A method for constructing a salmon-like meat color fish germplasm

Abstract

This invention discloses a method for constructing salmon-like fish germplasm. The method utilizes the Cas9 protein to target zebrafish. bco2b sgRNA in exon 2 of the gene specifically knocks out endogenous zebrafish genes. bco2b Genes, obtained bco2b A 2 bp deletion mutant of exon 2 of a gene was used to construct salmon-like fish germplasm. The construction method of this invention not only significantly increases the astaxanthin content in fish muscle but also improves the weight gain rate and specific growth rate of fish. Simultaneously, genes related to lipid metabolism in fish were also identified. cd36 , acaca , acacb , cpt2 and cpt1b The expression of all components was significantly upregulated. This invention is of great significance for the study of astaxanthin metabolism in fish and the breeding of salmon-like fish with flesh-colored flesh.

Description

Technical Field

[0001] This invention belongs to the field of animal genetic engineering and biological breeding technology, specifically relating to a method for constructing germplasm of salmon-like fish. Background Technology

[0002] Global population growth and economic development have driven a sustained increase in demand for animal-based foods, making aquaculture a core source of high-quality protein for humans. The apparent quality of fish directly affects their commercial value, with flesh color being a key indicator of quality, nutritional value, and freshness. Consumers generally associate red color with rich nutrition and excellent flavor, signifying high quality. Current research on fish flesh color, both domestically and internationally, focuses primarily on naturally red-fleshed fish (such as Atlantic salmon and rainbow trout), confirming that their red flesh mainly originates from astaxanthin and other carotenoids deposited in the muscle. Adding astaxanthin to feed can effectively enhance the flesh color of fish like rainbow trout and is currently the mainstream method for improving fish flesh color.

[0003] Astaxanthin is a highly active natural carotenoid that can enhance the stress resistance and immunity of fish, and can give fish flesh an orange-red color by binding to muscle actin. However, only a few fish species, such as Atlantic salmon, possess the genetic metabolic mechanism for efficiently absorbing exogenous astaxanthin and specifically depositing it in muscle tissue. Most commercially important fish species, such as grass carp, crucian carp, perch, grouper, and common carp, are limited by their inherent genetic and metabolic characteristics, and the astaxanthin they ingest is mostly broken down by the liver or transported to tissues such as the skin and ovaries, failing to accumulate effectively in the muscle. In current aquaculture processes, even with excessive addition of astaxanthin or optimized feed formulations (such as adding emulsifiers, lipid carriers, and other nutritional regulation methods), it is still impossible to overcome the inherent astaxanthin deposition barrier in these fish species, making it difficult to achieve the orange-red flesh similar to salmon, and significantly increasing farming costs and metabolic burden.

[0004] In recent years, CRISPR / Cas9 gene editing technology has been successfully applied to multiple aquaculture species, such as Atlantic salmon and Nile tilapia, enabling precise improvement of core economic traits like reproduction and growth, and providing reliable technical support for fish germplasm improvement. Therefore, there is an urgent need in this field for a targeted genetic improvement technology that, through directed modification of genes related to astaxanthin binding and deposition in fish, allows common economic fish to accumulate pigment in their muscles after ingesting conventional doses of astaxanthin, resulting in a high-quality orange-red color similar to salmon, thereby enhancing the commercial value of aquatic products and the economic benefits of aquaculture. Summary of the Invention

[0005] The purpose of this invention is to address the shortcomings of existing technologies by providing a method for constructing salmon-like fish germplasm.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a method for constructing salmon-like fish germplasm, comprising the following steps: (1) Design of target fish bco2b The sgRNA of exon 2 of the gene, the target sequence of the sgRNA is shown in SEQ ID NO:1, and the sequence of the sgRNA is shown in SEQ ID NO:2; (2) Mix the Cas9 protein with the above-mentioned sgRNA to form a ribonucleoprotein complex; (3) The ribonucleoprotein complex was introduced into fish embryos via microinjection, and endogenous ribonucleoproteins were screened for. bco2b Mutants with missing gene function are used to obtain the germplasm of the target fish species.

[0007] Furthermore, the aforementioned bco2b Gene ID: 678554.

[0008] Furthermore, the fish embryo is a single-celled zebrafish embryo.

[0009] Secondly, the present invention provides an endogenous substance obtained by the above-described construction method. bco2b Gene knockout zebrafish, the zebrafish in bco2b Two bases were deleted at positions 258 and 259 of exon 2 of the gene.

[0010] Thirdly, the present invention provides the aforementioned endogenous properties. bco2b Application of gene knockout zebrafish in fish quality improvement.

[0011] Furthermore, the zebrafish exhibits the following characteristics: (1) The astaxanthin content in the muscle increased significantly; (2) Astaxanthin metabolism genes were significantly reduced; (3) After feeding with astaxanthin, growth performance was significantly improved, and the content of triglycerides and total cholesterol was significantly increased; (4) Astaxanthin is deposited in muscle, liver, ovary and adipose tissue.

[0012] Furthermore, the astaxanthin metabolism genes include, but are not limited to, those mentioned above. scarb1 .

[0013] Furthermore, the growth performance indicators are weight gain rate and specific growth rate.

[0014] Fourthly, the present invention provides a method for enhancing carotenoid pigment deposition in fish by knocking out... bco2b Genes to achieve bco2b The gene function loss, the bco2b Gene ID: 678554.

[0015] The beneficial effects of this invention are as follows: This invention targets zebrafish via Cas9 protein binding. bco2b sgRNA in exon 2 of the gene specifically knocks out endogenous zebrafish genes. bco2b Genes, obtained bco2b A mutant with a 2 bp deletion in exon 2 of the gene was used to construct salmon-like fish germplasm. The construction method of this invention significantly increased the astaxanthin content in fish muscle and improved fish growth performance, while also enhancing genes related to lipid metabolism in fish. cd36 , acaca , acacb , cpt2 and cpt1b All were significantly upregulated. This method is of great significance for the study of astaxanthin metabolism in fish and the breeding of salmon-like fish with flesh-colored flesh. Attached Figure Description

[0016] Figure 1 This invention relates to the process for constructing a salmon-fleshed fish germplasm.

[0017] Figure 2 For target bco2b Diagram showing gRNA design and efficacy testing. (A) bco2b Schematic diagram of gene knockout target design; (B) bco2b Electrophoresis image of PCR products, DNA marker 2000, target band 238 bp; (C) Wild type (WT) and homozygous mutant ( bco2b - / - (A) Sequencing peak diagram; (D) Base sequence alignment diagram; (E) bco2b - / - Statistical results of F2 generation positivity rate during homozygous mutant screening; (F)WT and bco2b - / - Amino acid sequence prediction of homozygous mutant zebrafish.

[0018] Figure 3 For WT and bco2b - / - Bright field image of the embryo 30 minutes after fertilization.

[0019] Figure 4 For WT and bco2b - / - Phenotypic analysis of zebrafish juveniles at 24 hpf and 120 hpf. (A) WT and bco2b - / - Phenotypic images of zebrafish at 24 hpf white light, scale bar: 0.5 mm; (B) WT and bco2b - / -Phenotypic image of zebrafish at 120 hpf in white light, where red dashed lines represent body length, blue dashed lines represent pericardial area, orange dashed lines represent swim bladder area, and pink dashed lines represent yolk sac area. Scale bar: 0.5 mm; (C) 120 hpf WT and bco2b - / - Zebrafish body length quantized box plot; (D) 120 hpf WT and bco2b - / - Box plot of pericardial area quantification in zebrafish; (E) 120 hpf WT and bco2b - / - Box plot of zebrafish swim bladder area; (F) 120 hpf WT and bco2b - / - Box plot of zebrafish yolk sac area.

[0020] Figure 5 For 120 hpf WT and bco2b - / - Astaxanthin content in zebrafish juveniles under maternal astaxanthin conditions. (A) WT and bco2b - / - (B) Astaxanthin content in zebrafish; RT-qPCR assay scarb1 mRNA expression level of genes.

[0021] Figure 6 For 120 hpf WT and bco2b - / - Figure 1 shows the results of zebrafish oil red O staining and TG and TC content detection under maternal astaxanthin conditions. (A) WT and bco2b - / - Zebrafish oil red O staining bright field image, scale bar: 1 mm; (B) Triglyceride (TG) content determination; (C) Total cholesterol (TC) content determination.

[0022] Figure 7 For 120 hpf WT and bco2b - / - Figure 1. RT-qPCR results of lipid metabolism gene expression in zebrafish under maternal astaxanthin conditions.

[0023] Figure 8 For 10 dpf WT and bco2b - / - Astaxanthin deposition and T-SOD activity analysis in zebrafish juveniles under exogenous astaxanthin conditions. (A) WT and bco2b - / - Zebrafish astaxanthin content; (B) T-SOD activity.

[0024] Figure 9 For 10 dpf WT and bco2b - / -Figure 1 shows the results of zebrafish oil red O staining and TG and TC content detection under exogenous astaxanthin conditions. (A) WT and bco2b - / - (A) Oil Red O staining bright field image of zebrafish, scale bar: 0.5 mm; (B) OD value quantified by Oil Red O staining; (C) Triglyceride (TG) content determination; (D) Total cholesterol (TC) content determination.

[0025] Figure 10 For 10 dpf WT and bco2b - / - Figure 1. RT-qPCR results of lipid metabolism gene expression in zebrafish under exogenous astaxanthin conditions.

[0026] Figure 11 WT and WT of animals not fed and fed astaxanthin bco2b - / - Comparative images of body color in adult zebrafish. (A) Phenotype of wild-type (WT) zebrafish (unfed and fed astaxanthin); (B) Phenotype of wild-type zebrafish (unfed and fed astaxanthin). bco2b - / - Group Zebrafish Phenotype; (C) WT and bco2b - / - Side skin of adult zebrafish a *Significance analysis of the values; (D)WT and bco2b - / - Side skin of adult zebrafish b *Significance analysis of the values.

[0027] Figure 12 WT and WT of animals not fed and fed astaxanthin bco2b - / - Comparative images of the visceral mass and muscle of adult zebrafish. (A) Unfed and (B) Feeded with astaxanthin. bco2b - / - Phenotypes of visceral mass and muscle in zebrafish.

[0028] Figure 13 Feeding with astaxanthin at WT and bco2b - / - Figure 1 shows the results of astaxanthin content determination in various tissues of adult zebrafish. (A) Astaxanthin content in eyes; (B) Astaxanthin content in skin; (C) Astaxanthin content in intestines; (D) Astaxanthin content in muscle; (E) Astaxanthin content in liver.

[0029] Figure 14 Feeding with astaxanthin at WT and bco2b - / - Figure 1 shows the results of antioxidant index determination in the liver of adult zebrafish. (A) T-AOC content; (B) T-SOD content.

[0030] Figure 15Feeding with astaxanthin at WT and bco2b - / - Image showing the results of Oil Red O staining and TG and TC content detection in adult zebrafish muscle. (A) Whole body Oil Red O staining, with a magnified view of the black box on the right, scale bar: 1.25 mm; (B) TG content in the liver; (C) TG content in the muscle; (D) TC content in the liver; (E) TC content in the muscle.

[0031] Figure 16 Feeding with astaxanthin at WT and bco2b - / - Figure 1. RT-qPCR results of lipid metabolism gene expression in adult zebrafish muscle. Detailed Implementation

[0032] To make the content of this invention easier to understand, the technical solutions of this invention will be further described below in conjunction with specific embodiments and accompanying drawings, but this invention is not limited thereto.

[0033] Unless otherwise specified, the methods used in this invention are all conventional techniques.

[0034] In the following embodiments, bco2b - / - represent bco2b A 2 bp deletion in exon 2 of the gene bco2b homozygous mutant, bco2b + / - Represents a heterozygous mutant. bco2b + / + Represents the wild type.

[0035] The construction process of the salmon-fleshed fish germplasm of this invention is as follows: Figure 1 .

[0036] Example 1: Zebrafish bco2b gene knockout 1. Zebrafish bco2b Preparation method of gene sgDNA bco2b The gene's Gene ID is 678554, located on the zebrafish chromosome. bco2b Based on target prediction and confirmation of target specificity, the 5'-aggtggtcgtaatgggctctg-3' (SEQ ID NO:1) target sequence was selected as the protein coding region of the gene. Primers for the synthesis of sgDNA were designed as follows: bco2b-sg-F:5'-gaaattaatacgactcactataggagtggtcgtaatgggctctggttttagagctagaaatagc-3' (SEQ ID NO:3); bco2b -sg-R:5'-ttgtgaaaagcaccgactcggtgccactttttcaagttgataacggactagccttattttaacttgctattt ctagctctaaaac-3' (SEQ ID NO:4); (1) Synthesis of DNA template Prepare a 50 μL PCR reaction system as shown in Table 1, and the PCR reaction procedure is shown in Table 2; at the same time, prepare 4 tubes of PCR reaction solution for PCR to obtain a sufficient amount of template.

[0037] Table 1 PCR reaction system

[0038] Table 2 PCR reaction procedure

[0039] (2) Recycling If the correct bands are obtained after the procedure, follow the instructions for the SanPrep Column DNA Gel Extraction Kit to perform gel cutting and extraction.

[0040] 2. Zebrafish bco2b Preparation method of gene sgRNA sgDNA was transcribed into sgRNA using the T7 transcription kit and then purified and recovered. The in vitro transcription reaction system is shown in Table 3. In vitro transcription reaction conditions: After reacting at 42℃ for 4 h in a PCR instrument, 1 μL of DNA digesting enzyme was added, and the reaction was continued at 42℃ for 30 min in a PCR instrument.

[0041] Table 3 In vitro transcription reaction system

[0042] The transcribed sgRNA was then purified using reagents such as Phenol:Chloroform:Isoamyl Alcohol (25:24:1), Chloroform:Isoamyl Alcohol (24:1), isopropanol, and 75% ethanol to obtain a suitable sgRNA for zebrafish. bco2bThe gene knockout sgRNA fragment has the following sequence: 5'-AGUGGUCGUAAUGGGCUCUGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUUGAUCACUUGAAAAGUGGCACCGAGUCGGUGCUUUUCACAA-3' (SEQ ID NO:2).

[0043] 3. bco2b Gene knockout and identification methods Mix sgRNA and Cas9 protein according to the ratio in Table 4, inject into single-cell stage embryos, transfer the injected embryos to a small aquarium, and incubate at 28℃. On the same day, promptly remove dead eggs to prevent affecting the normal hatching of other eggs, and change the aquarium water. The next morning after injection, remove dead eggs again and change the water until the zebrafish embryos hatch normally.

[0044] Table 4 Cas9 protein reservoir

[0045] Thirty embryos were prepared 48 hours after injection for whole-genome extraction to identify positive zebrafish. Primers were designed 200-500 bp upstream and downstream of the Cas9 cleavage site for subsequent PCR reactions. The sequencing primers were designed as follows: forward primer F: 5'-tgaaactcttcttttgctccacag-3', reverse primer F: 5'-caaattggtactcacctgcttct-3'. The obtained genome was then amplified by PCR using the following reaction system: Table 5 PCR reaction system

[0046] The PCR reaction stock solution was sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were compared with the wild-type zebrafish gene sequence to determine whether it was a mutant. If the sequencing result peaks overlapped at the sgRNA target site, it indicated that the sgRNA target was an effective target, and the mutation was introduced during the repair process after cleavage at the corresponding target site. The remaining zebrafish embryos were then cultured to adulthood.

[0047] Adult F0 generation zebrafish were crossed one by one with wild-type zebrafish. Ten fertilized embryos from each parent were collected, and their genomes were extracted after 48 hours. PCR was then used for identification. If overlapping peaks appeared near the sgRNA target site in the sequencing chromatogram, it indicated that the F0 parent was a heritable mutant, and that all offspring of this mutant were heterozygous mutants (F1 generation). These heterozygous mutant offspring were then raised to adulthood. After the F1 generation reached adulthood, males and females were mated, and the resulting embryos were wild-type (…). bco2b+ / + ), heterozygous mutant ( bco2b + / - ), homozygous mutant ( bco2b - / - The mixed embryos were cultured for one month, and their tails were clipped to extract the genome. The genome was then identified by PCR testing to obtain homozygous embryos.

[0048] Zebrafish bco2b The gene is located on chromosome 6 and contains 14 exons. This invention designs a specific sgRNA targeting exon 2 of this gene to mediate targeted mutations. Figure 2 A), and successfully screened out in bco2b A two-base deletion occurred at positions 258 and 259 of exon 2 of the gene, with the deleted bases being AG, resulting in a homozygous mutant. Figure 2 BD). From bco2b + / - A total of 119 zebrafish were identified in the F2 generation obtained by self-pollination of heterozygotes. bco2b - / - 26 homozygous mutants were identified, accounting for 21.85% ( Figure 2 E). And this type of mutation leads to bco2b Premature termination of protein translation results in the protein being truncated from 555 amino acids to only 54 amino acids, a deletion of 501 amino acid residues. This mutation leads to... bco2b The loss of a gene's complete functional domain, resulting in a loss-of-function protein, indicates that the mutant was successfully constructed. Figure 2 F).

[0049] Example 2 bco2b - / - Zebrafish phenotypic analysis 1. bco2b The effects of gene deletion on the growth and development of zebrafish WT and bco2b Zebrafish strains with genetic mutations were routinely maintained and passaged under identical rearing conditions. Morphological observation of the embryos was performed using a stereomicroscope when they reached 0.5, 24, and 120 hpf, and representative images were collected. ImageJ software was then used for quantitative analysis of the collected images to assess phenotypic differences in zebrafish embryos. The results showed that phenotypic differences could be observed in embryos 30 minutes after fertilization. bco2b - / - Homozygous mutant embryos exhibit a distinctly orange body color. Figure 3 Further analysis of 120 hpf zebrafish juveniles revealed that, compared to wild-type, bco2b - / - Body length (mm) and pericardial area (mm²) of homozygous mutants 2), swim bladder area (mm 2 ) and yolk sac area (mm 2 There were no significant differences between them. Figure 4 The results show that... bco2b The absence of a gene may not affect the growth and development of zebrafish.

[0050] 2. Under maternal astaxanthin conditions bco2b Effects of gene deletion on astaxanthin and lipid metabolism S1: In order to investigate bco2b The effect of gene deletion on carotenoid metabolism was investigated using ELISA on 120 hpf unfed animals. bco2b - / - Astaxanthin content was determined in homozygous mutant juvenile fish. Total RNA was extracted from the juvenile fish and detected by RT-qPCR using the extracted total RNA as a template. scarb1 mRNA expression level of gene (Gene ID: 387260). cDNA was obtained according to the instructions of the Yugong Bio kit. The obtained cDNA was diluted 5 times and used as a template for RT-qPCR. 5 μL of the solution, 10 μL of 2×qPCR Mix, 2 μL of forward and reverse primers, and water were added to a final volume of 20 μL in an eight-tube RT-qPCR instrument for 1 h.

[0051] Table 6 RT-qPCR reaction procedure

[0052] After the reaction is complete, use Excel to calculate 2 -△△Ct Calculate and perform data analysis, select β-actin As an internal reference gene.

[0053] The results showed that, compared to WT, bco2b - / - The astaxanthin content was significantly upregulated in homozygous mutants; in addition, key genes for carotenoid transport were also affected. scarb1 Expression analysis shows that, compared to WT, bco2b - / - The mutant showed a significant downregulation trend. Figure 5 ).

[0054] S2: In order to investigate bco2b The effect of gene deletion on lipid metabolism was studied by collecting wild-type and... bco2b - / -Homozygous mutant zebrafish juveniles were fixed overnight in 4% paraformaldehyde solution at 4°C. The following day, they were washed three times with PBST buffer, followed by permeabilization with 60% isopropanol for 30 min. After treatment, the zebrafish juveniles were transferred to freshly filtered 0.3% Oil Red O working solution and stained in the dark for 3 h. After staining, the Oil Red O staining solution was discarded, and the juveniles were slowly destained with 60% isopropanol for 2 min. Finally, the juveniles were washed three times with PBST buffer. The staining of the juveniles was observed under a stereomicroscope, and clear images were acquired to further analyze the distribution and deposition of lipids in the juveniles. Triglycerides (TG) and total cholesterol (TC) were measured using kits provided by Nanjing Jiancheng Bioengineering Research Institute. Simultaneously, the mRNA expression levels of lipid metabolism-related genes were detected using RT-qPCR.

[0055] The results are as follows Figure 6 , 7 As shown, compared to WT, bco2b - / - Significant lipid deposition was observed in the mutant, particularly in the yolk sac region where staining was more intense; simultaneously... bco2b - / - The levels of TG and TC were both significantly upregulated. In the RT-qPCR results, lipid metabolism-related genes... cd36 (Gene ID: 436636) and fasn (Gene ID: 559001) genes were all significantly downregulated, while acacb (Gene ID: 556236) cpt2 (Gene ID: 100005717) and cpt1b All genes (Gene ID: 449677) were significantly upregulated. This indicates that under maternal astaxanthin conditions... bco2b Gene deletion may lead to abnormal lipid metabolism and deposition in zebrafish juveniles.

[0056] 3. Under the condition of exogenous astaxanthin bco2b Effects of gene deletion on astaxanthin and lipid metabolism The astaxanthin and lipid metabolism of zebrafish juveniles fed with astaxanthin-containing brine shrimp larvae at 10 dpf were analyzed using the method described above. The results showed that... bco2b - / - The astaxanthin content and T-SOD activity in the mutant were both significantly upregulated. Figure 8 Oil Red O staining revealed that the liver and yolk sac regions of juvenile fish were significantly more stained than those of WT fish, and the contents of TG and TC were significantly higher than those of WT fish. Figure 9 ); lipid metabolism-related genes acaca (Gene ID: 559403) was significantly upregulated, while fasn(Gene ID:559001) acacb (Gene ID: 556236) cpt2 (Gene ID: 100005717) and cpt1b (Gene ID:449677) All genes were significantly downregulated. Figure 10 It can be seen that under the condition of exogenous astaxanthin, bco2b Gene deletions can also lead to astaxanthin accumulation and abnormal lipid deposition.

[0057] Example 3: Astaxanthin feeding on bco2b - / - Phenotypic analysis of adult mutant zebrafish 1. bco2b Effects of gene deletion on astaxanthin deposition After feeding with astaxanthin, the system analysis showed that WT and bco2b - / - The color of the body surface, visceral mass, and muscle of adult mutant zebrafish. The basal diet used contained crude protein, crude fiber, crude ash, and crude fat. Based on this, two isonitrogenous and isolithic experimental diets were formulated: a control group (Group C) with 0 mg / kg astaxanthin and an experimental group (Group S) with 100 mg / kg astaxanthin. From WT and bco2b - / - Sixty healthy, undamaged individuals of similar body shape were randomly selected from each mutant zebrafish strain as experimental subjects. Before the formal experiment, the zebrafish underwent a one-week acclimatization period, during which they were fed a basic diet at 10:00 AM and 5:00 PM daily. After the acclimatization period, the zebrafish were starved for 24 hours. Subsequently, each strain was randomly divided into two groups (control group C and experimental group S), with 10 fish in each group. Three parallel samples were set up and placed in different aquariums to begin the formal experiment.

[0058] During the formal experiment, zebrafish were housed in a recirculating aquaculture system. Environmental parameters were uniformly controlled as follows: water temperature maintained at 28℃, pH value maintained between 7.0 and 8.0, and dissolved oxygen content maintained between 7 and 8 mg / L. A 14-hour light cycle and 10-hour dark cycle were used to ensure stable growth of the zebrafish. The experiment lasted 45 days. Sufficient feeding was provided twice daily, at 10:00 AM and 5:00 PM. After feeding, uneaten food and feces were promptly removed from the tanks, and one-third of the water was replaced to maintain water quality. Throughout the rearing period, the feeding status and health of each zebrafish strain were continuously observed, and the number of deaths in each tank was accurately recorded to ensure the accuracy of the experimental data.

[0059] At the end of the experiment, zebrafish were first photographed using a Canon 700D SLR camera to observe their overall color. Body color parameters were quantified using a 3nh NR60CP precision colorimeter manufactured by Guangdong Sanenshi Intelligent Technology Co., Ltd. The measurement site was uniformly selected on the skin area of ​​the trunk between the dorsal and pelvic fins, and measurements were repeated three times, with the average value taken. Color indices were based on the CIELAB standard established by the International Commission on Illumination (CIE), which includes: L The value of * ranges from 0 to 100, with values ​​from low to high representing black to white. a Positive values ​​represent red, and negative values ​​represent green. b *Positive values ​​represent yellow, and negative values ​​represent blue. An 8 mm measuring aperture was used during the testing process, paired with a D65 standard light source. Calibration was performed using a black and white calibration plate before measurement to ensure data accuracy and reliability. Furthermore, the analysis of visceral masses and flesh color was conducted using a Leica inverted microscope for imaging and observation.

[0060] The results showed that, overall, in male fish, the astaxanthin-fed group (S group) exhibited increased body surface brightness and significantly deeper color depth compared to the control group (C group), particularly noticeable in the body stripes and fins. However, this phenomenon was not significant in female fish. Among the astaxanthin-fed groups, compared to the wild-type group (WS group), bco2b - / - The male fish in the mutant group (BS group) showed a significantly darker body color, which was also confirmed by the colorimeter data. Figure 11 ). Observation of the color of the viscera and muscles revealed that, compared with the WC group, the livers of male fish in the BC group were bright red, while the ovaries and adipose tissue of female fish were deep orange; compared with the WS group, the red and orange colors of the viscera in the BS group were further deepened compared with the BC group. Figure 12 This indicates that, bco2b The gene plays a crucial role in astaxanthin metabolism in zebrafish, and its deletion may lead to the excessive deposition of astaxanthin in visceral tissues such as muscle, liver, ovaries, and fat. Therefore, bco2b Gene deletion increases the brightness of the zebrafish's body surface and darkens the color of its internal organs, but there is no significant change in muscle color that is visible to the naked eye.

[0061] 2. bco2b Effects of gene deletion on astaxanthin content and muscle lipid metabolism in adult zebrafish tissues S1: The astaxanthin content in each tissue was determined according to the method in Example 2. The results showed that, compared with the WS group, the astaxanthin content in the eye and skin tissues of the BS group was significantly lower, while it was significantly higher in the intestinal, muscle, and liver tissues. Figure 13 ).

[0062] S2: Referring to Example 2, adult female zebrafish from the WS and BS groups were selected. Lipid distribution was observed through tissue sections combined with Oil Red O staining (Oil Red O dye dissolves in fat and stains triglycerides and other neutral fats red). Quantitative analysis was performed using a kit. Results showed that compared to the WS group, the BS group had significantly increased lipid content in muscle tissue, and more pronounced lipid droplet accumulation. Simultaneously, the TG content in the liver and muscle tissue of the BS group was significantly higher than that of the WS group, while the TC content showed an upward trend. Figure 14-15 ).

[0063] S3: The expression levels of lipid metabolism-related genes were analyzed according to Example 2. The results showed that, except for... fasn No significant changes were observed in the genes, but all other genes were significantly upregulated. Figure 16 ).

[0064] Table 7 WT and bco2b - / - Statistics on the growth performance of adult zebrafish Note: Weight gain rate (WGR) = 100 × (final weight - initial weight) / initial weight; Specific growth rate (SGR) = 100 × (ln final body weight - ln initial body weight) / number of days of rearing; Survival rate SR = 100 × number of fish tails that survived at the end / number of fish tails at the beginning; Condition factor (CF) = 100 × fish weight / fish length 3 .

[0065] The results showed that, among them, astaxanthin-fed... bco2b - / - The WGR and SGR of the BS group were significantly higher than those of the WS group fed with astaxanthin (P<0.05). This indicates that adding astaxanthin to the feed may significantly improve... bco2b - / - Growth performance of mutant zebrafish.

[0066] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made within the scope of the claims of the present invention should be included in the scope of the present invention.

Claims

1. A method for constructing germplasm of salmon-like fish, characterized in that: Includes the following steps: (1) Design of target fish bco2b The sgRNA of exon 2 of the gene, the target sequence of the sgRNA is shown in SEQ ID NO:1, and the sequence of the sgRNA is shown in SEQ ID NO:2; (2) Mix the Cas9 protein with the above-mentioned sgRNA to form a ribonucleoprotein complex; (3) The ribonucleoprotein complex was introduced into fish embryos via microinjection, and endogenous ribonucleoproteins were screened for. bco2b Mutants with missing gene function are used to obtain the germplasm of the target fish species.

2. The construction method according to claim 1, characterized in that: The bco2b Gene ID: 678554.

3. The construction method according to claim 1, characterized in that: The fish embryos mentioned are zebrafish embryos in the single-cell stage.

4. An endogenous substance obtained by the construction method according to any one of claims 1 to 3. bco2b Gene knockout zebrafish are characterized by: The zebrafish in bco2b Two bases were deleted at positions 258 and 259 of exon 2 of the gene.

5. The endogenous nature as described in claim 4 bco2b Application of gene knockout zebrafish in fish quality improvement.

6. The application according to claim 5, characterized in that: The zebrafish exhibited the following characteristics: (1) The astaxanthin content in the muscle increased significantly; (2) Astaxanthin metabolism genes were significantly reduced; (3) After feeding with astaxanthin, growth performance was significantly improved, and the content of triglycerides and total cholesterol was significantly increased; (4) Astaxanthin is deposited in muscle, liver, ovary and adipose tissue.

7. The application according to claim 6, characterized in that: The astaxanthin metabolism gene is scarb1 .

8. The application according to claim 6, characterized in that: The growth performance indicators are weight gain rate and specific growth rate.

9. A method for enhancing carotenoid pigment deposition in fish, characterized in that: By knocking bco2b Genes to achieve bco2b The gene function loss, the bco2b Gene ID: 678554.

Images