A high-throughput screening system based on an antioxidant ginseng peptide derivative fusion protein and application thereof

Abstract

The present application belongs to the field of microbial technology, and particularly relates to a high-throughput screening system based on an antioxidant ginseng peptide derivative fusion protein and application, wherein the fusion protein comprises an antioxidant ginseng peptide derivative sequence and a fluorescent reporter protein sequence. The present application directly physically couples the expression level of the ginseng peptide derivative with the fluorescence intensity of the fluorescent reporter protein, so that when the screening system is used in combination with a mutagenesis breeding platform, high-throughput, rapid and non-destructive screening of mutant strains with high yield of antioxidant ginseng peptide derivatives can be realized. The screened mutant strains can be directly used for subsequent fermentation or iterative mutagenesis. The present application also discloses a mutant strain with high yield of antioxidant ginseng peptide derivatives screened by using the screening system, wherein the yield of the mutant strain is increased by 77.7% compared with that of the starting strain, and the mutant strain has good industrial application potential.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to a high-throughput screening system and its application based on antioxidant ginseng peptide derivative fusion protein. Background Technology

[0002] Ginseng, a plant belonging to the Araliaceae family, has been used as both food and medicine since ancient times. Ginseng is rich in saponins, polysaccharides, polypeptides, and organic acids, among which ginsenosides, polysaccharides, and polypeptides are bioactive components. Ginseng peptides are biofunctional peptides obtained from the breakdown products of ginseng or ginseng protein. Ginseng peptides can be directly absorbed by the human body without digestion, reducing the burden on the gastrointestinal tract and significantly enhancing its physiological regulatory effects. Therefore, they have broad application prospects in pharmaceutical development, functional foods, and cosmetics.

[0003] Currently, the acquisition of ginseng peptides mainly relies on extraction from ginseng roots or chemical synthesis. The former has problems such as low yield of target protein and complicated purification steps, while the latter has problems such as harsh reaction conditions, many by-products, and difficulty in meeting the needs of industrialization. Therefore, there is an urgent need to develop a method to obtain the target product efficiently.

[0004] Heterologous synthesis of ginseng peptides using microbial recombinant expression systems is a potential alternative strategy. However, current monitoring of recombinant strain expression products and screening of high-yielding strains mainly rely on in vitro detection methods such as SDS-PAGE or HPLC. These methods are cumbersome, have long detection cycles, and low screening efficiency. Therefore, developing a rapid, high-throughput screening system is a key requirement for efficiently obtaining target products. Summary of the Invention

[0005] To address the aforementioned problems, this invention provides a high-throughput screening system and its application based on antioxidant ginseng peptide derivative fusion proteins. This high-throughput screening system couples the expression level of antioxidant ginseng peptide derivatives with the fluorescence intensity of a fluorescent reporter protein. The expression level of antioxidant ginseng peptide derivatives can be indirectly reflected by the fluorescence signal intensity, thereby enabling rapid and efficient screening of strains that produce high levels of antioxidant ginseng peptide derivatives.

[0006] To achieve the above objectives, the specific technical solution of the present invention is as follows: The first aspect of the present invention provides a high-throughput screening system based on an antioxidant ginseng peptide derivative fusion protein, wherein the antioxidant ginseng peptide derivative fusion protein comprises an antioxidant ginseng peptide derivative sequence and a fluorescent reporter protein sequence; wherein the antioxidant ginseng peptide derivative sequence is selected from at least one of SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3.

[0007] Furthermore, the fluorescent reporter protein is a green fluorescent protein, a yellow fluorescent protein, or a red fluorescent protein.

[0008] Furthermore, the antioxidant ginseng peptide derivative fusion protein is prepared by the following steps: The antioxidant ginseng peptide derivative sequence and the green fluorescent protein sequence were cloned into an expression vector to obtain a recombinant vector. The recombinant vector was transformed into E. coli and then the recombinant plasmid was extracted. The recombinant plasmid was introduced into a host bacterium to obtain a recombinant strain; The recombinant strain was cultured to express the antioxidant ginseng peptide derivative fusion protein.

[0009] Furthermore, the antioxidant ginseng peptide derivative is obtained by tandem repeating the sequences shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3.

[0010] Furthermore, the expression vector is pMA5 or pP43NMK.

[0011] Furthermore, the host bacterium is Bacillus subtilis.

[0012] A second aspect of the present invention provides an application of the high-throughput screening system described above in screening strains that produce high levels of antioxidant ginseng peptide derivatives.

[0013] A third aspect of this invention provides a method for screening strains that produce high levels of antioxidant ginseng peptide derivatives. The method employs the high-throughput screening system described above and specifically includes the following steps: Mutagenesis was performed on host bacteria containing the high-throughput screening system to obtain mutant strains by creating mutant libraries. The fluorescence intensity of the mutant strain was detected under excitation / emission light conditions, and strains with the highest fluorescence intensity per unit cell were screened. Screening for strains with the highest fluorescence intensity per unit cell reduces workload and relatively increases the positive screening rate.

[0014] Furthermore, the mutagenesis is performed using atmospheric pressure, room temperature plasma mutagenesis technology.

[0015] Furthermore, the antioxidant ginseng peptide derivative fusion protein in the high-throughput screening system contains a green fluorescent protein sequence.

[0016] Furthermore, the excitation / emission conditions are 488nm / 507nm.

[0017] Furthermore, the host bacterium is Bacillus subtilis.

[0018] The fourth aspect of this invention provides a Bacillus subtilis strain that produces high levels of antioxidant ginseng peptide derivatives. Bacillus subtilis The Bacillus subtilis was obtained by screening using the method described above; the Bacillus subtilis is deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC NO.38855.

[0019] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention provides a high-throughput screening system based on an antioxidant ginseng peptide derivative fusion protein. The fusion protein comprises an antioxidant ginseng peptide derivative sequence and a fluorescent reporter protein sequence, wherein the antioxidant ginseng peptide derivative sequence is selected from at least one of SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3. This screening system physically couples the expression level of the antioxidant ginseng peptide derivative with the fluorescence signal intensity, converting the invisible yield of the antioxidant ginseng peptide derivative into a quantitatively detectable fluorescence signal, forming a genetic sensing system that can directly assess the expression level of the target product. This invention is the first to use a peptide-fluorescent protein fusion expression sensing element to screen strains that produce high levels of bioactive peptides. Compared to traditional SDS-PAGE or HPLC methods that require cumbersome pretreatment such as cell disruption, extraction, and purification, this screening system can directly detect in the viable bacterial state, achieving non-destructive, rapid, and real-time monitoring at the single-cell level.

[0020] The screening system provided by this invention can be directly coupled with mutagenesis techniques such as ARTP to rapidly identify strains that produce high levels of antioxidant ginseng peptide derivatives from mutant libraries. Using this system, this invention successfully screened a mutant engineered strain with a target fusion protein cell fluorescence intensity 1.7 times higher than the starting strain. This strain, while maintaining genetic stability, achieved efficient heterologous synthesis of antioxidant ginseng peptide derivatives. Measurements showed that its yield was 77.7% higher than the starting strain, laying a foundation for subsequent large-scale fermentation production.

[0021] Furthermore, those skilled in the art can extend the application of this screening system to high-throughput screening of other recombinant peptide expression strains by replacing the target peptide coding sequence, which has broad application prospects in the biomanufacturing of functional foods, cosmetics, and pharmaceutical intermediates.

[0022] Instructions for the Preservation of Biological Materials 169, referred to as mutant 169 in this invention, is classified as Bacillus subtilis. Bacillus subtilis Its Latin name is: Bacillus subtilisIt was deposited on May 25, 2026 at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.38855. The address of the depository is Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, 100101, China. Attached Figure Description

[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0024] Figure 1 Electrophoresis images of antioxidant ginseng peptide derivatives, green fluorescent protein, and carrier fragments. Figure 1 (A) in the image is an electrophoresis diagram of antioxidant ginseng peptide derivative fragments sa1, sa2, sa3 and green fluorescent protein; Figure 1 (B) in the image is the electrophoresis diagram of the vector pP43NMK.

[0025] Figure 2 Electrophoresis image of the fusion fragment of antioxidant ginseng peptide derivative and green fluorescent protein.

[0026] Figure 3 The recombinant plasmid map of the constructed fusion protein containing antioxidant ginseng peptide derivatives is shown.

[0027] Figure 4 The results are observed under fluorescence microscopy with 488 nm excitation on recombinant Bacillus subtilis.

[0028] Figure 5 This is an SDS-PAGE electrophoresis image of the antioxidant ginseng peptide derivative fusion protein SA-GFP.

[0029] Figure 6 The growth curve of recombinant Bacillus subtilis containing an antioxidant ginseng peptide derivative fusion protein is shown. Detailed Implementation

[0030] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0031] (I) Culture media and reagents involved in specific embodiments of the present invention: All culture media were prepared using ultrapure water and sterilized at 115°C for 30 min after preparation.

[0032] LB liquid medium: 10 g / L sodium chloride, 10 g / L peptone, and 5 g / L yeast extract.

[0033] TB liquid medium: 24 g / L yeast extract, 12 g / L peptone, 12.54 g / L K2HPO4, 2.31 g / L KH2PO4 and 4 mL / L glycerol.

[0034] The solid culture medium used was LB liquid medium with 2 w / v% agar powder added.

[0035] spI-a: 28 g / L K2HPO4·3H2O, 12 g / L KH2PO4, 4 g / L (NH4)2SO4 and 2 g / L Na3C6H5O7·2H2O.

[0036] spI-b: 0.4 g / L MgSO4·7H2O.

[0037] Glucose solution: 50% (w / v) anhydrous glucose.

[0038] 100×CAYE: 20 g / L casein amino acids, 100 g / L yeast extract.

[0039] CaCl2 solution: 50 mmol / L CaCl2.

[0040] MgCl2 solution: 250 mmol / L MgCl2.

[0041] 100×EGTA solution: 10 mmol / L EGTA.

[0042] spI medium: Mix 4.9 mL spI-a, 4.9 mL spI-b, 100 μL glucose solution and 100 μL 100×CAYE thoroughly.

[0043] spII medium: Mix 5.88 mL spI, 60 μL CaCl2 solution and 60 μL MgCl2 solution thoroughly.

[0044] (II) Preparation and transformation methods of Bacillus subtilis competent cells Dip a sterile inoculation loop into the glycerin tube and store it. Bacillus subtilisWB600 bacterial suspension was streaked onto LB agar plates and incubated overnight at 37°C to activate the strain. Single colonies obtained from streaking were picked and inoculated into 3 mL of spI medium and incubated overnight at 37°C and 200 rpm. 100 μL of the overnight culture was transferred to 5 mL of spI medium and incubated at 37°C and 200 rpm for 4.5 h. Then, 200 μL of the culture was inoculated into 2 mL of spII medium and incubated at 37°C and 200 rpm for 1.5 h. Finally, 20 μL of 100×EGTA solution was added to 2 mL of spII medium and incubated for another 10 min. The resulting cells were competent cells.

[0045] Add the plasmid to 500 μL of competent cells and mix gently. Incubate at 37°C and 200 rpm for 2.5 h. Centrifuge at 5000 rpm for 3 min, discard part of the supernatant, resuspend the cells and spread them on an antibiotic plate. Incubate overnight at 37°C.

[0046] Example 1: Construction of a recombinant plasmid containing an antioxidant ginseng peptide derivative fusion protein (1) Antioxidant ginseng peptide derivative gene fragments and gfp PCR amplification Using recombinant plasmids pMA5-A (biomaterial information can be found in publication number: CN118956715A), pMA5-SA (biomaterial information can be found in publication number: CN118956714A), and pMA5-SA3 from our research group's laboratory as templates, antioxidant ginseng peptide derivative fragments were amplified using primers F1 / R1, F2 / R2, and F3 / R3. sa 1. sa 2 and sa 3; Using the commercially available plasmid pP43NMK as a template, the linearized vector pP43NMK was amplified using primers F4 / R4 as a backbone; using the laboratory-preserved pHT43- gfp Using the template, the green fluorescent protein gene was amplified with primers F5 / R5. gfp .

[0047] sa The nucleotide sequence of 1: gattatcgcctgaaatttgtgcgcctgccgagcaaagattatcgcctgaaatttgtgcgcctgccgagcaaagattatcgcctgaaatttgtgcgcctgccgagcaaagattatcgcctgaaatttgtgcgcctgccgagcaaagattatcgcctgaaatttgtgcgcctgccgagcaaagattatcgcctgaaatttgtgcgcctgccgagcaaagattatcgcctgaaatttgtgcgcctgccgagcaaagattatcgcctgaaatttgtgcgcctgccgagcaaagattatcgcctgaaatttgtgcgcctgccgagcaaagattatcgcctgaaatttgtgcgcctgccgagcaaagattatcgcctgaaatttgtgcgcctgccgagcaaagattatcgcctgaaatttgtgcgcctgccgagcaaagattatcgcctgaaatttgtgcgcctgccgagcaaagattatcgcctgaaatttgtgcgcctgccgagcaaagattatcgcctgaaatttgtgcgcctgccgagcaaa, SEQ ID NO. 1.

[0048] sa The nucleotide sequence of 2: cagacaagccaaacgagccagacaagccaaacgagccagacaagccaaacgagccagacaagccaaacgagccagacaagccaaacgagccagacaagccaaacgagccagacaagccaaacgagccagacaagccaaacgagccagacaagccaaacgagccagacaagccaaacgagccagacaagccaaacgagccagacaagccaaacgagccagacaagccaaacgagccagacaagccaaacgagccagacaagccaaacgagccagacaagccaaacgagccagacaagccaaacgagccagacaagccaaacgagccagacaagccaaacgagc, SEQ ID NO. 2.

[0049] sa The nucleotide sequence of SEQ ID NO. 3: gaacacggtgagtacgaagagcatggtgaatacgaagaacatggcgaatatgaagagcacggagagtacgaagaacacggcgaatacgaagagcacggagaatatgaagagcatggagaatatgaggagcatggagagtatgaagagcatggtgagtatgaagagcatggcgaatacgaagagcacggtgagtatgaagagcatggcgagtacgaagaacatggcgagtatgaagaacatggtgaatatgaagaacacggtgaatacgaagaacacggagaatacgaagaacatggtgagtacgaagaacatggagaatacgaggaacatggagagtacgaagagcacggcgagtatgag, SEQ ID NO. 3.

[0050] The nucleotide sequence of pMA5-SA3:

[0051] The primer sequences are shown in Table 1.

[0052] Table 1 Primer sequences The PCR amplification system is shown in Table 2.

[0053] Table 2 PCR amplification system Each 25 μL PCR amplification system contains: 0.2 μL to 1 μL template DNA, 1 μL each of forward primer (F) and reverse primer (R), 12.5 μL Phanta Flash Master Mix (P510-01), and ddH2O to make up the difference.

[0054] The PCR amplification conditions were as follows: 98℃ pre-denaturation for 30 s; 98℃ denaturation for 10 s, 60℃ annealing for 5 s, 72℃ extension for 40 s, 30 cycles; 72℃ extension for 1 min.

[0055] The amplification products were detected by 1 w / v% agarose gel electrophoresis, and the results are as follows: Figure 1 As shown, the size of the amplified product fragment is consistent with expectations.

[0056] (2) Overlap PCR The gene fragment obtained in (1) sa 1. sa 2 and sa 3 and gfp They were spliced ​​together using overlapping PCR.

[0057] The conditions for the overlap PCR reaction were: 98℃ pre-denaturation for 30 s; 98℃ denaturation for 10 s, 60℃ annealing for 5 s, 72℃ extension for 40 s, 10 cycles; 72℃ extension for 1 min.

[0058] The overlap PCR amplification system is shown in Table 3.

[0059] Table 3 Overlap PCR Amplification System Using 2 μL of the overlapped PCR product SA-GFP as a template, PCR amplification was performed according to the method in Table 2. The results are as follows. Figure 2 As shown, all four replicate samples amplified the target band, which was bright and clear.

[0060] (3) Connection and transformation Homologous fragments were introduced into the expression vector. Using the Gibson splicing method, the fragments obtained in (2) were ligated with the linearized expression vector pP43NMK. The ligation product was then transformed into E. coli DH5α competent cells. Positive clones were screened using a 100 μg / mL ampicillin solution. Positive transformants were obtained after sequencing verification, which are recombinant plasmids containing antioxidant ginseng peptide derivative fusion proteins. The plasmid map is shown below. Figure 3 As shown.

[0061] Example 2: Construction of recombinant Bacillus subtilis containing an antioxidant ginseng peptide derivative fusion protein (1) Transform the recombinant plasmid Bacillus subtilis WB600 host cells The recombinant plasmid constructed in Example 1 was transformed into a chemical transformation method. Bacillus subtilis WB600 competent cells (strain information can be found in publication number: CN118956715A) were screened on LB plates containing a final concentration of 50 μg / mL kanamycin. The correct positive clones were identified by colony PCR, thus successfully constructing a high-throughput screening system for antioxidant ginseng peptide derivative fusion proteins.

[0062] (2) Fluorescence detection Select the correctly identified positive clones from (1), streak them on LB plates to isolate single colonies, and inoculate them into LB liquid medium for overnight culture. Take 1 mL of bacterial cells, centrifuge at 12000 rpm for 1 min, wash three times with 1 mL of sterile PBS, and take 10 μL for observation under a microscope. No green fluorescence was observed in the control group, while the experimental group showed green fluorescence under 488 nm excitation. Figure 4 As shown, this indicates that the recombinant plasmid containing the antioxidant ginseng peptide derivative fusion protein was successfully expressed in Bacillus subtilis.

[0063] Example 3: Shake-flask fermentation of antioxidant ginseng peptide derivative fusion protein (1) Preparation of seed fungal suspension The positive clones obtained in Example 2 were streaked onto LB solid medium containing a final concentration of 50 μg / mL kanamycin and incubated overnight at 37°C with the medium inverted. Colonies were selected and inoculated into LB liquid medium and incubated overnight at 37°C and 220 rpm. (2) Shake flask fermentation Inoculate at a volume ratio of 2% into TB medium containing a final concentration of 50 μg / mL kanamycin and incubate at 37℃ for 36 h. After incubation, collect the bacterial culture, centrifuge at 8000 rpm for 15 min, discard the supernatant, and obtain the bacterial cells. Resuspend the bacterial cells in PBS, then break the bacterial cells using a cell disruptor and collect the supernatant, which is the supernatant containing the antioxidant ginseng peptide derivative fusion protein.

[0064] The supernatant containing the antioxidant ginseng peptide derivative fusion protein SA-GFP was subjected to SDS-PAGE, and the results are shown in the figure. Figure 5 The molecular weight of the target band was consistent with the theoretical value of the SA-GFP fusion protein, indicating that the antioxidant ginseng peptide derivative fusion protein was successfully expressed intracellularly.

[0065] (3) Growth curve determination Inoculate at a volume ratio of 2% into TB medium containing a final concentration of 50 μg / mL kanamycin, and incubate at 37°C for 72 h. For the first 12 h, take 1 mL of bacterial cells every 4 h to determine bacterial density; after 12 h, take 1 mL of bacterial cells every 12 h to determine bacterial density. The growth curve is shown below. Figure 6 As shown.

[0066] Example 4: Feasibility Verification of a High-Throughput Screening System for Antioxidant Ginseng Peptide Derivative Fusion Proteins (1) Treatment of recombinant Bacillus subtilis using ambient pressure room temperature plasma (ARTP) mutagenesis instrument Single colonies of recombinant Bacillus subtilis isolated by streaking on LB plates in Example 3 were inoculated into LB liquid medium and cultured overnight. Then, at a volume ratio of 1%, the colonies were inoculated into TB medium containing a final concentration of 50 μg / mL kanamycin and cultured at 37°C and 220 rpm for 12 h. One mL of the bacterial cells was then centrifuged at 4°C and 5000 rpm for 6 min, and subsequently resuspended in sterile PBS containing 5% glycerol to achieve a bacterial concentration of 10. 8 CFU / mL.

[0067] In a sterile laminar flow hood, the slides for the ARTP mutagenesis instrument were sterilized using an alcohol lamp. They were then placed in sterile glass petri dishes and cooled. 10 μL of bacterial suspension was pipetted onto the slides and evenly spread. After the ARTP plasma mutagenesis instrument finished UV sterilization, the mutagenesis conditions were set, with a mutagenesis time of 20 s. After mutagenesis, the bacterial cells were shaken to mix thoroughly, and TB medium was added. After several-fold dilution, 150 μL of the bacterial suspension was pipetted onto LB agar plates containing a final concentration of 50 μg / mL kanamycin and incubated overnight at 37°C.

[0068] (2) Feasibility verification of high-throughput screening of strains producing high-yield ginseng peptide derivatives Two hundred single colonies were randomly selected from overnight incubated plates for shake-flask screening and validation. The fluorescence intensity and bacterial density of each strain were measured, and the fluorescence intensity per cell was calculated. The strains with the highest fluorescence intensity per cell showed increased levels of the antioxidant ginseng peptide derivative fusion protein. Therefore, this high-throughput screening method can be used as a reliable method for identifying high-yielding ginseng peptide derivative strains.

[0069] Example 5: Screening engineered bacteria that produce high-yield ginseng peptide derivative fusion proteins using a high-throughput screening system. The starting strain was subjected to ARTP mutagenesis according to the method described in Example 4, and then plated on LB agar plates containing a final concentration of 50 μg / mL kanamycin and incubated overnight at 37°C. 200 single colonies were randomly selected from the overnight incubated plates and screened in 96-well plates using the high-throughput screening method described in step (2). The fluorescence intensity (FL) and bacterial density (OD) of each strain were measured. 600 ), calculate the fluorescence intensity per unit bacterial cell (FL / OD) 600 This characterizes the relative yield of the target fusion protein per unit bacterial cell. The FL / OD ratio was initially screened in 96-well plates. 600 The results showed that the top 10% of strains were re-screened.

[0070] Table 4. Fluorescence intensity measurement results of mutant 169 The results in Table 4 show that, compared with the original strain, the fluorescence intensity of one of the mutants, numbered 169, was significantly increased.

[0071] After three parallel shake-flask screenings, the average fluorescence intensity per cell of mutant 169 was 2.7 times that of the starting strain, indicating that the yield of the target fusion protein was 1.7 times higher than that of the starting strain. Meanwhile, the cell growth density of this mutant was not significantly different from that of the starting strain, suggesting that the increased yield was not due to differences in cell growth.

[0072] Example 6: Fermentation verification of mutant strain 169 with enhanced fluorescence intensity The starting strain and the mutant strain 169 with enhanced fluorescence intensity obtained in Example 5 were inoculated into LB medium and cultured at 37°C and 220 rpm for 12 h. Subsequently, at a volume ratio of 1%, the culture was inoculated into TB medium containing a final concentration of 50 μg / mL kanamycin. After the culture was completed, the bacterial culture was collected, centrifuged at 8000 rpm for 15 min, the supernatant was discarded, and the bacterial cells were obtained. The bacterial cells were resuspended in PBS, and then the bacterial cells were disrupted using a cell disruptor. The supernatant was collected after centrifugation at 8000 rpm for 15 min, which is the supernatant containing the fusion protein containing the antioxidant ginseng peptide derivative.

[0073] The supernatant containing the antioxidant ginseng peptide derivative fusion protein obtained from the starting strain and mutant strain 169 was purified by nickel column affinity chromatography. The equilibration buffer used for nickel column affinity chromatography was 50 mM NaH2PO4, 500 mM NaCl, and 20 mM imidazole, and the elution buffer was 50 mM NaH2PO4, 500 mM NaCl, and 250 mM imidazole.

[0074] Equilibrate with 5 column volumes of equilibration buffer at a flow rate of 3 mL / min until the pH of the eluent matches that of the equilibration buffer. Load the supernatant onto the equilibrated nickel column at a flow rate of 2 mL / min. After loading, wash the column with equilibration buffer to remove unbound contaminating proteins. Then elute at a flow rate of 2 mL / min and collect the eluent (which is the antioxidant ginseng peptide derivative fusion protein).

[0075] The eluents collected after purification of the starting strain and mutant 169 were analyzed according to the instructions of the BCA protein concentration assay kit (Solepro BCA protein concentration assay kit, catalog number: PC0020). The yield of the starting strain was 330.3 mg / mL, and the yield of the 169 mutant was 587.0 mg / mL, representing a 77.7% increase compared to the starting strain.

[0076] The above results show that the screening system and screening method provided by the present invention can successfully obtain mutant strains with high yield of ginseng peptide derivatives, and the mutant strain 169 screened out has a significant yield increase and has good potential for industrial application.

[0077] It should be noted that when numerical ranges are involved in this invention, it should be understood that both endpoints of each numerical range and any value between the two endpoints can be selected. Since the steps and methods used are the same as in the embodiments, preferred embodiments are described here to avoid redundancy. Although preferred embodiments of the invention have been described, those skilled in the art, once they understand the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of this invention.

[0078] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A high-throughput screening system based on antioxidant ginseng peptide derivative fusion proteins, characterized in that, The antioxidant ginseng peptide derivative fusion protein comprises an antioxidant ginseng peptide derivative sequence and a fluorescent reporter protein sequence; the antioxidant ginseng peptide derivative sequence is selected from at least one of SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.

3.

2. The high-throughput screening system according to claim 1, characterized in that, The fluorescent reporter protein is a green fluorescent protein, a yellow fluorescent protein, or a red fluorescent protein.

3. The high-throughput screening system according to claim 2, characterized in that, The antioxidant ginseng peptide derivative fusion protein was prepared by the following steps: The antioxidant ginseng peptide derivative sequence and the green fluorescent protein sequence were cloned into an expression vector to obtain a recombinant vector. The recombinant vector was transformed into E. coli and then the recombinant plasmid was extracted. The recombinant plasmid was introduced into a host bacterium to obtain a recombinant strain; The recombinant strain was cultured to express the antioxidant ginseng peptide derivative fusion protein.

4. The high-throughput screening system according to claim 3, characterized in that, The antioxidant ginseng peptide derivative was obtained by tandem repeating the sequences shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.

3.

5. The high-throughput screening system according to claim 3, characterized in that, The expression vector is pMA5 or pP43NMK; the host bacterium is Bacillus subtilis.

6. The application of the high-throughput screening system according to any one of claims 1 to 5 in screening strains that produce high levels of antioxidant ginseng peptide derivatives.

7. A method for screening strains that produce high levels of antioxidant ginseng peptide derivatives, characterized in that, The high-throughput screening system according to any one of claims 1 to 5 includes the following steps: The host bacteria containing the high-throughput screening system were subjected to mutagenesis to construct a mutant library and obtain mutant strains. The fluorescence intensity of the mutant strain was detected, and the strains with the highest fluorescence intensity per unit cell were screened.

8. The method according to claim 7, characterized in that, The mutation was induced using ambient pressure, room temperature plasma mutagenesis technology.

9. The method according to claim 7, characterized in that, The host bacterium is Bacillus subtilis.

10. A Bacillus subtilis strain that produces high levels of antioxidant ginseng peptide derivatives ( Bacillus subtilis The Bacillus subtilis is obtained by screening using the method described in any one of claims 7 to 9; the Bacillus subtilis is deposited at the China General Microbiological Culture Collection Center with accession number CGMCC NO.38855.

Images