Application of Photosystem Ⅱ Protein Gene TaPSII in Regulating Wheat Leaf Color and Net Photosynthetic Efficiency

Abstract

The application discloses a photosystem II protein related gene TaPSII The application discloses an application of the gene in regulating wheat leaf color and net photosynthetic efficiency. TaPSII The nucleotide sequence of the gene in common hexaploid wheat Chinese Spring is shown as SEQ ID NO. 1. TaPSII Overexpression of the gene in wheat can significantly deepen leaf color, increase the net photosynthetic rate of the leaf; and TaPSII Decreasing the expression of the gene in wheat can make the leaf color lighter and the net photosynthetic rate of the leaf decrease. TaPSII Therefore, the photosystem II protein gene provided by the application can be used for improving photosynthesis of wheat, and lays a foundation for establishing new germplasm of high light efficiency of wheat.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology applications and relates to the photosystem II protein gene. TaPSII Its application in regulating wheat leaf color and net photosynthetic efficiency specifically involves a photosystem II protein gene derived from common hexaploid wheat. TaPSII And its application in improving wheat leaf color and net photosynthetic rate. Background Technology

[0002] Wheat (Triticum aestivum) L Wheat is an important food crop, and its yield is closely related to leaf photosynthesis. Leaf color reflects chlorophyll content, chloroplast development, and the state of the photosynthetic membrane system. Therefore, wheat leaf color mutants are important materials for studying chlorophyll metabolism, chloroplast development, and photosynthetic regulation, and can also provide genetic resources for the genetic improvement of photosynthetic traits and germplasm innovation.

[0003] Photosystem II (PSII) is a multi-subunit pigment-protein complex located on the thylakoid membrane of chloroplasts. It utilizes light energy to oxidize water, release molecular oxygen, and provide electrons for the photosynthetic electron transport chain. The assembly, stabilization, and repair of PSII are crucial for maintaining light conversion efficiency. During PSII formation, various accessory proteins temporarily bind to assembly intermediates and dissociate after the complex matures. Studies have shown that proteins related to PSII assembly and stability significantly affect the structure and function of the photosystem. In Arabidopsis, LOW PSII ACCUMULATION 1 (LPA1) participates in the efficient assembly of PSII; loss of LPA1 function reduces PSII complex accumulation and affects the stability of core proteins such as D1, D2, CP43, and CP47 (Peng et al., 2006). The chloroplast cyclophilic protein CYP38 participates in the assembly and maintenance of the PSII supercomplex; its loss of function leads to decreased PSII supercomplex stability and abnormal photosynthetic function (Fu et al., 2007). PSB27 is a helper protein involved in the assembly, repair, and maturation of PSII. It can bind to the CP43 chlorophyll-binding subunit of PSII to form the PSB27-PSII immature subcomplex, which dissociates during PSII maturation. Johnson et al. used cyanobacteria... Synechocystis The study sp. PCC 6803 found that the absence of PSB27 reduces non-photochemical fluorescence quenching ability. Researchers proposed that the immature PSII subcomplex formed by PSB27 and CP43 can dissipate some of the excess excitation energy before entering the functional PSII complex library, thereby reducing photodamage to PSII precursors and promoting PSII repair, maturation, and high-quality assembly (Johnson et al., 2022).

[0004] The above studies demonstrate that PSII-related proteins can regulate chlorophyll fluorescence, photosynthetic efficiency, and light stress tolerance by influencing complex assembly, excitation energy dissipation, electron transport, and damage repair. Abnormal function of these proteins may lead to impaired PSII assembly, thereby affecting chloroplast structure, chlorophyll content, leaf color, and overall photosynthetic performance. Summary of the Invention

[0005] The purpose of this invention is to address the shortcomings of existing technologies by providing a photosystem II protein. TaPSII Genes and their application in regulating wheat leaf color and net photosynthetic rate TaPSII Genes are positively correlated with wheat leaf color and photosynthetic efficiency.

[0006] To achieve the above objectives, the present invention proposes the following technical solution: In a first aspect, the present invention provides a wheat photosystem II-related gene. TaPSII The nucleotide sequence of the gene in hexaploid common wheat, *Wheat Germ*, is shown in SEQ ID NO. 1. Overexpression in wheat. TaPSII After gene administration, wheat leaves darken in color and net photosynthetic performance increases; gene administration reduces or silences photosynthetic performance in wheat. TaPSII After the gene is expressed, the wheat leaves become lighter in color and the net photosynthetic efficiency decreases.

[0007] A second aspect of the present invention provides a [missing information - likely a specific product or service]. TaPSII The application of the gene in regulating wheat leaf color and net photosynthetic rate: increasing the expression of the gene in common hexaploid wheat increases the net photosynthetic rate of wheat leaves. As shown in SEQ ID NO.1, overexpression of the gene... TaPSII The application of genes in improving the net photosynthetic rate of wheat or in breeding new wheat varieties with high light efficiency. Among them, wheat leaf color is measured by the ExG index.

[0008] A third aspect of the invention provides an improvement over the aforementioned TaPSII Application of gene-expressing biomaterials in improving the net photosynthetic rate of wheat and / or breeding new wheat germplasm with high photosynthetic efficiency.

[0009] Furthermore, the biomaterial comprises at least one of the following: a) Enables the TaPSII Expression cassettes with significantly upregulated genes; b) A recombinant vector having the function described in a); c) Recombinant bacteria having the function described in a) or the recombinant vector described in b).

[0010] A fourth aspect of the present invention provides a method for improving wheat leaf color and net photosynthetic rate by upregulating or overexpressing the substance shown in SEQ ID NO. 1 in wheat. TaPSII Genes that improve wheat leaf color and photosynthetic efficiency.

[0011] Furthermore, in accordance with the aforementioned TaPSII The gene was used as a template gene and overexpressed in wheat through Agrobacterium-mediated plant transformation. TaPSII Genes can increase the net photosynthetic rate of wheat.

[0012] Furthermore, the wheat in question is common hexaploid wheat.

[0013] In a fifth aspect, the present invention provides a method for cultivating wheat plants with high photosynthetic efficiency, wherein... TaPSII Genes were cloned into plant overexpression vectors to construct recombinant plasmids. The target fragment from the recombinant plasmid was then transferred into wheat using Agrobacterium-mediated transformation. After screening and cultivation, high-light-efficiency wheat plants were obtained. TaPSII The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0014] The beneficial effect of this invention is that it upregulates or overexpresses [certain substances] in wheat. TaPSII This gene can enhance wheat leaf color and photosynthetic efficiency. This invention lays the foundation for establishing new wheat germplasm with high photosynthetic efficiency, and has significant practical implications for both basic scientific research and future agricultural applications. Attached Figure Description

[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the embodiments are briefly described below. Obviously, the following drawings are only some embodiments of the present invention. For those skilled in the art, other related drawings can be obtained based on the drawings without any creative effort.

[0016] Figure 1 This invention is a gene silencing genome (BSMV). TaPSII The results of growth status, leaf color index ExG, and net photosynthetic rate of wheat plants compared with the control group (BSMV:γ) 14 days after application were as follows; among them, Figure 1 In the diagram, A represents the growth status of wheat plants in the gene silencing group and the control group 14 days after application. BSMV: TaPDS Leaf whitening indicates that the silencing efficiency of this experiment was good; Figure 1 B in the diagram is a top view of the third leaf of the gene silencing group and the control group. The gene silencing group (BSMV) can be observed with the naked eye. TaPSII The difference in leaf color between the control group (BSMV:γ) and the control group (BSMV:γ); Figure 1 In this context, C represents the expression level of TaPSII in wheat from the gene silencing group and the control group, as analyzed by qRT-PCR. Figure 1In this context, D represents the statistical values ​​of ExG measurements in the gene silencing group and the control group. Figure 1 In this context, E represents the net photosynthetic rate (A, µmol / m³) between the gene silencing group and the control group. -2 s -1 Measurement and statistics; p < 0.01, t-test; Figure 2 This invention is overexpressed TaPSII Phenotypic analysis of transgenic wheat following gene modification; among which... Figure 2 In the diagram, A represents PCR identification of overexpressing transgenic lines, numbers 1-11 represent 11 independent transgenic lines, and P represents a positive control plasmid. TaPSII (Gene overexpression vector), M stands for electrophoresis marker; Figure 2 In the diagram, B represents the transgenic receptor Fielder (CK) at 20 days of germination and its overexpression. TaPSII Growth status of genetically modified wheat lines (OE); Figure 2 In this context, C represents the transgenic receptor Fielder (CK) and its overexpression. TaPSII Top view of a leaf of an OE (Organic Evolutionary) wheat line; Figure 2 D in the text represents the four selected turns. TaPSII In gene-positive lines TaPSII The relative expression level of the gene was detected by qRT-PCR. Figure 2 E in the figure represents the control group and the overexpression group. TaPSII Statistical analysis of ExG values ​​in genetically modified wheat lines; Figure 2 F in the figure represents the control group and the overexpression group. TaPSII Statistics on net photosynthetic rate (A) of genetically modified wheat lines; where CK is the transgenic recipient variety Fielder; p < 0.01, t-test. Detailed Implementation

[0017] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0018] In the following examples, the wheat transgenic recipient variety Fielder was preserved in our laboratory.

[0019] In the following embodiments, the hexaploid common wheat, Chinese spring, was preserved in our laboratory. This biological material is only required for repeating the experiments of this invention and should not be used for other purposes.

[0020] In the following implementations, the BSMV vector can be obtained commercially. BSMV:TaPDS is a commonly used positive control group in this field, and its silencing effect is to cause whitening of new leaves in positive plants.

[0021] Example 1: TaPSII Obtaining gene sequences A natural population was formed by selecting multiple wheat varieties from both domestic and international sources. GWAS was used to identify a locus AX-110905711 that regulates leaf color, and candidate genes were found within this locus. TaPSII This gene has two haplotypes (C / T) in natural populations. The leaf color of the C haplotype varieties is significantly higher than that of the T haplotype varieties. The C haplotype is the superior haplotype. The C haplotype sequence of this gene is shown in SEQ ID NO.1.

[0022] Leaf color gene TaPSII The cloning process is as follows: (1) Wheat planting Hexaploid common wheat seeds (Chinese Spring variety) were sown in seedling trays with a nutrient substrate ratio of nutrient soil: vermiculite: perlite = 1:1:1. The seedlings were placed in a light-in-dark (16h light / 8h darkness) culture room and watered as needed to maintain soil moisture.

[0023] (2) RNA extraction Wheat seedling leaves at the three-leaf stage were harvested and cut. A grinding rod was placed in a mortar, and 3-4 mL of anhydrous ethanol was added and ignited to inactivate RNase. The mortar was then rapidly cooled with liquid nitrogen. The leaf sample was then added and rapidly ground in liquid nitrogen until a powder without particles was formed. The powder was then quickly transferred to 1.5 mL RNase-free centrifuge tubes and stored in liquid nitrogen or at -80°C for long-term preservation. Total RNA was isolated from the sample using a plant total RNA extraction kit, following the manufacturer's instructions. The total RNA was stored at -80°C for subsequent analysis.

[0024] (4) Obtaining cDNA via reverse transcription Reverse transcription was performed using the Magen HiPure Plant RNA Mini Kit. RNA template denaturation helps open secondary structures, significantly increasing the yield of first-strand cDNA. The reverse transcription reaction system is shown in Table 1 below. The reverse transcription conditions were: 55 °C for 15 min, followed by termination at 85 °C for 5 s. The reverse transcription product can be used immediately for subsequent experiments or stored at -20 °C and used within six months, avoiding repeated freeze-thaw cycles.

[0025] Table 1 Reverse transcription reaction system (5) TaPSII Amplification of the full length of the gene Based on the principle of homologous recombination, amplification primers were designed using Primer 5.0 to ligate the target gene into the vector pUBI between the Xba I-Sma I restriction sites. Restriction sites and their corresponding 15-base vector fragments before or after the 5' end of the upstream and downstream primers were added to ensure correct insertion orientation of the target fragment. Primer length is generally around 40 bp, with a GC content of 40%-60%. The primers designed in this example are as follows: Upstream primer (SEQ ID NO. 2): 5'-gagaacacgggggactctaga ATGCCTGGGCCTCCTTCC -3'; Downstream primer (SEQ ID NO. 3): 5'-ataagggactgaccacccggg AGAGGTAGGCCTCTGCGG -3'.

[0026] Fragment PCR amplification was performed using diluted primers and cDNA obtained in step (4). The PCR amplification system is shown in Table 2.

[0027] Table 2 PCR amplification system The PCR program was as follows: 98 °C pre-denaturation for 3 min; 98 °C denaturation for 10 sec, 59 °C annealing for 5 sec, 68 °C extension for 1-10 sec / kb, 25-35 cycles; 68 °C final extension for 5 min.

[0028] (6) Recovery and purification of PCR amplification products PCR products were separated by 1% agarose gel electrophoresis. The product recovery procedure was performed according to the instructions of the TianSai Gel / PCR Purificationkit kit. The concentration and quality of the recovered products were determined using a NanoDrop One 2000 spectrophotometer.

[0029] (7) Homologous recombination reaction Using the ClonExpress II One Step Cloning Kit from Nanjing Novizan Biotechnology Co., Ltd., a homologous recombination reaction system was prepared by combining the linearized pUBI vector with the recovered PCR product, as shown in Table 3. The reaction was carried out at 37 ℃ for 30 min. The recombination product was used immediately or stored at -20 ℃.

[0030] Table 3 Homologous recombination reaction system (8) Transformation of recombinant products into competent E. coli DH5α cells, sequencing and sequence analysis 1. Add 5-10 μL of the recombinant product to be transformed into 50-100 μL of competent DH5α cells, gently tap to mix, and incubate on ice for 30 min.

[0031] 2. Place the centrifuge tubes in a 42°C water bath for 90 seconds for heat shock.

[0032] 3. Add 700 μL of antibiotic-free LB liquid medium to a centrifuge tube and incubate at 37°C and 200 rpm for 45 min / h.

[0033] 4. Centrifuge the incubated bacterial culture at 3500 rpm for 5 min, discard the supernatant, resuspend the bacterial pellet in 100 μL of antibiotic-free LB liquid medium, and transfer it to LB solid medium containing the corresponding ampicillin antibiotic, spreading it evenly.

[0034] 5. After the bacterial culture on the surface of the plate has been absorbed, seal the petri dish and invert it to incubate at 37 ℃ for 12-16 h.

[0035] 6. Using a sterilized toothpick, pick a single colony and place it in 600 μL of antibiotic liquid LB medium. Incubate at 37 ℃ with a shaker at 200 rpm for 6-8 h. Then, take 1 μL of the bacterial solution for PCR. Send the PCR-positive bacterial solutions to Qingke Biotechnology for Sanger sequencing. TaPSII The reference nucleotide sequence of the gene is shown in SEQ ID NO.1. The measured sequences are compared, and plasmids and recombinant bacterial cultures that are completely identical can be stored in an ultra-low temperature freezer for subsequent experiments.

[0036] Example 2: Silence TaPSII Application of genes in regulating wheat leaf color and net photosynthetic efficiency BSMV-VIGS is a technique for studying gene function, capable of efficiently and rapidly inducing endogenous gene silencing in contemporary plants. This example utilizes BSMV-VIGS technology to... TaPSIIFunctional studies of the genes were conducted to verify the role of the target genes in wheat leaf color regulation, providing a scientific basis for breeding and genetic improvement of high-efficiency wheat.

[0037] In this embodiment, the BSMV-VIGS silencing system uses the BSMV:γ vector (an RNA-γ modified vector of BSMV) as the insertion backbone for the target gene fragment. This vector can be purchased commercially, as detailed below: (1) TaPSII Construction of BSMV gene vector Based on the target gene TaPSII Based on the CDS sequence information, specific silencing target sequences are designed, and suitable restriction enzyme sites are added according to the target sequence and the information on the BSMV:γ vector. Not I and Pac I) Using cDNA from Chinese spring leaves as a template, specific amplification was performed. The specific amplification system is shown in Table 4, and the primers used are as follows: Forward primer (SEQ ID NO.4): tttttagctagctgattaattaaCGCGGGAGGTGGTGCGGA; Reverse primer (SEQ ID NO.5): tccgttgctagctgagcggccgcGAACTCCGCCAGCGATTTG.

[0038] Table 4 Specific amplification system The PCR product was recovered as described in Example 1, the γ-vector was linearized, and the resulting recombinant transformation was performed on *E. coli* followed by sequencing. The plasmid with correct sequencing results was identified as BSMV. TaPSII Store in a refrigerator at -20 ℃ for later use.

[0039] (2) BSMV smothering wheat leaves TaPSII Gene As shown in Table 5, Ribo MAX™ Large Scale RNA Production Systems-T7 will be used to produce RNA containing BSMV. TaPSII After plasmid linearization, in vitro transcription was performed. The reactants were added to microcentrifuge tubes and incubated at 37°C for 2 hours. 0.5 μL of the in vitro transcription product was diluted 10-fold with DEPC-treated water and detected by electrophoresis. The product was stored at -80°C for later use.

[0040] Table 5 In vitro transcription system Take 2.5 μL each of the BSMV vector α, β, and γ (or recombinant γ) in vitro transcription products, mix them in a 1:1:1 ratio, dilute with an equal volume (7.5 μL) of DEPC-treated water, and add 2.5 μL of the mixture to 45 μL of FES buffer (1.0452 g dipotassium hydrogen phosphate, 0.7508 g glycine, 0.5 g sodium pyrophosphate, 0.5 g diatomaceous earth, 0.5 g bentonite, bring the volume to 50 ml, autoclave at 115 degrees Celsius for 20 min), and mix thoroughly with a micropipette.

[0041] When wheat seedlings reach the two-leaf-one-heart stage, apply 8-10 μL of the mixture to your index finger (wearing a latex glove) and gently rub it against your thumb. Then rub the second leaf of the seedling about 10 times. A slight squeaking sound should be heard as you rub from the base to the tip of the leaf. Hold the base of the second leaf with your other hand to prevent it from breaking. After inoculation, spray with a small amount of DEPC-treated water and maintain a room temperature of 23±2˚C, keeping it moist and dark for 24 hours. Then, culture for 14 days using a normal 16 / 8h light / dark cycle. Each independent experiment included a negative control with FES buffer, a BSMV:γ blank control, and a BSMV:γ control. TaPDS Positive control group; viral infection symptoms and PDS phenotype were observed regularly. Results were as follows: Figure 1 Two weeks later, the new leaves of the positive control group (A and B) turned white, demonstrating the good silencing efficiency of this batch of BSMV injection and the effectiveness of this batch of technology system.

[0042] (3) TaPSII Gene silencing efficiency, leaf color, and net photosynthetic rate were measured. RNA was extracted from the control and experimental groups as described in Example 1, and cDNA was obtained by reverse transcription. RT-qPCR was then performed using quantitative primers (SEQ ID NO. 6 and SEQ ID NO. 7) to detect the RNA. TaPSII Gene silencing.

[0043] Design specific primers: SEQ ID NO.6: 5'- GGAGGCCTGGAGAATGTTAAA -3'; SEQ ID NO. 7: 5'-CTGGAGGGCCATAGAACAATAC-3'.

[0044] First, the cDNA concentration of all test samples was adjusted to be consistent, with a concentration difference of ±5 ng / μL. RT-qPCR was performed using the AceQ qPCR SYBR Green Master Mix, with Actin as the internal control gene. Each sample had three technical replicates and three biological replicates. The reaction program was executed on a Roche LightCycler 4800II real-time PCR instrument. The RT-qPCR reaction system is shown in Table 6. Quantitative data were standardized based on the minimum sample threshold period number (Ct value) and the highest fluorescence value, and the relative gene expression level was calculated using the 2-ΔΔCT method. The RT-qPCR reaction program is as follows: Step 1: 95 ℃ for 30 s; Step 2: 95 ℃ for 10 s; Step 3: 58 ℃ for 10 s; Step 4: 72 ℃ for 30 s; Step 5: Repeat steps 1 to 4 for 40 cycles; Steps 6 and 7: Plot the melting curve.

[0045] Table 6 RT-qPCR reaction system Quantitative PCR detection was performed, and the RT-qPCR results were as follows: Figure 1 As shown in C, the gene-silencing group of wheat plants TaPSII The gene expression level was significantly lower than that of the control group, indicating that the silencing effect was good.

[0046] like Figure 1 The results showed that 14 days after application of the BSMV vector to each group, the leaves of wheat plants in the silent group became lighter in color, the wheat in the control group grew normally, and the leaves of wheat plants in the positive control group showed bleaching. Leaf color index (ExG) was scanned and analyzed from the leaves of the experimental and silent groups, and net photosynthetic rate (A) was measured using a photosynthesis meter. The ExG index and A of the silent group leaves decreased significantly, indicating that... TaPSII Downregulation or silencing can reduce the color intensity of wheat leaves and photosynthetic efficiency.

[0047] Example 3: Overexpression TaPSII Application of genes in improving wheat leaf color and net photosynthetic efficiency Cultivation and Acquisition TaPSII -OE transgenic wheat plants were first constructed. TaPSII Gene overexpression vectors were transformed into wheat immature embryos via Agrobacterium-mediated transformation, and resistant regenerated plants were obtained through selection culture; then, PCR identification and qPCR screening were performed as described above to obtain... TaPSII Positive lines with significantly upregulated gene expression; among them, PCR identification results are as follows: Figure 2As shown in Figure A, lines 1-11 are 11 independent transgenic lines. Except for lines 1 and 11, all other lines amplified specific bands consistent with the positive control plasmid (P), indicating that the exogenous transgenic plasmid... TaPSII The gene has been successfully integrated into the genomes of various strains, and the transgenic receptor Fielder (CK) is overexpressed. TaPSII The growth and leaf condition of the genetically modified wheat line (OE) are shown in [link to relevant documentation]. Figure 2 BC and T2 showed no significant differences in plant growth and leaf morphology. Positive plants were continuously self-pollinated to the T2 generation to obtain genetically stable homozygous transgenic wheat plants, which are then... TaPSII -OE transgenic wheat plants.

[0048] This embodiment compares the control group and... TaPSII -OE transgenic wheat plants' ExG index and net photosynthetic rate, such as Figure 2 As shown in DF, where TaPSII -OE indicates overexpression. TaPSII Transgenic wheat plants obtained from genetically modified genes. For example... Figure 2 As shown, the transgenic receptor Fielder and overexpression TaPSII Gene expression levels, leaf color ExG index, and net photosynthetic rate were compared, and the results showed that overexpression of the gene in upland wheat was effective. TaPSII The gene can significantly increase the wheat leaf color index (ExG) and significantly increase the net photosynthetic rate of the leaves. The above examples illustrate this. TaPSII Genes are positively correlated with wheat leaf color and photosynthetic efficiency. 。

[0049] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

[0050] Sequence List: SEQ ID NO. 1: ATGCCTGGGCCTCCTTCCACCATGTCCCTGCCGAGGCCGAGCAGGTGCTACCGCTGCTGCTCGTCGTCGACGCCGCCGCCGCCGAAGCAGCGAGCCGCGGAGAGCAAGCGGCGGCCTATCCGCGGAGCGCGGCTGCTGCTGACCCGGAGGGCGCTGGCGGGCGCTGTGGCGACGGTGACGTTGGCGGTGGCGGGCCGTGCCAGGGCGGCGGAGGAGGGCGGCGAGGGGGTGGTGGGCGCGTTCAAGTCGCTGTTCGACCCGAACGAGGAGACCAAGGCCGGGAAGGTGCTGCCCAAGGCGTACCTGAAGGCGGCGCGGGAGGTGGTGCGGACGCTCCGGGAGTCGCTGGGGGAGGGCGACGCCGCCGGCGACTCGGCCAGCTTCCGCAGGGGCGCCGACTCCGCCAAGACGTCCATCCGAGAGTTCCTCGGCGGCTGGAGAGGCCAGCCCGCCGTCGCCAAAGAGGAGTCGTATGTGGCGCTGGAGAAGGCCATCAAATCGCTGGCGGAGTTCTACTCCAAGGCAGGGCCCTTCGCCTCGCTTCCGGGAGATGTCAAAAACAAGATCCTCGACGACCTCAACGCCGCAGAGGCCTACCTCTAG SEQ ID NO. 2:gagaacacgggggactctaga ATGCCTGGGCCTCCTTCC SEQ ID NO. 3:ataagggactgaccacccggg AGAGGTAGGCCTCTGCGG SEQ ID NO. 4:tttttagctagctgattaattaaCGCGGGAGGTGGTGCGGA SEQ ID NO. 5:tccgttgctagctgagcggccgcGAACTCCGCCAGCGATTTG SEQ ID NO. 6:GGAGGCCTGGAGAATGTTAAA SEQ ID NO. 7:CTGGAGGGCCATAGAACAATAC。

Claims

1. Overexpression of the photosystem II protein gene TaPSII Its application in improving wheat leaf color and net photosynthetic efficiency is characterized by... The gene TaPSII The nucleotide sequence is shown in SEQ ID NO.

1.

2. A biomaterial for improving wheat leaf color and net photosynthetic efficiency, characterized in that, The biomaterial comprises at least one of the following: a) Overexpression TaPSII Gene expression cassettes; b) A recombinant vector containing the expression cassette described in a); c) Recombinant bacteria containing the expression cassette described in a) or the recombinant vector described in b).

3. The application of the biomaterials described in claim 2 in the cultivation of new wheat germplasm with improved leaf color and / or enhanced photosynthetic efficiency.

4. A method for improving wheat leaf color and net photosynthetic efficiency, characterized in that, The biomaterial described in claim 2 is genetically transformed into wheat.

5. The method according to claim 4, characterized in that, The wheat in question is common hexaploid wheat.

6. The method according to claim 4, characterized in that, The genetic transformation method is either Agrobacterium-mediated transformation or gene gun transformation.

7. The method according to claim 4, characterized in that, The wheat recipient material for the genetic transformation is a wheat immature embryo, mature embryo, or young spike.

8. A method for cultivating wheat plants with high light and efficiency, characterized in that, Will TaPSII Genes were cloned into plant overexpression vectors to construct recombinant plasmids. The target fragment from the recombinant plasmid was then transferred into wheat using Agrobacterium-mediated transformation. After screening and cultivation, high-light-efficiency wheat plants were obtained. TaPSII The nucleotide sequence of the gene is shown in SEQ ID NO.1.

Images