fixation. Subsequently, using a narrow-tipped glass microinjection needle, the prepared grass carp spermatogonial stem cell suspension will be injected into the larvae's body cavity from the area of ​​the gonadal primordia in the abdomen. Figure 4(Medium D). Inject approximately 1–2 μL of cell suspension (containing approximately 100,000 cells) into each larva. After injection, quickly transfer the larvae back to clean water to revive. Simultaneously, observe the injection effect under a fluorescence microscope. Figure 4 (E). After the transplantation is completed, the transplanted fish will be transferred to a 60 L aquarium for further rearing.

[0067] Step S6: Donor grass carp spermatogonial stem cells are chimeric into the gonads of recipient goldfish and proliferate and differentiate.

[0068] Three weeks post-transplantation, recipient juvenile goldfish were randomly selected. The heads and viscera were removed, and the remaining tissue was immersed in Tissue-Tek Ufix fixative (Sakura, Japan) and fixed on ice for 1 min. The tissue was then washed 2-3 times with PBST. PKH26-labeled donor cells colonized in the recipient gonads were observed using a fluorescence microscope. Fluorescence results showed that red fluorescence signals were detectable in 75.00% of the transplanted recipient gonads. Donor cells were scattered in punctate patterns or locally clustered, and their spatial location highly overlapped with the gonadal tissue. Figure 5 (A and B); while no fluorescent signal was detected in the gonads of the WT control group (A and B); Figure 5 (C and D in the middle). This indicates that the donor grass carp spermatogonial stem cells have successfully migrated and chimeric into the recipient goldfish gonad.

[0069] Example 2

[0070] Based on the successful migration and chimerization of grass carp spermatogonial stem cells into the gonads of recipient goldfish in Example 1, the developmental characteristics of the recipient goldfish gonads after transplantation were further investigated. The specific details are as follows:

[0071] 1. Assess the gonadal development characteristics of the recipient goldfish after transplantation.

[0072] Three months post-transplantation, randomly selected juvenile recipient fish were dissected. Histological analysis of gonadal development revealed that gametogenesis occurred in the gonads of 73.33% of the recipients. The female recipient ovaries entered the meiotic stage, primarily consisting of stage II primary oocytes, containing a small number of oogonial stem cells (…). Figure 5 (I); The male testes of the transplant recipient are in the mitotic stage, and the testes contain a large number of spermatogonial stem cells ( Figure 5 (J). However, the WT ovary enters the meiotic stage, and the ovary contains a large number of stage II primary oocytes ( Figure 5 (Middle E); WT The testes enter the meiotic stage, and the testicular tissue contains spermatogonia, primary spermatocytes, secondary spermatocytes, spermatids, and a very small number of sperm cells ( Figure 5(F). Infertile recipient gonads contain only somatic and stromal cells, lacking germ cells, and mainly exhibit two different structural types: Type I gonads have ovarian-like structures and contain an ovarian cavity ( Figure 5 Type G); Type II gonads exhibit a testis-like structure ( Figure 5 (H). The results showed that donor grass carp spermatogonial stem cells could chimerate with the gonads of sterile goldfish, proliferate, and differentiate into oogonial stem cells.

[0073] 2. PCR detection of transplanted chimeras

[0074] By comparing the sequence differences of the vasa gene, a germ cell marker gene, between donor grass carp and recipient goldfish, species-specific primers for the vasa gene mRNA were designed. The grass carp vasa gene mRNA primers are shown in SEQ ID NO.1 and SEQ ID NO.2, and the goldfish vasa gene mRNA primers are shown in SEQ ID NO.3 and SEQ ID NO.4 (specific sequences are detailed in Table 2). Total gonadal RNA was extracted from transplanted and control individuals according to the instructions of the FastPure Tissue / Cell Total RNA Isolation Kit V2 (Vazyme, China). Subsequently, PrimeScript was used to analyze the RNA. TM Reverse transcription of cDNA was performed using the RT reagent kit with gDNA Eraser (TaKaRa, Japan). The RT-PCR reaction system consisted of 20.0 µL: 10 µL of 2 × Phanta Flash Master Mix, 8.2 µL of ddH2O, 1 μL of cDNA template, and 0.4 μL each of forward and reverse primers. The reaction conditions were: 98 ℃ for 3 min; 98 ℃ for 10 s, 60 ℃ for 20 s, for 35 cycles; extension at 72 ℃ for 4 s; and a final extension at 72 ℃ for 10 min. The RT-PCR products were detected by 2.0% agarose gel electrophoresis.

[0075] PCR results showed that ( Figure 6The grass carp vasa gene-specific primers amplified the target fragment only in grass carp (the nucleotide sequence of the grass carp-specific target fragment is shown in SEQ ID NO. 11), and the goldfish vasa gene-specific primers amplified the target fragment only in goldfish (the nucleotide sequence of the goldfish-specific target fragment is shown in SEQ ID NO. 12). Using the internal reference gene β-actin primers as a positive control, the β-actin fragment was amplified in the gonadal tissues of both grass carp and goldfish (the common fragment sequence is shown in SEQ ID NO. 13). These results indicate that the grass carp and goldfish vasa gene-specific primers designed at the RNA level can effectively distinguish between germ cells derived from grass carp or goldfish.

[0076] Table 2 Primer Sequences

[0077]

[0078] To analyze the presence of donor grass carp germ cells in chimeric gonads 3 months post-transplantation, vasa gene RT-PCR was performed using histological analysis combined with RNA level detection in recipient goldfish gonad tissue.

[0079] The results showed that the gonads of 75% of the transplanted individuals contained a fragment of the donor grass carp vasa gene. No grass carp or goldfish vasa gene fragment was detected in the gonads of the four sterile recipients; only a β-actin gene sequence fragment was detected. Figure 7 The gonads of WT grass carp and WT goldfish contained only grass carp-specific vasa sequence fragments, and β-actin gene fragments were detectable in both. These results indicate that individuals with normal gonadal development in the transplant recipient contain germ cells from the donor grass carp.

[0080] 3. Detection of donor grass carp sperm produced by recipient goldfish

[0081] By comparing the differences in the vasa gene DNA sequence of germ cells from donor grass carp and recipient goldfish, species-specific vasa DNA primers were designed. The grass carp vasa-specific DNA primers are SEQ ID NO.1 and SEQ ID NO.2, and the amplified grass carp vasa fragment sequence is shown in SEQ ID NO.11. The goldfish vasa-specific DNA primers are SEQ ID NO.7 and SEQ ID NO.8 (because the target fragment contains introns, the DNA primers are different from the mRNA primers), and the amplified goldfish vasa fragment sequence is shown in SEQ ID NO.14. The primers for the common sequence of grass carp and goldfish are SEQ ID NO.9 and SEQ ID NO.10 (see Table 3 for details), and the common fragment sequence is shown in SEQ ID NO.15.

[0082] Blood samples were collected from both male and female WT grass carp and WT goldfish. Genomic DNA was extracted strictly according to the standard operating procedures provided by the TaKaRa MiniBEST Universal Genomi Extraction Kit Ver.5.0 (TaKaRa, China). The DNA template was diluted to 20-30 ng / µL. The PCR reaction system was 20.0 µL: 10 µL of 2 × Phanta FlashMaster Mix, 8.2 µL of ddH2O, 1 μL of cDNA template, and 0.4 μL each of forward and reverse primers. The reaction conditions were: 98 ℃ for 3 min; 98 ℃ for 10 s, 60 ℃ for 20 s, 35 cycles; extension at 72 ℃ for 4 s; final extension at 72 ℃ for 10 min. The RT-PCR products were detected by 2.0% agarose gel electrophoresis. The PCR results showed that ( Figure 8 The grass carp vasa gene-specific primers amplify the target fragment only in grass carp (SEQ ID NO.11), the goldfish vasa gene-specific primers amplify the target fragment only in goldfish (SEQ ID NO.14), and the common primers for both can amplify the expected fragment in the gonadal tissues of grass carp and goldfish (SEQ ID NO.15).

[0083] Table 3 Primer Sequences

[0084]

[0085] After the recipient goldfish reached sexual maturity, the water temperature was maintained at 26 ℃. A fish spawning induced agent produced by Shanghai Biotechnology Co., Ltd. was injected into the base of the pectoral fin according to the instructions. Fresh semen was collected from male fish 8–10 hours after injection. Simultaneously, semen was collected from WT grass carp and goldfish. The total sperm count was 1 × 10⁻⁶.6 ~1 × 10 7 Semen from cells was used for genomic DNA extraction. DNA extraction was performed strictly according to the standard operating procedures provided by the TaKaRa MiniBEST Universal Genomi Extraction Kit Ver. 5.0 (TaKaRa, China). PCR conditions were verified using the specific primers described above.

[0086] The results show that ( Figure 9 In the study (A), sperm from all nine recipient fish contained the specific product of the donor grass carp vasa gene. In the control samples of WT grass carp and goldfish semen, only grass carp and goldfish-specific vasa gene fragments were amplified, respectively. This indicates that the recipient goldfish produced donor grass carp sperm.

[0087] Another 5 μL of fresh semen was fixed in a solution containing 2.5% glutaraldehyde for scanning electron microscopy (SEM) sample preparation. The fixed samples were dehydrated, dried, and sputter-coated with gold according to standard SEM sample preparation methods, followed by SEM morphology and structure observation. The ultrastructural characteristics of sperm produced by WT grass carp, WT goldfish, and the transplant recipient goldfish were observed. The sperm head area was measured using ImageJ software. The results showed that the average head area of ​​grass carp sperm was significantly smaller than that of goldfish sperm, while there was no significant difference in head area between the transplant recipient sperm and grass carp sperm. Figure 9 (BH). Further, it was found that the recipient goldfish produced sperm from the donor grass carp. To assess the sperm density and semen volume of the transplanted goldfish, it was discovered that the average semen volume that could be collected from wild-type male goldfish in a single ejaculation was approximately 1.46 ml, and the average sperm density was approximately 29.00 × 10⁻⁶. 9 The average sperm count / mL was [number] sperm / mL; while the average semen volume collected from male goldfish recipients in a single collection was approximately 0.75 ml, with an average sperm density of approximately 5.64 × 10⁻⁶. 9 cells / mL ( Figure 9 (I). The results showed that the semen volume and sperm density produced by wild-type goldfish were significantly higher than those of the transplant recipients.

[0088] 4. Analysis of motility parameters of recipient goldfish producing donor grass carp sperm

[0089] The percentage of forward motility (PMOT), linear velocity (VSL), curvilinear velocity (VCL), and mean path velocity (VAP) of sperm were detected using a computer-assisted sperm analysis system (CASAⅡ). The results showed that there were no significant differences in PMOT, VSL, VCL, and VAP between the transplanted sperm and the control group (grass carp and goldfish). Figure 10 This indicates that the sperm produced by the transplanted individual possesses normal motility. Combined analysis of DNA level identification and scanning electron microscopy results shows that the recipient goldfish successfully produced functional sperm derived from the donor grass carp.

[0090] In summary, this embodiment demonstrates that by transplanting grass carp spermatogonial stem cells into sterile goldfish fry, the goldfish recipient can successfully produce sperm from the donor grass carp. This invention provides an innovative interspecies fish reproductive pathway with broad application prospects in the fields of aquatic germplasm creation and reproductive biology research.

[0091] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions claimed by the present invention.

Claims

1. A morpholino-based antisense oligonucleotide for use in goldfish surrogacy to produce grass carp sperm, characterized in that, The sequence of the morpholino antisense oligonucleotide is shown in SEQ ID No.

16.

2. The application of the morpholino antisense oligonucleotide according to claim 1 in the production of grass carp sperm by goldfish surrogacy.

3. The application according to claim 2, characterized in that, The method for goldfish surrogacy to produce grass carp sperm specifically includes the following steps: S1: The morpholino antisense oligonucleotide was microinjected into the 1-cell stage of the fertilized eggs of goldfish larvae to block the migration of endogenous primordial germ cells in the goldfish embryo, thereby preparing sterile recipient goldfish larvae without endogenous germ cells as transplant recipients. S2: Use grass carp to prepare a suspension of donor grass carp spermatogonial stem cells as a transplant donor; S3: Transplant the grass carp spermatogonial stem cell suspension into the infertile recipient goldfish fry to obtain transplanted goldfish; S4: The transplanted goldfish are raised normally, and the raised transplanted goldfish are able to produce grass carp sperm.

4. The application according to claim 3, characterized in that, The goldfish fry mentioned in step S1 are selected from goldfish fry that are less than 5 days old after hatching; the grass carp in step S2 weighs 2.8~3.8kg.

5. The application according to claim 3, characterized in that, In step S3, the grass carp spermatogonial stem cell suspension is transplanted to the primordium of the reproductive crest of the infertile recipient goldfish fry via microinjection.

6. The application according to claim 3, characterized in that, The amount of grass carp spermatogonial stem cell suspension used is 1-2 μL per goldfish fry.

7. A primer set for detecting germ cells derived from grass carp or goldfish as claimed in claim 3, characterized in that, The primer set includes mRNA-specific primers for the vasa gene of grass carp and goldfish. The sequences of the mRNA-specific primers for the vasa gene of grass carp are shown in SEQ ID No. 1 and SEQ ID No. 2, and the nucleotide sequence of the amplified grass carp-specific fragment is shown in SEQ ID No.

11. The sequences of the mRNA-specific primers for the vasa gene of goldfish are shown in SEQ ID No. 3 and SEQ ID No. 4, and the nucleotide sequence of the amplified goldfish-specific fragment is shown in SEQ ID No.

12.

8. A primer set for detecting grass carp sperm produced by transplanted goldfish as described in claim 3, characterized in that, The primer set includes specific primers and universal primers for the vasa gene of grass carp and goldfish. The sequences of the specific primers for the grass carp vasa gene fragment are shown in SEQ ID No. 1 and SEQ ID No. 2, and the nucleotide sequence of the amplified grass carp-specific fragment is shown in SEQ ID No.

11. The sequences of the DNA-specific primers for the goldfish vasa gene fragment are shown in SEQ ID No. 7 and SEQ ID No. 8, and the nucleotide sequence of the amplified goldfish-specific fragment is shown in SEQ ID No.

14. The sequences of the universal primers are shown in SEQ ID No. 9 and SEQ ID No.

10.

9. The application of the primer set described in claim 7 or 8 in the identification and detection of recipient goldfish germ cells.

10. The application according to claim 9, characterized in that, The PCR reaction system for identifying and detecting the recipient goldfish using the aforementioned primer set specifically includes: 20.0 µL: 10 µL of 2 × Phanta Flash Master Mix, 8.2 µL of dd H2O, 1 μL of cDNA template, and 0.4 μL each of forward and reverse primers; the reaction conditions are: 98℃ for 3 min; 98℃ for 10 s, 60℃ for 20 s, with 35 cycles; extension at 72℃ for 4 s; 72℃.

Images