Citrus oil sac secretory cell-specific promoters and uses thereof

Abstract

The application discloses a citrus oil sac secretion cell specific promoter and application thereof, and the citrus oil sac secretion cell specific promoter is ProWRKY75a a promoter or ProWRKY75b a promoter; the application respectively constructs ProWRKY75a and ProWRKY75b plant expression vectors driven by GUS-eGFP report genes, and obtains transgenic citrus plants through agrobacterium-mediated stable genetic transformation of citrus. Through GUS tissue chemical staining and laser confocal microscopic observation, it is confirmed that both of them can specifically drive report gene expression in citrus oil sac secretion cells. The two promoters provided by the application can drive directional expression of key enzyme genes or transcription factor genes, help to reduce adverse effects of a constitutive promoter on the whole plant, and provide new regulation elements for citrus essential oil quality improvement and oil sac metabolic engineering.

Description

Technical Field

[0001] This invention relates to the fields of plant biotechnology and fruit tree molecular breeding, specifically to a citrus oil cell secretory cell-specific promoter and its application. Background Technology

[0002] Citrus oil cells are secretory structures unique to citrus plants, primarily responsible for the synthesis, secretion, and storage of essential oils. Citrus essential oils possess antibacterial, insecticidal, and antioxidant activities, and are widely used in the food, pharmaceutical, and daily chemical industries. The oil cell interior consists of an outer sheath cell, secretory cells with active metabolic functions, and a central cavity. The secretory cells are the main functional cells for essential oil synthesis, and metabolic products are ultimately transported and stored in the cavity. Therefore, achieving precise expression of target genes in the secretory cells of oil cells is of great significance for the targeted regulation of citrus essential oil metabolic pathways and quality improvement.

[0003] Promoters are cis-regulatory elements located upstream of the 5' end of structural genes. By binding to RNA polymerases and various transcription factors, they regulate the spatiotemporal specificity and transcriptional efficiency of gene expression, and are the core functional elements of plant gene engineering expression vectors. Based on different expression patterns, plant promoters are generally classified into three main categories: constitutive promoters, inducible promoters, and tissue- and cell-specific promoters. Constitutive promoters (such as the cauliflower mosaic virus CaMV 35S promoter, the maize Ubiquitin promoter, and the rice Actin1 promoter) can drive gene expression sustainably throughout all tissues and developmental stages. For perennial woody plants like citrus, constitutive promoters may impose a metabolic burden on the plant, causing abnormal growth and development, and hindering the precise regulation of target traits. In contrast, tissue- and cell-specific promoters can drive gene expression only in specific tissues or cell types, helping to reduce potential impacts on normal plant growth while achieving target trait improvement, and have become an important research direction in current plant metabolic engineering and precision molecular breeding. Currently, there are few reports on promoters for citrus oil cell-specific expression and available elements, and there is a lack of effective regulatory elements that can stably drive the specific expression of exogenous genes in oil cell secretory cells.

[0004] The WRKY transcription factor family is widely involved in the regulation of plant secondary metabolism and development. Two WRKY75 paralogous genes exist in the citrus genome, designated CsWRKY75a and CsWRKY75b. While they share high homology in their coding regions, their upstream regulatory regions may have diverged during evolution, leading to differences in expression patterns. However, to date, there are no reports on the functional identification of the promoter activity and driving sites of the upstream regulatory regions of these paralogous genes, nor have they been reported as specific expression elements for oil cell secretory cells.

[0005] In summary, the existing technology has the following drawbacks: (1) When essential oil metabolism pathway gene expression is driven by constitutive promoters, the gene is continuously expressed in all tissues of the citrus plant, which can easily cause metabolic burden and abnormal growth and development, and cause ectopic accumulation of metabolites. (2) Existing citrus tissue-specific regulatory elements have a large scale of action, making it difficult to limit the expression of the target gene to oil cell secretory cells, which are the cell type that actually performs essential oil synthesis. (3) Few available elements of citrus oil cell-specific expression promoters have been reported, especially promoters that have been verified by stable genetic transformation and cellular localization; (4) In metabolic engineering modifications that require the simultaneous introduction of multiple genes, if the same promoter is used repeatedly, the sequence homology between them will increase the risk of homology-dependent gene silencing. The number of existing promoter elements available for citrus oil cells is insufficient to support the dispersed use of promoters when multiple genes are co-expressed. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of the prior art and provide a citrus oil cell-specific promoter and its application. This promoter can specifically drive gene expression in citrus oil cells or oil cell secretion cells to meet the needs of citrus essential oil metabolism engineering for precise expression regulatory elements.

[0007] To achieve the above objectives, the technical solution designed by the present invention is as follows: This invention provides a citrus oil cell secretory cell-specific promoter, wherein the citrus oil cell secretory cell-specific promoter is... ProWRKY75a promoter or ProWRKY75b Promoters; and both promoters are promoters of the WRKY75 gene, among which, ProWRKY75a The nucleotide sequence of the promoter is shown in SEQ ID NO.1; ProWRKY75b The nucleotide sequence of the promoter is shown in SEQ ID NO.2.

[0008] The present invention also provides a recombinant expression vector containing the above-mentioned citrus oil cell secretory cell-specific promoter.

[0009] Furthermore, the citrus oil cell secretory cell-specific promoter is located upstream of the reporter gene or the target gene.

[0010] Furthermore, the recombinant expression vector uses the expression vector pCAMBIA1300-35S-eGFP as its backbone, the target gene is a dual reporter gene fused with GUS and eGFP, and the T-DNA region of the recombinant expression vector also contains a TurboRFP selection marker expression cassette driven by the Pocs promoter.

[0011] The present invention also provides a recombinant host bacterium containing the above-described recombinant expression vector.

[0012] Furthermore, the recombinant host bacterium is Escherichia coli DH5α or Agrobacterium tumefaciens EHA105.

[0013] The present invention also provides a transgenic citrus cell or tissue, the genome of which is integrated with an expression cassette, the expression cassette being composed of the aforementioned citrus oil cell secretory cell-specific promoter and a target gene located downstream of the promoter and operably linked thereto.

[0014] The present invention also provides the application of the above-mentioned citrus oil cell secretory cell-specific promoter in driving the specific expression of the target gene in citrus oil cell secretory cells.

[0015] Furthermore, the target gene encodes an enzyme involved in the essential oil biosynthesis pathway or a transcription factor that regulates the essential oil biosynthesis pathway, and the application is to regulate the synthesis and accumulation of terpenoid compounds in citrus oil cells.

[0016] The present invention also provides a method for specifically expressing a target gene in citrus oil cell secretory cells, comprising the following steps: (1) The target gene is linked to the above-mentioned citrus oil cell secretory cell-specific promoter to construct a recombinant expression vector, wherein the promoter is located 5' upstream of the target gene; (2) The recombinant expression vector was introduced into Agrobacterium tumefaciens to obtain Agrobacterium tumefaciens bacterial solution containing the recombinant expression vector; (3) Citrus explants were infected with Agrobacterium tumefaciens solution, co-cultured, and then transferred to a culture medium containing screening agent for screening culture and induction of adventitious shoot regeneration; (4) Positive identification and root culture were performed on the regenerated adventitious buds to obtain transgenic citrus material that specifically expresses the target gene in oil cell secretory cells.

[0017] The beneficial effects of this invention are: 1. This invention cloned and identified two promoters derived from the WRKY75 homologous gene. ProWRKY75a and ProWRKY75b This enriches the resources of citrus oil cell-specific expression promoters, so that citrus essential oil metabolism engineering is no longer limited to a few known promoters when selecting regulatory elements.

[0018] 2. This invention, through Agrobacterium-mediated stable genetic transformation and reporter gene analysis, confirms at the transgenic plant level that both promoters can drive reporter gene expression in citrus oil cells; further, through vibration sectioning and laser confocal microscopy, it is confirmed that the reporter signal is located in the secretory cells of the oil cells, that is, the driving site of the promoter of this invention is consistent with the actual synthesis site of the essential oil.

[0019] 3. Because the promoter of this invention restricts the expression of the target gene to oil-secreting cells, compared with the scheme using constitutive promoters, it can avoid the ectopic expression of the target gene in non-target sites such as mesophyll, epidermis, roots, and stems, thereby reducing the overall metabolic burden of the plant, reducing the risk of abnormal growth and development and ectopic accumulation of metabolites, and helping to achieve precise regulation of metabolic engineering.

[0020] 4. ProWRKY75a and ProWRKY75b Although they are paralogous genes with high homology in their coding regions, their promoter regions differ significantly (3236 bp and 2844 bp in length, respectively), while their driver regions remain consistent. Therefore, in multi-gene co-expression systems requiring the simultaneous introduction of multiple genes, the two promoters can be used in different expression cassettes, eliminating long promoter homologous sequences between the cassettes. This removes the induction condition for homology-dependent gene silencing, thus improving the stability of multi-gene expression—an effect not solely due to the specificity of any single promoter, but rather to the combination of "a pair of promoters with identical driver regions but significantly different sequences."

[0021] 5. Utilize ProWRKY75a and ProWRKY75b The targeted expression of key enzyme genes or transcription factor genes driven by promoters can be used for metabolic engineering of citrus oil cells. This will enable precise regulation and quality improvement of terpene characteristic metabolic components, laying the foundation for targeted breeding and metabolic engineering of citrus functional components. Attached Figure Description

[0022] Figure 1 for CsWRKY75a and CsWRKY75b The protein sequence alignment results are shown in the figure. Figure 2 for CsWRKY75a Image of in situ hybridization results of gene mRNA; In this diagram, A represents the antisense probe hybridization signal, and B represents the positive probe negative control. The scale bar is 50 μm. Figure 3 for CsWRKY75a and CsWRKY75b Subcellular localization results, scale bar 10μm; Figure 4 Image of pCAMBIA1300-35S-eGFP vector; Figure 5 for ProWRKY75a and ProWRKY75b Schematic diagram of the T-DNA region structure of the expression vector that drives the reporter gene; Figure 6The image shows the GUS histochemical staining results of ProWRKY75a::GUS-eGFP and ProWRKY75b::GUS-eGFP transgenic plants, where WT is the wild-type negative control. The scale bar is 2 mm. Figure 7 The image shows the eGFP fluorescence signal in oil cells of leaves of ProWRKY75a::GUS-eGFP and ProWRKY75b::GUS-eGFP transgenic plants. The scale bar is 200 μm. Figure 8 The image shows the results of laser confocal microscopy observation of vibrating sections of leaves from ProWRKY75a::GUS-eGFP and ProWRKY75b::GUS-eGFP transgenic plants. The scale bar is 150 μm. Detailed Implementation

[0023] The present invention will now be described in further detail with reference to specific embodiments, so that those skilled in the art can understand it.

[0024] Example 1: Identification and sequence analysis of paralogous genes in citrus WRKY75 Homology searches and gene structure analyses were performed using the sweet orange genome database Citrus sinensis v2.0 (http: / / citrus.hzau.edu.cn / ), identifying two WRKY75 paralogous genes, which were named... CsWRKY75a and CsWRKY75b Their nucleotide sequences are shown in SEQ ID NO:3 and SEQ ID NO:4, respectively. CsWRKY75a The gene is 585 bp in length and encodes 194 amino acid residues. CsWRKY75b The gene is 489 bp in length and encodes 162 amino acid residues.

[0025] The protein sequences of the two were compared, and the results are as follows: Figure 1 As shown, CsWRKY75a and CsWRKY75b are highly conserved in the WRKY domain region, both containing the WRKYGQK core motif and the subsequent zinc finger motif. The main difference lies in the N-terminal region: CsWRKY75a has an additional alanine-rich extension sequence at the N-terminus compared to CsWRKY75b. These results indicate that they belong to the same subfamily of paralogous genes, and their encoded products are conserved in DNA-binding function.

[0026] The high conservatism of the coding region suggests potential functional redundancy between the two. Whether its expression pattern is equally conserved as the regulatory region sequence requires functional identification of its upstream regulatory region. This constitutes a... CsWRKY75a and CsWRKY75bThe starting point for cloning and functional verification in the upstream control zone.

[0027] Example 2 CsWRKY75a and CsWRKY75b Expression patterns and subcellular localization analysis Analysis by in situ hybridization CsWRKY75a The specific steps for organizing gene expression are as follows: Citrus shoot tip materials were fixed overnight in FAA at 4 °C, followed by dehydration with graded ethanol the next day. The tissue was then cleared with Histo-Clear II, and the clearing solution was replaced with paraffin. After thorough replacement, the samples were fixed in paraffin. A target gene probe was then prepared. CsWRKY75a The full-length coding sequence was amplified and purified from the plasmid, then transcribed in vitro, hydrolyzed, and purified to prepare the probe. The sample was then analyzed by cross-section and longitudinal sectioning. CsWRKY75a Expression patterns were observed in the shoot tips and leaves. Samples fixed on slides were subsequently dewaxed, rehydrated, treated with protease, fixed with paraformaldehyde, treated with acetic anhydride, and dehydrated in a gradient of ethanol to pure alcohol before hybridization with DIG-labeled target gene RNA antisense probes. Finally, detection was performed using DIG antibody and NBT / BCIP colorimetric assay. CsWRKY75a Organizational expression situation.

[0028] The results are as follows Figure 2 As shown: CsWRKY75a Gene expression signals are stronger in oil cells.

[0029] Using a transient expression system of citrus leaf mesophyll protoplasts to... CsWRKY75a Genes and CsWRKY75b Subcellular localization analysis of genes.

[0030] The results are as follows Figure 3 As shown: CsWRKY75a Genes and CsWRKY75b Genes are located in the cell nucleus.

[0031] Example 3 ProWRKY75a and ProWRKY75b Promoter cloning and plant expression vector construction 1. ProWRKY75a and ProWRKY75b promoter cloning Using citrus genomic DNA as a template, amplification was performed separately. CsWRKY75a and CsWRKY75b The 3236bp and 2844bp sequences upstream of the ATG gene are named ProWRKY75a and ProWRKY75b The primers used for amplification are: pWRKY75a-F: CAATATAACGGGGACACTATAACTCG, as shown in SEQ ID NO:5; pWRKY75a-R: TTTGATTTGAGACTTTATCTAGATAGATAGAGAG, as shown in SEQ ID NO:6; pWRKY75b-F: TTCACGTTGATTGGATTATACAATCCAATTTAATAG, as shown in SEQ ID NO:7; pWRKY75b-R: CAAGCAGAAGCACAATAATTAAAATGAT, as shown in SEQ ID NO:8; The amplification system is as follows: 2. Construction of plant expression vectors Obtained ProWRKY75a and ProWRKY75b Using the promoter sequence as a template, primers containing the BpiⅠ restriction site were designed for a second round of PCR amplification to facilitate subsequent cloning operations. The promoter fragment obtained from PCR amplification was digested with BpiⅠ and then combined with the pCAMBIA1300-GUS-eGFP vector (which was digested with the same restriction enzyme) after the same digestion treatment. Figure 4 This is an improved binary expression vector constructed based on the α-DNA backbone. Compared to the original vector, this vector integrates dual visual reporter genes GUS and eGFP, as well as the tRFP red fluorescent selection marker, within the T-DNA region for ligation. The vector construction system is as follows: The ligation products were transformed into *E. coli* DH5α competent cells, and after antibiotic selection and sequencing verification, recombinant expression vectors pCAMBIA1300-ProWRKY75a::GUS-eGFP and pCAMBIA1300-ProWRKY75b::GUS-eGFP were obtained. like Figure 5 As shown, in the above-mentioned carrier, ProWRKY75a or ProWRKY75b The promoter is located upstream of the GUS-eGFP dual reporter gene and is used to drive reporter gene expression.

[0032] Example 4: Agrobacterium-mediated stable genetic transformation of citrus trifoliate orange The recombinant expression vectors described above were transformed into *Agrobacterium tumefaciens* EHA105. Positive clones were selected and cultured in liquid medium until the logarithmic growth phase. After centrifugation, the cells were collected and resuspended in MS liquid medium, and the infection concentration was adjusted to OD0.05.600 Approximately 0.6.

[0033] Stem segments from sterile trifoliate orange seedlings approximately 30 days old were selected as explants and immersed in the infection solution for about 15 minutes, followed by co-culture. After co-culture, the seedlings were transferred to a medium containing the appropriate selection antibiotics for selection culture to induce the regeneration of adventitious shoots. Positive shoots were obtained by RFP fluorescence screening and transferred to rooting medium for rooting culture. After robust rooting, the seedlings were transplanted into soil for culture, resulting in stably transformed ProWRKY75a::GUS-eGFP and ProWRKY75b::GUS-eGFP transgenic trifoliate orange plants.

[0034] Example 5 ProWRKY75a and ProWRKY75b Promoter tissue-specific expression analysis (1) GUS histochemical staining Prepare the GUS staining solution in advance (0.1M phosphate buffer, 0.05mM potassium ferricyanide, 0.05mM potassium ferrocyanide, 10mM EDTA, 0.1% Triton X-100, 1mg / ml X-gluc) and the destaining solution (70% ethanol: 30% acetic acid). Positive plants of pCAMBIA1300-ProWRKY75a::GUS-eGFP and pCAMBIA1300-ProWRKY75b::GUS-eGFP transgenes, as well as young leaves of wild-type trifoliate orange, were immediately immersed in GUS staining solution. After vacuuming for 1 hour, they were wrapped in aluminum foil to protect them from light and stained at 37°C for 16-24 hours. Decolorization was then carried out at 37°C with decolorizing solution (the decolorizing solution was changed daily) until the chlorophyll was completely removed. Subsequently, they were photographed and observed under a stereomicroscope.

[0035] The results are as follows Figure 6 As shown: positive transgenic plants have obvious GUS staining signals in the oil cells of their leaves, while wild-type plants have no staining signals in the oil cells of their leaves.

[0036] (2) Observation of eGFP signal using fluorescence microscopy and confocal microscopy Young leaves of transgenic trifoliate orange (Citrus trifoliata) from pCAMBIA1300-ProWRKY75a::GUS-eGFP and pCAMBIA1300-ProWRKY75b::GUS-eGFP were taken and preliminarily observed under a fluorescence microscope.

[0037] like Figure 7 As shown, obvious GFP fluorescence signals were detected in all oil cells distributed in the leaves.

[0038] A 5% agarose gel was prepared and repeatedly heated until no bubbles were generated. Once the agarose gel temperature dropped to approximately 50°C, the leaves of the transgenic material were embedded in the agarose gel. After complete solidification, the embedded samples were fixed on the stage of a vibratory microtome and sectioned to 50 μm. Cells were stained with 0.01% fluorescent whitening agent 28 (FB; Sigma-Aldrich). The eGFP signal was observed using a confocal microscope. The excitation and emission wavelengths were set as follows: FB (DAPI channel) 405 nm / 410-475 nm, GFP 488 nm / 493-540 nm, and mCherry 561 nm / 590-640 nm. Bright-field (BF) images were acquired simultaneously using a transmitted light detector, and all images were processed using LAS X software.

[0039] like Figure 8 As shown, confocal observation results confirm that the GFP fluorescence signal is specifically localized in the secretory cells of oil cells.

[0040] The above results indicate that P roWRKY75a and ProWRKY75b The promoter can drive reporter gene expression in citrus oil cell secretory cells.

[0041] All other parts not described in detail are existing technologies. Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A citrus oil cell secretory cell-specific promoter, characterized in that, The citrus oil cell secretory cell-specific promoter is ProWRKY75a promoter or ProWRKY75b Promoters; and both promoters are promoters of the WRKY75 gene, among which, ProWRKY75a The nucleotide sequence of the promoter is shown in SEQ ID NO.1; ProWRKY75b The nucleotide sequence of the promoter is shown in SEQ ID NO.

2.

2. A recombinant expression vector, characterized in that: It contains the citrus oil cell secretory cell-specific promoter as described in claim 1.

3. The recombinant expression vector according to claim 2, characterized in that, The citrus oil cell secretory cell-specific promoter is located upstream of the reporter gene or the target gene.

4. The recombinant expression vector according to claim 3, characterized in that, The recombinant expression vector uses the expression vector pCAMBIA1300-35S-eGFP as its backbone, and the target gene is a dual reporter gene fusion of GUS and eGFP.

5. A recombinant host bacterium, characterized in that, It contains the recombinant expression vector as described in claim 2.

6. The recombinant host bacterium according to claim 5, characterized in that, The recombinant host bacteria are Escherichia coli DH5α or Agrobacterium tumefaciens EHA105.

7. A transgenic citrus cell or tissue, characterized in that, Its genome integrates an expression cassette, which consists of the citrus oil cell secretory cell-specific promoter as described in claim 1 and a target gene located downstream of the promoter and operatively linked thereto.

8. The application of the citrus oil cell secretory cell-specific promoter as described in claim 1 in driving the specific expression of the target gene in citrus oil cell secretory cells.

9. The application according to claim 8, characterized in that, The target gene encodes an enzyme involved in the essential oil biosynthesis pathway or a transcription factor that regulates the essential oil biosynthesis pathway. The application is to regulate the synthesis and accumulation of terpenoid compounds in citrus oil cells.

10. A method for specifically expressing a target gene in citrus oil cell secretory cells, characterized in that, Includes the following steps: (1) The target gene is linked to the citrus oil cell secretory cell-specific promoter described in claim 1 to construct a recombinant expression vector, wherein the promoter is located 5' upstream of the target gene; (2) The recombinant expression vector was introduced into Agrobacterium tumefaciens to obtain Agrobacterium tumefaciens bacterial solution containing the recombinant expression vector; (3) Citrus explants were infected with Agrobacterium tumefaciens solution, co-cultured, and then transferred to a culture medium containing screening agent for screening culture and induction of adventitious shoot regeneration; (4) Positive identification and root culture were performed on the regenerated adventitious buds to obtain transgenic citrus material that specifically expresses the target gene in oil cell secretory cells.

Images