DsRNA nanocomplex of a plodia cuticular protein gene pxrr1-12 and preparation method and application thereof

Abstract

The application discloses a dsRNA nanocomplex of a Plutella xylostella cuticular protein gene PxRR1-12 and a preparation method and application thereof. The nucleotide sequence of the PxRR1-12 gene is shown as SEQ ID NO. 1, and the nucleotide sequence of the dsRNA of the PxRR1-12 gene is shown as SEQ ID NO. 2. The application combines a nano-carrier star-shaped polycation (SPc) with the dsPxRR-12 through electrostatic interaction, mixes them according to a mass ratio of 1:1, stands still at room temperature for 15 min, and forms the SPc-dsPxRR-12 nanocomplex. The nanocomplex can significantly improve the stability and delivery efficiency of the dsPxRR-12, effectively inhibit the expression of the target gene, has high silencing efficiency and a long effective period, can significantly reduce the survival rate of the Plutella xylostella in a high-temperature environment, and improve the sensitivity of the Plutella xylostella to a medicament. The application provides a new RNAi target and technical strategy for the green prevention and control of the Plutella xylostella, and has an important application prospect.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, and in particular relates to a dsRNA nanocomposite of the diamondback moth epidermal protein gene PxRR1-12, its preparation method and application. Background Technology

[0002] The diamondback moth (Plutella xylostella), belonging to the family Plutellaeidae in the order Lepidoptera, is a major agricultural pest originating in the Mediterranean region and now spreading globally, causing severe damage, especially in subtropical and tropical regions. In China, it is distributed throughout all provinces, with vegetables in the middle and lower reaches of the Yangtze River and areas south of it being particularly severely affected. This insect possesses strong migratory ability, environmental adaptability, high reproductive capacity, and significant pesticide resistance. Its main hosts are cruciferous crops such as cabbage and Chinese cabbage, but it can also damage various vegetables such as radish, cauliflower, mustard greens, rapeseed, tomato, potato, onion, and ginger, as well as some flowers and medicinal plants. Globally, the annual cost of controlling the diamondback moth is approximately US$4.5 billion, resulting in enormous economic losses. The diamondback moth has a high level of genomic variation and strong genetic plasticity, enabling it to rapidly adapt to environmental changes and selective pressures, and its damage is expected to continue in the future. Therefore, developing efficient, green, and sustainable diamondback moth control strategies is urgently needed.

[0003] RNA interference (RNAi) is a sequence-specific post-transcriptional gene silencing mechanism triggered by double-stranded RNA (dsRNA). It inhibits the expression of target genes by degrading homologous mRNA and is widely used in insect functional genomics research and pest control. However, applying RNAi technology to the practical control of lepidopteran pests (such as the diamondback moth) still faces significant challenges, primarily due to its generally low interference efficiency. Factors affecting efficiency mainly include: the selection of target genes (different genes have significantly different sensitivities to RNAi), insect species (for example, coleopterans typically exhibit higher RNAi sensitivity, while lepidopterans are relatively less sensitive), and the delivery efficiency of dsRNA within the insect. Insufficient dsRNA delivery efficiency within the insect is one of the key bottlenecks leading to the low efficiency of lepidopteran RNAi. To overcome this obstacle, various nanodelivery systems have been developed over the past two decades to improve the delivery efficiency and stability of dsRNA. For example, starpolycations (SPc) have cationic groups on their surface that can bind to negatively charged dsRNA through electrostatic interactions, forming nanocomposites. After insects take up this complex, it enters the cell primarily through cell membrane binding and endocytosis, encapsulates within endocytic vesicles, and is transported along microtubules to the endosomes. During this process, SPc protects dsRNA from nuclease degradation and promotes its release from the endosomes into the cytoplasm, thereby effectively exerting its gene silencing function. Currently, SPc delivery of dsRNA has achieved highly efficient RNAi effects in various insects, demonstrating its promising potential as a delivery vector for nucleic acid biopesticides.

[0004] Based on the above mechanism, some studies have attempted to assemble SPc with dsRNA targeting key genes in lepidopteran insects into nanocomposites, aiming to improve dsRNA delivery efficiency and prolong the duration of interference. However, existing technologies lack systematic research on RNAi target screening for the diamondback moth epidermal protein gene family and the application of its nanocomposites. This invention further discovers that SPc-dsRNA nanocomposites constructed by targeting specific epidermal protein genes can not only efficiently silence target genes but also delay the developmental stage of the diamondback moth, reduce its heat tolerance, and enhance its sensitivity to chemical agents. This provides a novel, multi-effect synergistic strategy for the green and sustainable control of the diamondback moth and can also provide technical reference for the RNAi control of other lepidopteran pests. Summary of the Invention

[0005] The purpose of this invention is to provide the nucleotide sequence of the diamondback moth epidermal protein gene PxRR1-12, its dsRNA, a nanocomposite containing the dsRNA, and its preparation method and application. This invention establishes an interference system using star-shaped polymeric cations (SPc) loaded with dsRNA. By loading dsPxRR1-12 onto SPc, the interference efficiency against diamondback moth is improved, significantly inhibiting PxRR1-12 expression, prolonging the interference time, reducing the survival rate of diamondback moth under high-temperature conditions, and increasing its sensitivity to pesticides, thereby achieving reduced pesticide use in the control of diamondback moth.

[0006] To achieve the above objectives, the present invention provides a diamondback moth epidermal protein gene PxRR1-12, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0007] The present invention also provides the dsRNA of the PxRR1-12 gene, the nucleotide sequence of which, dsPxRR-12, is shown in SEQ ID NO.2.

[0008] This invention also provides a dsPxRR1-12 nanocomposite comprising the aforementioned dsPxRR1-12 and a star-shaped polymeric cation (SPc) nanocarrier. The SPc nanocarrier and dsPxRR1-12 are bonded together via electrostatic interactions to form a stable SPc-dsPxRR1-12 nanocomposite. Preferably, the mass ratio of the SPc nanocarrier to dsPxRR1-12 is 1:1.

[0009] The present invention also provides a method for preparing the dsPxRR1-12 nanocomposite, wherein the nanocarrier SPc and dsPxRR1-12 are mixed at a mass ratio of 1:1 and allowed to stand at room temperature for 15 min to form a stable composite.

[0010] This invention also provides the application of the dsPxRR1-12 nanocomposite in the control of diamondback moth. The dsPxRR1-12 nanocomposite is delivered into the diamondback moth through spraying or ingestion, inhibiting the expression of the PxRR1-12 gene, reducing the diamondback moth's heat tolerance, increasing its sensitivity to pesticides, and promoting its mortality. Further, the spraying method involves applying the dsPxRR1-12 nanocomposite to the plant surface, allowing the diamondback moth larvae to ingest the dsPxRR1-12 nanocomposite when feeding on the plant.

[0011] Compared with the prior art, the present invention has the following beneficial effects:

[0012] This invention provides a diamondback moth epidermal protein gene, PxRR1-12. Using the diamondback moth as experimental material, the gene PxRR1-12, which significantly affects the survival and environmental adaptability of the diamondback moth, was screened. This invention utilizes electrostatic interactions to mount dsPxRR1-12 onto the nanomaterial SPc, preparing a dsPxRR1-12 nanocomposite in a specific ratio. This carrier effectively inhibits the expression of the diamondback moth epidermal protein gene PxRR1-12, significantly improving interference efficiency and duration, and significantly increasing the mortality rate of the diamondback moth under high-temperature conditions and its sensitivity to pesticides. The dsPxRR1-12 nanocomposite prepared by this invention effectively improves the in vitro and in vivo stability of dsPxRR1-12, significantly enhancing the interference efficiency and duration of the lepidopteran pest, the diamondback moth, and improving the effectiveness of environmental stress and pesticide control. This provides a new technical approach for the nucleic acid biopesticide control of the diamondback moth. This invention provides a novel RNAi target for diamondback moth control and has great application potential in environmentally friendly agriculture. Attached Figure Description

[0013] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0014] Figure 1 Gel electrophoresis images of SPc and dsPxRR1-12 at different mass ratios. In the images, the lane marker is the DNA molecular weight standard (DL2000), lane 1 is the mass ratio of SPc to dsPxRR1-12 1:2, lane 2 is the mass ratio 1:1, and lane 3 is the mass ratio 2:1.

[0015] Figure 2 This is a gel electrophoresis image showing the protective effect of SPc against dsPxRR1-12 against RNase. Lane 1 contains dsPxRR1-12; lane 2 contains dsPxRR1-12 and RNase; lane 3 contains dsPxRR1-12 and SPc; and lane 4 contains dsPxRR1-12, SPc, and RNase. The mass ratio of SPc to dsPxRR1-12 is 1:1.

[0016] Figure 3 The silencing efficiency of the PxRR1-12 gene at different time points after injection of dsPxRR1-12 and SPc-dsPxRR1-12, respectively.

[0017] Figure 4The results show the silencing efficiency of RNA interference by feeding. Figure A shows the interference efficiency after feeding with different feed ratios to dsPxRR1-12 (1g:60μg, 1g:120μg, 1g:180μg), and Figure B shows the interference efficiency at different time points after feeding with dsPxRR1-12 and SPc-dsPxRR1-12.

[0018] Figure 5 The figure shows the results of RNA interference-mediated reduction in the survival rate of diamondback moth under extreme high temperatures.

[0019] Figure 6 The figure shows the results of increased pesticide sensitivity in diamondback moth mediated by RNA interference. Detailed Implementation

[0020] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0021] All raw materials used in this invention are not particularly limited in their source; they can be purchased from the market or prepared using conventional methods known to those skilled in the art.

[0022] There are no particular restrictions on the purity of any of the raw materials used in this invention. However, this invention preferably uses raw materials of analytical grade or purity commonly used in the field of chemical synthesis.

[0023] This invention provides the cDNA sequence of the diamondback moth epidermal protein gene PxRR1-12. Gene identification was performed using a relevant HMM prototype in the Pfam database (http: / / pfam.sanger.ac.uk / ) as a template. A Hidden Markov Model (HMM) was used to search the diamondback moth reference genome database (Accession No. GCA_932276165.2), with an E-value set to 1*102. -6 The CDS sequence of the PxRR1-12 gene is shown in SEQ ID NO.1.

[0024] SEQ ID NO.1:

[0025] ATGAAATTCCTAGTACTAGCCCTGTGCGTGTGCGCCGCGTCCGCCGCGTCCTTCCCCAGCTACAACGCGCGCGCCACCGCCTACGTCCAGGCTGTCTCCTCCGTGGAGGTCCCGGCCCCCGCGCCCGTGGTCAAGTCCGTGACGGTCGAGGCCGCCCCCGCCCTGCCCGTCAGGTCGGCCGCCTTCGCCTCCAACGCCCAGGTCAAGAATGTGAACTACAACAACGAGGGAGAGGCCGTCATTGTGCGCTCCGAGAACGAGATCCTTCCTGAGGGATTCAACTACGCTTACGAGACCGGTAACGGAATCTTCGCTGAGTCCAGCGGCACCCTCAAGAGGGTCGACAACACCGAGGCTGTGGTGGTCCGTGGCTCGTACAGGTACTTGGCCCCTGACGGCACCCCGGTCGAGGTCCGGTACATCGCCGACGAAAACGGATTCCAGCCTGAGGGCAATGTCCTCCCCGTGGCGCCCGCCATCCCCGAGGCCATCCAGCGCTCCCTGCAGTACATCGCCGCCCACCCCGCGCAGGTCGAGCAGAGCTACAGGAAGCTGTAA

[0026] The present invention also provides dsRNA of said PxRR1-12 gene, wherein the nucleotide sequence of the dsRNA, dsPxRR-12, is as shown in SEQ ID NO.2.

[0027] SEQ ID NO.2:

[0028] ATGAAATTCCTAGTACTAGCCCTGTGCGTGTGCGCCGCGTCCGCCGCGTCCTTCCCCAGCTACAACGCGCGCGCCACCGCCTACGTCCAGGCTGTCTCCTCCGTGGAGGTCCCGGCCCCCGCGCCCGTGGTCAAGTCCGTGACGGTCGAGGCCGCCCCCGCCCTGCCCGTCAGGTCGGCCGCCTTCGCCTCCAACGCCCAGGTCAAGAATGTGAACTACAACAACGAGGG

[0029] Main Materials

[0030] SteadyPure RNA extraction kit was purchased from Hunan Aikerui Biotechnology Co., Ltd.; T7 RiboMAX™ Express RNAi System kit was purchased from Promega; DNA marker was purchased from Takara Bio Engineering Co., Ltd. (Dalian); 2× Phanta Max Master Mix was purchased from Nanjing Nuowei Biotechnology Co., Ltd.; all other reagents were purchased from Sangon Biotech (Shanghai) Co., Ltd. Primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. SPc nanomaterials (star-shaped polymeric cations) were prepared according to the method disclosed in China Agricultural University Patent 201810350562.7. The diamondback moth strain used was a sensitive strain raised in the laboratory.

[0031] Example 1. Gene cloning and in vitro synthesis of dsPxRR1-12

[0032] (1) Extraction of diamondback moth RNA and synthesis of cDNA: Total RNA was extracted from diamondback moth using the SteadyPure RNA Extraction Kit. The integrity and quality were assessed by Nano Vue spectrophotometer and 2% agarose gel electrophoresis. cDNA was synthesized using the total RNA as a template and a cDNA reverse transcription kit.

[0033] (2) PCR amplification and product purification: Based on the predicted PxRR1-12 sequence from the diamondback moth genome database, CDS-specific primers were designed using Oligo7. PCR amplification was performed using cDNA as a template with a 2×Phanta Max Master Mix (Dye Plus) kit. A 50 μL reaction mixture was prepared: 25 μL 2×Master Mix, 2 μL each of forward and reverse primers, 2 μL cDNA template, and RNase-free water to a final volume of 50 μL. After thorough mixing and brief centrifugation, the following program was run in the PCR instrument: 95℃ pre-denaturation for 3 min; 34 cycles (95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 2 min); 72℃ final extension for 5 min. The PCR products were separated by 2% agarose gel electrophoresis and purified according to the gel purification kit instructions.

[0034] The primer sequences used are as follows:

[0035] PCR-PxRR1-12-F (SEQ ID NO.3):ATGAAATTCCTAGTACTAGCCCTGTGC

[0036] PCR-PxRR1-12-R (SEQ ID NO.4):GAGCAGAGCTACAGGAAGCTGTAA

[0037] (3) Design and synthesis of dsPxRR1-12 primers: Primers carrying the T7 promoter for the synthesis of dsPxRR1-12 were designed using Oligo7, and the sequences are as follows (the underlined part is the T7 promoter sequence):

[0038] dsPxRR1-12-F (SEQ ID NO.5):

[0039] TAATACGACTCACTATAGGG ATGAAATTCCTAGTACTAGCCCTGTGC

[0040] dsPxRR1-12-R (SEQ ID NO.6):

[0041] TAATACGACTCACTATAGGG CCCTCGTTGTTGTAGTTCACATTCT

[0042] In vitro transcription was performed using the Belongbio T7 RNA Transcription Kit with gel-recovered DNA as a template. The specific steps were as follows: ① Prepare the following reaction mixture (50 μL): DNA 1 μg, RNase Inhibitor 1 μL, NTP Mix 8 μL, 10× Transcription Buffer 5 μL, T7 RNA Polymerase 1 μL, and RNase-Free water to a final volume of 50 μL. ② Gently mix the reaction mixture and incubate at 37°C for 2–8 h. ③ Add 2 U / μL DNase I 1 μL to the reaction mixture and incubate at 37°C for 15 min to digest the DNA template. ④ RNA purification: Extract with an equal volume of phenol / chloroform mixture; extract twice with chloroform; precipitate RNA with two volumes of anhydrous ethanol; wash the precipitate twice with 70% ethanol; dissolve the RNA in nuclease-free water.

[0043] Synthesis of control dsGFP: Double-stranded dsRNA of the green fluorescent protein gene GFP (dsGFP) was used as a negative control. Using a plasmid containing the GFP gene sequence as a template, PCR amplification was performed using specific primers carrying the T7 promoter to obtain an in vitro transcription template. Then, dsGFP was synthesized according to the in vitro transcription method described above.

[0044] The primer sequences used are as follows (the underlined parts are the T7 promoter sequences):

[0045] dsGFP-F (SEQ ID NO.7): TAATACGACTCACTATAGGG CACAAGTTCAGCGTGTCC

[0046] dsGFP-R (SEQ ID NO.8): TAATACGACTCACTATAGGG GGTGCTCAGGTAGTGGTT

[0047] Example 2. Preparation of dsRNA nanomaterial composites

[0048] Positively charged nitrogen ions on the periphery of SPc bind to negatively charged dsPxRR1-12 via electrostatic attraction. SPc and dsPxRR1-12 were mixed at three mass ratios of 2:1, 1:1, and 1:2 and allowed to stand at room temperature for 15 min to prepare nanocomposite solutions. Agarose gel electrophoresis was used to analyze the composites and screen for the optimal ratio of dsPxRR1-12 to SPc.

[0049] The results are as follows Figure 1 As shown, when the mass ratio of SPc to dsPxRR1-12 was 2:1, some dsPxRR1-12 failed to completely bind with SPc, leading to the migration of some dsPxRR1-12 under the influence of the electric field. When the mass ratios were 1:1 and 1:2, dsPxRR1-12 completely bound to SPc, and the complex remained at the sample well, with no free dsPxRR1-12 bands observed. Therefore, a mass ratio of SPc to dsPxRR1-12 of 1:1 is the optimal composite ratio.

[0050] The protective ability of the nanocarrier SPc on dsPxRR1-12: The dsPxRR1-12 nanocomposite prepared according to the above method was diluted to 500 ng / µL, and an appropriate amount of RNase was added and incubated at room temperature for 15 min. Subsequently, the mass of dsPxRR1-12 was detected by agarose gel electrophoresis.

[0051] Gel electrophoresis analysis showed ( Figure 2 In the untreated sample, a clear dsPxRR1-12 band was visible (lane 1), but this band disappeared after RNase treatment (lane 2). In contrast, when dsPxRR1-12 pre-binded with SPc to form a complex, a bright signal was still detected at the sample well after RNase treatment (lane 4), indicating that dsPxRR1-12 in the complex was not degraded. These results demonstrate that SPc can effectively protect dsPxRR1-12 from RNase degradation.

[0052] Example 3. Detection of the inhibition of the expression of the target gene PxRR1-12 in Plutella xylostella by SPc-dsPxRR1-12 nanocomposite

[0053] (a) SPc-based injection-based RNA interference

[0054] Diamondback moth larvae were reared to the end of the 3rd instar, and 100 nL of dsPxRR1-12 (6000 ng / µL) or a dsPxRR1-12 nanoparticle complex (with an equal concentration of dsGFP as a control) was injected into the abdomen of the larvae using a microinjection system. Gene expression levels were detected at 6 h, 12 h, 24 h, and 48 h post-injection, as well as at the pupal stage (1 d, 2 d) and adult stage (1–4 d). qRT-PCR was used to detect gene expression levels to assess gene silencing efficiency.

[0055] The results are as follows Figure 3 As shown, without SPc, gene silencing after injection of dsPxRR1-12 only lasted until the pupal stage, with a silencing efficiency ranging from 22.37% to 79.46%. However, after SPc loading, the duration of the interference effect was significantly prolonged, extending into the adult stage, with the silencing efficiency increasing to 26.27% to 89.72%. This indicates that SPc can significantly improve interference efficiency and prolong interference time.

[0056] (ii) SPc-based feeding method for RNA interference

[0057] The feed is prepared according to the following formula: First, add 20 g of yeast powder, 6 g of agar, and 250 mL of distilled water to a beaker and bring to a boil. Then, add 37.5 g of wheat germ powder, 0.5 g of compound vitamins, 1 g of sorbic acid, 1 g of parabens, 1 g of ascorbic acid, 3 g of radish seed powder, and 10 g of sugar to the beaker and stir well. Next, add 1 mL of rapeseed oil and 1-2 drops of linoleic acid to the beaker, pour the mixture into a prepared disposable food container, and after it solidifies and cools, store it in a refrigerator at 4°C.

[0058] Weigh 1 g of feed, crush it, and mix it thoroughly with 60 μg, 120 μg, and 180 μg of dsPxRR1-12 or dsPxRR1-12 nanoparticle complex (with an equal concentration of dsGFP as a control). Spread the mixture evenly in petri dishes and air dry in a clean bench. Inoculate each dish with 30 late-stage third-instar diamondback moth larvae. Collect samples 24 h after feeding, and use qPCR to detect gene expression levels to screen for the optimal feed-dsPxRR1-12 mixing ratio.

[0059] The results are as follows Figure 4 As shown in Figure A, compared with the control group, the treatment groups containing 60 μg, 120 μg, and 180 μg of dsPxRR1-12 in the feed all significantly inhibited the expression of the PxRR1-12 gene, and the treatment group carried by SPc showed a stronger gene silencing effect. The interference effect of 180 μg in the feed was the most significant.

[0060] Weigh 1 g of feed, crush it, and mix it thoroughly with 180 μg of dsPxRR1-12 or dsPxRR1-12 nanoparticle complex (with an equal concentration of dsGFP as a control). Spread the mixture evenly in a petri dish and air-dry it in a clean bench. Inoculate each dish with 30 late-stage 3rd instar diamondback moth larvae. Collect samples on the first and second days of the 4th instar, the first and second days of the pupal stage, and the first to fourth days after emergence. qRT-PCR was used to detect gene expression levels to assess gene silencing efficiency.

[0061] The results are as follows Figure 4 As shown in Figure B, without SPc, gene silencing after consuming feed containing dsPxRR1-12 only lasted until the pupal stage, with a silencing efficiency ranging from 28.47% to 49.60%. However, after consuming feed containing SPc-dsPxRR1-12, gene silencing could last until the adult stage, with a silencing efficiency ranging from 29.95% to 70.22%. This indicates that SPc can significantly improve interference efficiency and prolong interference duration.

[0062] Example 4. Application of SPc-dsPxRR1-12 nanocomposite in the control of diamondback moth

[0063] (a) High-temperature environmental stress test

[0064] Fourth-instar diamondback moth larvae were subjected to feeding interference, with the feed mixed with dsPxRR1-12 at a ratio of 1 g:180 μg. Twenty-four hours after feeding, single pupae from both the control and interference treatment groups were placed in perforated 1.5 mL centrifuge tubes. After emergence, each treatment group consisted of 20 females or males as one replicate, with a total of four biological replicates per treatment group. The larvae were treated at 38–43 °C for 2 hours, followed by placement in a 26 °C climate chamber for 24 hours. Surviving individuals were observed (survival was indicated by movement of any appendage, such as legs, mouthparts, antennae, or wings), and the survival rate was calculated.

[0065] The results are as follows Figure 5 As shown, in 4th instar larvae, after silencing PxRR1-12, the larval survival rate of the dsPxRR1-12 treatment group was significantly lower than that of the control group, regardless of whether it was carried by SPc. This indicates that interfering with PxRR1-12 can significantly reduce the high-temperature tolerance of the diamondback moth.

[0066] (ii) Drug sensitivity testing

[0067] The technical grade insecticides, namely cypermethrin, abamectin, brofenoxam, and emamectin benzoate, were dissolved in 95% acetone to prepare a stock solution with a concentration of 1000 μg / mL. This stock solution was then diluted to a series of concentrations with 0.1% Triton-X aqueous solution. The experimental concentrations of cypermethrin, abamectin, brofenoxam, and emamectin benzoate were 19.899 mg / L, 6.506 mg / L, 0.0151 mg / L, and 0.0334 mg / L, respectively. Take a 25 mL dipping cup and evenly drop 200 μL of the drug solution onto the surface of the artificial feed. After air-drying in a ventilated place for about 2 hours, transfer 10 third-instar diamondback moth larvae subjected to feeding interference into each cup. The feed and dsPxRR1-12 are mixed at a ratio of 1 g:180 μg (dsGFP group, free dsPxRR1-12 group, and SPc-dsPxRR1-12 group). Place them in an incubator for continued rearing. After 48 hours, observe the surviving individuals (judgment criteria as above) and calculate the survival rate.

[0068] The results are as follows Figure 6 As shown, after treatment with high-efficiency cypermethrin, abamectin, brofenoxam, and emamectin benzoate, the survival rates of diamondback moths in both the free dsPxRR1-12 group and the SPc-dsPxRR1-12 group were significantly lower than those in the control group. This indicates that interfering with PxRR1-12 can significantly improve the pesticide sensitivity of diamondback moths. In the field, combining dsRNA (dsPxRR1-12) with this treatment can reduce the amount of pesticides used.

[0069] The above description is only a partial embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

[0070] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A diamondback moth epidermal protein gene PxRR1-12, characterized in that: Its nucleotide sequence is shown in SEQ ID NO.

1.

2. The dsRNA of the diamondback moth epidermal protein gene PxRR1-12 as described in claim 1, characterized in that: The nucleotide sequence of the dsRNA, dsPxRR-12, is shown in SEQ ID NO.

2.

3. The application of the diamondback moth epidermal protein gene PxRR1-12 as described in claim 1 in the control of diamondback moth.

4. The application of the dsRNA of the diamondback moth epidermal protein gene PxRR1-12 as described in claim 2 in the control of diamondback moth.

5. A dsRNA nanocomposite, characterized in that: It comprises the dsPxRR-12 as described in claim 2 and the star-shaped polymeric cation nanocarrier.

6. The dsPxRR-12 nanocomposite according to claim 5, characterized in that: The mass ratio of the star-shaped polymeric cations of the nanocarrier to dsPxRR-12 is 1:

1.

7. The method for preparing the dsPxRR-12 nanocomposite according to claim 5 or 6, characterized in that: The star-shaped polymeric cations of the nanocarrier were mixed with dsPxRR1-12 at a mass ratio of 1:1 and allowed to stand at room temperature for 15 min to form a stable complex.

8. The application of the dsPxRR1-12 nanocomposite according to claim 5 or 6 in the control of diamondback moth.

9. The application according to claim 8, characterized in that: By applying the dsPxRR1-12 nanocomposite to the crop to be controlled, the dsPxRR1-12 nanocomposite is delivered into the diamondback moth, inhibiting the expression of the diamondback moth epidermal protein gene PxRR1-12, reducing the diamondback moth's high-temperature tolerance, and increasing the diamondback moth's sensitivity to pesticides.

10. The application according to claim 9, characterized in that: The application involves spraying the dsPxRR1-12 nanocomposite onto the surface of the crop to be treated, and the diamondback moth larvae ingest the dsPxRR1-12 nanocomposite when feeding on the crop.

Images