ABCG14 transporter gene and application thereof in regulating plant root system compound efflux

Abstract

The application belongs to the technical field of biology and particularly relates to an ABCG14 transporter gene and application thereof in regulating exocytosis of compounds in roots of Peucedanum decursivum. The nucleotide sequence is shown as SEQ ID NO. 1. The application first proves that the ABCG14 transporter of Peucedanum decursivum is involved in transmembrane transport of tryptamine or indole alkaloid compounds, overexpression of the ABCG14 gene can significantly reduce the content of tryptamine in roots of Peucedanum decursivum, and it is indicated that the ABCG14 can promote the transport of tryptamine or its derivatives to the outside of cells.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to an ABCG14 transporter protein gene and its application in regulating the efflux of plant root compounds. Background Technology

[0002] Peucedanum praeruptorum Dunn is a perennial herb belonging to the genus Peucedanum in the family Apiaceae. Its dried root is a commonly used traditional Chinese medicine with effects such as dispelling wind and heat, and resolving phlegm. The root of Peucedanum praeruptorum is rich in various active chemical components, including coumarins and alkaloids. Among these, alkaloids, especially indole alkaloids, are important defensive secondary metabolites in plants, playing a crucial role in resisting abiotic stress and regulating the rhizosphere microecological environment.

[0003] Plant roots can actively or passively release secondary metabolites synthesized within the plant into the rhizosphere environment; this process is called root exudation. Secondary metabolites in root exudates can perform various ecological functions, such as inhibiting pathogenic microorganisms, regulating microbial community structure, and participating in allelopathic processes. Under adverse conditions, enhancing the synthesis of specific secondary metabolites and exuding them into the rhizosphere is one of the important strategies by which plants adapt to environmental changes.

[0004] ATP-binding cassette (ABC) transporters are one of the largest transporter families in plants, utilizing energy from ATP hydrolysis to mediate the transmembrane transport of various endogenous and exogenous substances, including alkaloids, flavonoids, hormones, and secondary metabolites. ABC transporters have been widely demonstrated to participate in the transmembrane transport of various secondary metabolites, including alkaloids, flavonoids, and terpenoids. Their functions extend beyond intracellular distribution regulation, playing a crucial role in the secretion of metabolites into the rhizosphere. However, the specific functions of ABC transporter family members in *Peucedanum praeruptorum*, particularly their involvement in the transmembrane transport and rhizosphere secretion of alkaloids, remain largely unexplored. Therefore, isolating and identifying ABC transporter genes capable of regulating root compound efflux from *Peucedanum praeruptorum* is of great significance for elucidating the accumulation and secretion mechanisms of secondary metabolites in *Peucedanum praeruptorum*, and for regulating the targeted accumulation and secretion of active ingredients in medicinal plants through genetic engineering. Summary of the Invention

[0005] The purpose of this invention is to provide an ABCG14 transporter gene derived from Angelica dahurica.

[0006] Another object of the present invention is to provide a recombinant expression vector containing the above-mentioned genes and its application.

[0007] Another object of the present invention is to provide the application of the above-mentioned gene in regulating the efflux of plant root compounds, particularly in regulating the secretion of tryptamine or indole alkaloids into the rhizosphere from the roots of Angelica dahurica.

[0008] To achieve the above objectives, the present invention adopts the following technical solution: An ABCG14 transporter gene, characterized in that its nucleotide sequence is shown in SEQ ID NO.1.

[0009] A recombinant expression vector containing the gene.

[0010] The present invention also includes the application of the gene and the recombinant expression vector in regulating the efflux of plant root compounds.

[0011] Furthermore, the plant in question is Angelica dahurica var. praecox.

[0012] Furthermore, the compound is a tryptamine or indole alkaloid compound.

[0013] The present invention also provides a method for regulating the tryptamine content in the roots of Angelica dahurica, characterized in that it includes: reducing or increasing the tryptamine content in the roots of Angelica dahurica by overexpressing or inhibiting the expression of the ABCG14 transporter gene.

[0014] The present invention also provides a method for promoting the secretion of alkaloid compounds from the roots of Angelica dahurica into the rhizosphere, characterized by comprising: overexpressing the ABCG14 transporter gene in Angelica dahurica plants.

[0015] The present invention has the following beneficial effects: This invention is the first to isolate and identify an ABCG14 transporter gene from Angelica dahurica, which has the function of regulating the efflux of root compounds, and provides its nucleotide sequence. This invention is the first to demonstrate that the ABCG14 transporter of Peucedanum praeruptorum participates in the transmembrane transport of tryptamine or indole alkaloids, providing a new molecular basis for revealing the accumulation and secretion mechanism of Peucedanum praeruptorum secondary metabolites. This invention demonstrates through functional verification experiments that overexpression of the ABCG14 gene can significantly reduce the tryptophan content in the roots of Angelica dahurica, indicating that ABCG14 can promote the extracellular transport of tryptophan or its derivatives. This provides an important target and tool for regulating the targeted accumulation and secretion of active ingredients in medicinal plants through genetic engineering. This invention provides new strategies and approaches for improving the quality of Angelica dahurica using genetic engineering technology, for targeted regulation of the accumulation and rhizosphere secretion of its active ingredients, and for enhancing plant stress resistance by regulating the rhizosphere chemical environment. Attached Figure Description

[0016] Figure 1 This is a graph showing the expression analysis of the ABCG14 gene in Angelica dahurica under dark stress conditions. Figure 2 This is an electrophoresis pattern of PCR amplification of the ABCG14 gene in Angelica dahurica. Where M is the DNA molecular weight standard, and lanes 1-2 are the amplification products of the ABCG14 gene; Figure 3 This image shows the construction of the RUBY-ABCG14 recombinant expression vector and its transformation into Agrobacterium tumefaciens for identification. Among them, a is the RUBY vector enzyme digestion verification pattern, and b is the bacterial culture PCR identification pattern after the RUBY-ABCG14 recombinant plasmid is transformed into Agrobacterium. Figure 4 A graph showing the relative expression level of the ABCG14 gene in the roots of plants overexpressing ABCG14, known as Angelica dahurica. Figure 5 The image shows the HPLC analysis of tryptophan content in the roots of plants overexpressing ABCG14 as Angelica dahurica. Detailed Implementation

[0017] Example 1 Cloning and sequence analysis of the ABCG14 gene of Angelica dahurica 1.1 Plant materials and treatment The seeds used in this experiment were sourced from Chun'an County, Hangzhou City, Zhejiang Province (all references to *Peucedanum praeruptorum* in this article refer specifically to white-flowered *Peucedanum praeruptorum*). After identification according to the *Flora of China*, *Illustrated Flora of Higher Plants of China*, and relevant taxonomic literature on medicinal plants, they were used for subsequent experiments. Before the experiment, plump, disease-free seeds were selected and soaked in 37°C water for 24 hours. Subsequently, the treated seeds were sown in a high-temperature sterilized mixed substrate with a substrate ratio of nutrient soil: perlite: vermiculite = 3:1:1. After sowing, the seeds were placed in an artificial climate incubator with the following parameters: 14 hours of light, 10 hours of darkness, temperature 24°C, and light intensity 8000 Lux. After 30 days of seedling growth, the seedlings were subjected to shading treatment for 0, 6, and 12 days, respectively, and the corresponding treatment groups were labeled starting point, dark_6, and dark_12. After shading, the leaves and roots of the plants were collected, rinsed clean under running water, wrapped in aluminum foil and flash-frozen in liquid nitrogen, and then transferred to a -80°C freezer for storage in subsequent experimental analysis.

[0018] 1.2 Total RNA extraction and cDNA synthesis The samples were removed from the -80°C freezer and placed in a pre-cooled mortar. Liquid nitrogen was quickly added, and the samples were thoroughly ground into a uniform fine powder until no particulate matter was visible. Approximately 0.1 g of the powder was then weighed, and total RNA was extracted strictly according to the kit instructions. Analysis of the RNA quality of each sample showed that the overall RNA concentration in the different treatment groups was at a high level, ranging from 541.86–915.78 ng / μL. Regarding purity, the OD values ​​of each sample were... 260 / 280 The ratios ranged from 2.089 to 2.198, all close to 2.0, indicating that the RNA was largely uncontaminated by proteins; OD 260 / 230 The ratios ranged from 1.876 to 1.956. Overall, the RNA purity of each sample was good and of high quality, meeting the requirements for subsequent transcriptome sequencing or related molecular experiments. First-strand cDNA was synthesized using the extracted total RNA as a template via a reverse transcription kit.

[0019] 1.3 Expression characteristics analysis of ABCG14 gene under darkness stress To further verify the transmembrane transport and rhizosphere secretion of metabolites in the roots of *Peucedanum praeruptorum* under dark stress, this invention detected the expression level of the ABCG14 gene under dark stress. The expression level of the ABCG14 gene after dark stress was detected using qRT-PCR. Under dark treatment conditions, the expression levels of ABC transporter family genes in the roots of *Peucedanum praeruptorum* all showed an increasing trend, with the ABCG14 gene showing the most significant change. The results are as follows: Figure 1 As shown.

[0020] 1.4 Cloning of the ABCG14 gene Based on the transcriptome sequencing data of Angelica dahurica, the complete coding sequence (CDS) of the ABCG14 gene was obtained. Specific primers were designed for PCR amplification of the ABCG14 gene. The primer sequences are as follows: Forward primer KL-ABCG14-F: ATGTCGACTCTAGAGGATCCTCCACTCACTGCTGCAATGCT (SEQ ID NO.2); Reverse primer KL-ABCG14-R: CACGGGGGACGAGCTCATGTCTATACATTGCATGGTGCAAAAAC (SEQ ID NO.3).

[0021] Using cDNA from the roots of Angelica dahurica as a template, PCR amplification was performed using the primers described above. The PCR reaction mixture consisted of: 0.5 μL of forward primer, 0.5 μL of reverse primer, 12.5 μL of TransStart® FastPfu Fly PCR SuperMix, 1 μL of cDNA, and RNase-free water to a final volume of 25 μL. The PCR program was as follows: 98°C pre-denaturation for 1 min; 98°C denaturation for 10 s, 55°C annealing for 5 s, 72°C extension for 15 s, for a total of 35 cycles; and a final extension at 72°C for 2 min.

[0022] The PCR products were detected by agarose gel electrophoresis. Using cDNA obtained from reverse transcription as a template, a pair of specific primers were designed and synthesized based on the coding region sequence of the ABCG14 gene, and the target fragment was successfully amplified by PCR. Agarose gel electrophoresis showed that the amplified product appeared as a single band at the expected location, and its migration distance matched the theoretically calculated full-length 1977 bp coding region. The band was bright and free of non-specific contaminants. Figure 2 (As shown). After the target band was cut and recovered, sequencing was performed. Comparative analysis confirmed that the cloned sequence completely matched the reference sequence of the ABCG14 gene, and no base mutations were found in the entire coding region. The cloned ABCG14 gene coding region sequence is shown in SEQ ID NO. 1.

[0023] Example 2 Functional verification of the ABCG14 gene in Angelica dahurica 2.1 Construction of RUBY-ABCG14 overexpression vector The RUBY plasmid was digested with SpeI enzyme. The reaction conditions were 37°C for 15 min for digestion and 80°C for 20 min for inactivation. Subsequently, the gel-recovered product of the ABCG14 gene obtained in Example 1 was ligated to the digested linearized vector using a homologous recombination kit at 50°C for 30 min.

[0024] After ligation, the recombinant product was introduced into competent E. coli cells. Positive transformants were then preliminarily identified by colony PCR, and candidate clones were sequenced for verification. Once the sequences were confirmed to be correct, the recombinant plasmid, namely the RUBY-ABCG14 recombinant expression vector, was extracted from the positive strain.

[0025] 2.2 Agrobacterium-mediated transient transformation Remove GV3101 Agrobacterium competent cells frozen at -80°C and thaw slowly in an ice bath until partially thawed. Take 50 μL of the competent cell suspension and add 5 μL of the constructed recombinant plasmid (RUBY-ABCG14 or empty vector). Gently tap the tube wall with your finger to mix evenly, then continue incubation on ice for 30 min. After incubation, quickly transfer the centrifuge tube to a 42°C constant temperature water bath for 1 min of heat shock, then quickly transfer it to an ice bath for 2 min of cooling. In a clean bench, add 1000 μL of antibiotic-free LB liquid medium to the tube, gently mix, and incubate at 28°C with shaking at 200 rpm for 2 to 3 h to allow the Agrobacterium cells to recover and express the corresponding antibiotic resistance.

[0026] After incubation, the bacterial suspension was centrifuged at 5000 rpm for 5 min. Most of the supernatant was removed, leaving approximately 100 μL of residual liquid and bacterial precipitate in the tube. The precipitate was gently resuspended using a pipette. A sterile spreader was used to pick up the resuspended bacterial suspension and spread it evenly on the surface of an LB agar plate containing kanamycin. The plate was initially held upright for a short time until the surface bacterial suspension was completely absorbed by the medium. Then, the plate was inverted and placed in a 28°C incubator for 24 to 48 h, until well-dispersed single colonies appeared on the plate.

[0027] After amplifying the culture of Agrobacterium carrying either RUBY-ABCG14 or an empty vector plasmid, the bacterial cells were cultured until the OD value reached 0.6 at 600 nm. The cells were then collected by centrifugation at 5000 rpm for 10 min. The cells were resuspended in an equal volume of resuspension solution (containing 10 mM MES pH 5.6, 10 mM MgCl2, and 100 μM acetylsyleugenone) and allowed to stand at room temperature for 2–3 h. The bacterial suspension was injected into the root tissue of *Angelica dahurica* using a syringe. After injection, the plants were cultured in darkness for 12 h, then transferred to normal light conditions for further culture. Samples were collected 24 h later and stored at -80°C for later use.

[0028] Figure 3 In the image, a is the enzyme digestion verification pattern of the RUBY vector; b is the PCR identification pattern of Agrobacterium tumefaciens after transformation of the RUBY-ABCG14 recombinant plasmid, showing a positive band at approximately 2250 bp.

[0029] 2.3 Detection of ABCG14 gene expression level in overexpression plants Total RNA was extracted from root samples after transient expression treatment and cDNA was synthesized by reverse transcription. The expression level of the target gene ABCG14 was detected by quantitative real-time PCR (qRT-PCR) with empty vector (EV) as a control.

[0030] The results (Figure 4) showed that the relative expression level of ABCG14 in the OE-ABCG14 treatment group was significantly increased compared with the empty vector (EV) group, approximately 1.6 times that of the empty vector group, and the difference was statistically significant (P<0.05). This result indicates that the constructed ABCG14 overexpression vector can effectively increase the transcription level of the target gene in *Peucedanum praeruptorum*, demonstrating the successful construction of the transient overexpression system, which can be used for subsequent functional studies.

[0031] 2.4 Detection of tryptophan content in overexpressing plants Take 0.1 g of the root sample of *Angelica dahurica* after instantaneous treatment from a -80°C freezer and place it in an oven preheated to 105°C for 10–15 min. After the oven temperature drops to approximately 55°C, continue drying the sample to constant weight, ensuring complete removal of moisture. Grind the dried sample into a fine powder using a mortar and pestle to improve the extraction efficiency of the target components. Accurately weigh 0.05 g of the powder and place it in a 2 mL centrifuge tube. Add 1 mL of chromatographic grade methanol (solid-liquid ratio 1:20) and mix thoroughly using a vortex mixer to effectively extract the chemical components from the sample. Place the mixture in an ultrasonic extractor and perform intermittent ultrasonic treatment for a total time of 30 min. Centrifuge at 12000 rpm for 10 min to remove solid residue. Use a syringe to aspirate the supernatant and filter it through a 0.22 μm filter membrane to further remove fine particles and impurities.

[0032] The content of the target compound was determined by high-performance liquid chromatography (HPLC). The detection platform was a Waters e2695 HPLC system, and the separation medium was a C18 reversed-phase column. The mobile phase was a quaternary combination consisting of: 0.025 mol / L ammonium acetate aqueous solution, double-distilled water, chromatographic grade methanol, and chromatographic grade acetonitrile. The instrument operating parameters were set as follows: injection volume of 10 μL, constant mobile phase flow rate of 1 mL / min, column temperature maintained at 25°C, and UV detector signal acquisition wavelength of 280 nm. Gradient elution was used for the separation of the analytes.

[0033] like Figure 5 As shown, HPLC analysis results indicate that, compared with the empty vector control group, the peak area of ​​tryptophan in the roots of ABCG14-overexpressing plants was significantly reduced, suggesting that overexpression of ABCG14 promotes the exocrine transport of alkaloids from the roots to the rhizosphere.

[0034] Example 3 Application of the ABCG14 gene of Angelica dahurica in regulating root compound efflux Based on the functional validation results, the ABCG14 transporter in *Peucedanum praeruptorum* mediates the transmembrane efflux of tryptamine or indole alkaloids. Plant ABC transporters are recognized as key determinants in the transport of specialized metabolites to the extracellular compartment, thus directly influencing the rhizosphere chemical environment. Overexpression of ABCG14 may promote the transport of tryptamine or its derivatives to the extracellular space or other tissues, leading to a decrease in detectable levels in local tissues. Upregulation of ABCG14 may promote the secretion of alkaloids or their precursors into the rhizosphere.

[0035] Therefore, overexpression of the ABCG14 gene in *Angelica dahurica* can promote the secretion of alkaloids from the roots into the rhizosphere, thereby regulating the composition of rhizosphere metabolites. Specific applications include, but are not limited to: (1) Transform the expression vector containing the nucleotide sequence shown in SEQ ID NO. 1 into Angelica dahurica to obtain transgenic plants overexpressing ABCG14. The plants have enhanced ability to secrete tryptamine or indole alkaloids into the rhizosphere.

[0036] (2) Use gene editing technology (such as CRISPR / Cas9) to knock out or inhibit the expression of the ABCG14 gene in Angelica dahurica, reduce the excretion of alkaloids from the root system into the rhizosphere, and thus regulate the rhizosphere chemical environment.

[0037] ABCG14 full-length CDS sequence:

Claims

1. An ABCG14 transporter protein gene, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

1.

2. A recombinant expression vector containing the gene of claim 1.

3. The application of the gene as described in claim 1 in regulating the efflux of tryptamine or indole alkaloids from the roots of Angelica dahurica.

4. A method for regulating tryptophan content in the roots of Angelica dahurica, characterized in that, include: The tryptophan content in the roots of Angelica dahurica can be reduced or increased by overexpressing or inhibiting the expression of the ABCG14 transporter gene as described in claim 1.

5. A method for promoting the secretion of alkaloid compounds from the roots of Angelica dahurica into the rhizosphere, characterized in that, include: Overexpression of the ABCG14 transporter gene as described in claim 1 in white Angelica dahurica plants.

Images