An autoinduction intelligent regulation system in escherichia coli and application thereof in inositol production

Abstract

The application discloses an Escherichia coli self-induction intelligent regulation system and application thereof in myo-inositol (MI) production. The regulation system integrates a quorum sensing system (QS) and a growth coupling promoter (GPP), and realizes accurate redirection of carbon metabolic flux through a dynamic regulation mechanism mediated by an artificial small RNA (sRNA). The self-induction intelligent regulation system has the advantages of modularity, automation and low metabolic burden, and can be widely applied to metabolic flux optimization of a microbial cell factory, thereby providing technical support for efficient synthesis of high-value compounds.

Description

Technical Field

[0001] This invention belongs to the field of microbial metabolic engineering technology, specifically relating to a self-induced intelligent regulation system in Escherichia coli and its application in inositol production. Background Technology

[0002] Myo-inositol (MI) is a six-carbon cyclic polyol with important physiological functions, widely used in food, medicine, and cosmetics. Microbial fermentation for inositol production has become a current research hotspot due to its environmental friendliness and renewable raw materials. However, constructing inositol biosynthetic pathways in hosts such as *E. coli* often faces the problem of carbon metabolic flux imbalance: the inositol biosynthetic pathway competes for carbon flux with the host's inherent metabolic pathways (such as glycolysis EMP and the pentose phosphate pathway HMP), while overexpression of exogenous pathways increases the host's metabolic burden, leading to limited strain growth and ultimately affecting inositol yield.

[0003] Traditional metabolic engineering strategies often employ constitutive promoter overexpression of synthetic pathway genes or knockout of competing pathway genes. However, these static regulatory approaches struggle to balance the dynamic relationship between strain growth and product synthesis: constitutive inhibition of competing pathways may lead to strain growth defects, while persistently high expression of key synthetic genes can exacerbate the metabolic burden. Therefore, developing intelligent systems capable of automatically regulating metabolic flux based on strain growth status to achieve dynamic separation of growth and production is crucial for improving product fermentation efficiency.

[0004] Artificial small RNAs (sRNAs), as highly efficient gene expression regulation tools, possess advantages such as simple design, strong modularity, and low metabolic burden. They can achieve precise post-transcriptional inhibition by targeting and binding to target gene mRNA. Quorum sensing systems (QS) can automatically activate gene expression based on cell density, while the activity of growth-coupled promoters (GPPs) dynamically changes with cell growth stages; both are ideal elements for dynamic regulation. However, there are currently no reports on integrating sRNA, QS, and GPP systems for carbon flux redirection in E. coli inositol synthesis. Summary of the Invention

[0005] The purpose of this invention is to provide a self-induced intelligent regulatory system in Escherichia coli, which solves the problem of imbalance between growth and production in inositol fermentation by dynamically regulating the expression of genes in competitive and synthetic pathways, achieving precise redirection of carbon metabolism flux to inositol synthesis, and increasing inositol production.

[0006] In one aspect, the present invention provides a recombinant expression system for inositol synthesis, the recombinant expression system comprising at least one key gene of the inositol biosynthetic pathway and at least one gene related to a competing metabolic pathway; The expression of the key genes and competing metabolic pathway-related genes is dynamically controlled by regulatory elements, so that the recombinant strain preferentially expresses competing metabolic pathway-related genes during the growth stage to support cell growth, and preferentially expresses key genes of the inositol biosynthesis pathway during the production stage to promote inositol synthesis, thereby achieving a dynamic balance between cell growth and inositol production.

[0007] In one embodiment of the present invention, the regulatory elements include quorum sensing (QS) regulatory elements and growth phase-dependent promoter (GPP) regulatory elements; these two elements synergistically drive the temporal expression of artificial small RNAs (sRNAs), differentially regulating key genes in the inositol biosynthesis pathway and genes related to competing metabolic pathways at different growth stages. In a specific embodiment of the present invention, during the cell growth stage, the expression level of sRNAs targeting key genes in the inositol biosynthesis pathway is increased, while the expression level of sRNAs targeting genes related to competing metabolic pathways is decreased, to maintain the carbon flow supply required for central metabolism and cell growth, ensuring cell growth and biomass accumulation; during the product synthesis stage, the expression level of sRNAs targeting genes related to competing metabolic pathways is increased, while the expression level of sRNAs targeting key genes in the inositol biosynthesis pathway is decreased, promoting the allocation of carbon sources to the inositol biosynthesis pathway and reducing the allocation of carbon sources to competing metabolic pathways, thereby increasing inositol production.

[0008] In one embodiment of the present invention, the recombinant expression system comprises a combination of the following elements: (1) Inositol synthesis element, comprising at least one key gene expression cassette of the inositol biosynthesis pathway for overexpression of key enzymes in the inositol biosynthesis pathway; (2) Quorum sensing (QS) regulatory element comprising at least one first sRNA expression cassette driven by a density-dependent promoter, wherein the first sRNA is used to target and inhibit genes related to competing metabolic pathways, thereby achieving a directed redistribution of metabolic flow to the inositol synthesis pathway; (3) Growth phase-dependent (GPP) regulatory elements, including at least one second sRNA expression cassette driven by a growth phase-dependent promoter, wherein the second sRNA is used to dynamically negatively regulate the expression of key genes in the inositol synthesis pathway at a specific growth phase in order to optimize the metabolic balance between growth and production.

[0009] In one embodiment of the present invention, the key genes of the inositol biosynthesis pathway are selected from one or more combinations of the following: inositol-1-phosphate synthase genes (such as INO1 or MIPS), inositol monophosphatase genes (such as suhB), and other precursor supply pathway genes (such as phosphogluconose isomerase genes pgi, phosphogluconose mutase genes, and glucokinase genes). In one embodiment of the present invention, the key genes of the inositol biosynthesis pathway are selected from INO1 and suhB. In one embodiment of the present invention, the key genes of the inositol biosynthesis pathway are driven by constitutive or inducible promoters (preferably Ptac).

[0010] In one embodiment of the present invention, the density-dependent promoter is selected from at least one of the following: Lux system promoter, Las system promoter, Rhl system promoter, Tra system promoter, Agr system promoter, and ComQXPA system promoter.

[0011] In one embodiment of the present invention, the density-dependent promoter is selected from Lux system promoters; preferably at least one of Plux (such as PluxI, PluxR, PluxICDABE) or functional variants.

[0012] In one embodiment of the present invention, the quorum sensing regulatory element further comprises an expression cassette of an acylhomoserine lactone (AHL) synthase gene (luxI class or its functional homologs, such as lasI, rhlI, etc.) and / or a LuxR gene. Preferably, the AHL synthase gene and / or LuxR gene are expressed by a constitutive promoter. The constitutive promoter is preferably the PJ23104 promoter.

[0013] In one embodiment of the present invention, the density-dependent promoter can regulate the expression of the target gene in response to changes in the concentration of AHL signaling molecules, thereby achieving downregulation of the competitive pathway gene in the later stage of strain growth.

[0014] In one embodiment of the present invention, the target gene of the first sRNA is selected from one or more of the following pathways: glycolysis, pentose phosphate pathway, and other tributary genes that consume glucose-6-phosphate. Preferably, pfkA and pfkB from the glycolysis pathway, and zwf from the pentose phosphate pathway are selected.

[0015] In one embodiment of the present invention, the quorum sensing regulatory element comprises a luxI gene driven by a constitutive promoter of PJ23104 or equivalent function, and a first sRNA expression cassette targeting pfkA, pfkB, and zwf genes driven by a density-responsive promoter of Plux or equivalent function.

[0016] In one embodiment of the present invention, the growth stage-dependent promoter includes at least one of an exponential growth phase promoter, a stationary phase promoter, a nutrient restriction-responsive promoter, or a stress-responsive promoter. In another embodiment of the present invention, the growth stage-dependent promoter includes at least one of PSA, PcsiD, Pdps, PbolA, PrpoS, PgadA, or Pfic.

[0017] In one embodiment of the present invention, the growth phase-dependent promoter is an exponential growth phase promoter, whose transcriptional activity is higher during the cell's exponential growth phase than during the stationary phase, thereby achieving the inhibition of key genes during the strain's growth phase and normal expression during the stationary phase.

[0018] In one embodiment of the present invention, the target gene of the second sRNA is selected from INO1.

[0019] In one embodiment of the present invention, the GPP regulatory element comprises a second sRNA expression cassette targeting the INO1 gene, driven by a PSA or a functionally equivalent growth stage-dependent promoter.

[0020] In one embodiment of the present invention, the first sRNA or the second sRNA is of the SgrS-Hfq type, and its seed region is complementary to the first 24 nt of the translation initiation region of the target gene mRNA. The scaffold region can recruit Hfq protein to form a complex, crowding out ribosome binding sites to inhibit the translation of the target gene.

[0021] In one embodiment of the present invention, the QS regulatory element and the GPP regulatory element are integrated in the same or different carriers to jointly achieve dynamic regulation of the inositol synthesis pathway. In another embodiment of the present invention, the QS regulatory element and the GPP regulatory element are integrated on pACYC184, pUC19, pET28a, pTrc99A, or a carrier with equivalent function.

[0022] In one embodiment of the present invention, the inositol synthesis element is located on pUC19 or a functionally equivalent high-copy vector.

[0023] In one embodiment of the present invention, the density-dependent promoter and the growth stage-dependent promoter can be replaced by other functionally equivalent inductive promoters.

[0024] In one embodiment of the present invention, the system further comprises a gene expression cassette that enhances precursor supply and / or modifications that knock out or weaken key genes in competing pathways.

[0025] In one embodiment of the present invention, it further includes at least one reporter gene expression cassette, wherein the reporter gene is selected from fluorescent protein genes (mCherry, GFP, etc.), enzyme genes, or antibiotic resistance genes.

[0026] In one embodiment of the present invention, the system can achieve efficient synthesis of inositol in a shake flask, fermenter, or continuous fermentation system.

[0027] In a second aspect, the present invention provides a method for constructing the recombinant expression system, comprising constructing an inositol synthesis element, a QS regulatory element, and a GPP regulatory element, optionally with the step of orthogonally integrating the QS and GPP elements.

[0028] In one embodiment of the present invention, the method includes the following steps: a. Constructing the recombinant plasmid pUC19-INO1-suhB for inositol synthesis; b. Construct recombinant plasmids pQS-sRNAs for QS regulatory elements; c. Construct the recombinant plasmid pGPP-anti-INO1, which regulates GPP elements; d. Amplify and ligate the GPP regulatory element into the pQS-sRNAs plasmid to obtain the pQS-sRNAs-GPP-anti-INO1 recombinant plasmid.

[0029] In a third aspect, the present invention provides a host cell containing the recombinant expression system described above.

[0030] In one embodiment of the present invention, the host cell is selected from Escherichia coli, Bacillus subtilis, yeast, Pseudomonas, or Corynebacterium.

[0031] In one embodiment of the present invention, the host cell is Escherichia coli ElwR or a derivative strain (such as ElwR-PA), obtained by transformation or co-transformation of a plasmid containing the recombinant expression system.

[0032] In one embodiment of the present invention, when the engineered Escherichia coli ferments in a sucrose-based carbon source medium, its inositol production is significantly higher than that of the control strain without the regulatory element, and also higher than that of strains that are regulated solely by single-target sRNA expression plasmids of pfkA, pfkB, zwf, pgi, or INO1 genes.

[0033] In one embodiment of the present invention, Escherichia coli ElwR is used as the starting strain, and a QS regulatory element and a GPP regulatory element are introduced through a recombinant plasmid. The QS regulatory element includes a luxI gene driven by the PJ23104 promoter and a first sRNA expression cassette controlled by the Plux promoter. The GPP regulatory element includes a second sRNA expression cassette controlled by the PSA promoter.

[0034] In one embodiment of the present invention, the first sRNA expression cassette targets pfkA, pfkB, and zwf; the second sRNA expression cassette targets the INO1 gene.

[0035] In a fourth aspect, the present invention provides a method for the biosynthesis of inositol, wherein the recombinant expression system or the host cell (preferably engineered Escherichia coli) is used to carry out fermentation culture in a sucrose-containing medium.

[0036] In one embodiment of the present invention, the fermentation temperature is 30-40℃, the fermentation time is 4-72h, the shaking speed is 150-250rpm, and the sucrose concentration is 0.5-50g / L.

[0037] In a fifth aspect, the present invention provides the application of the recombinant expression system, the host cell (preferably engineered Escherichia coli), or the method thereof in the production of inositol.

[0038] The present invention also provides an orthogonal regulatory system, including a QS regulatory element and a GPP regulatory element, for dynamic negative regulation of a target metabolic pathway (preferably the inositol synthesis pathway) in microbial cells.

[0039] In one embodiment of the present invention, the QS regulatory element and the GPP regulatory element are as described above. In a specific embodiment of the present invention, the QS regulatory element includes the luxI gene and the Plux responsive promoter; the GPP regulatory element includes the PSA promoter.

[0040] The present invention also provides a fermentation composition comprising the host cell (preferably engineered Escherichia coli) and a culture medium suitable for inositol fermentation.

[0041] The present invention also provides a kit comprising the recombinant expression system, the engineered Escherichia coli, transformation reagent and / or fermentation medium components.

[0042] The beneficial effects of this invention are: (1) The self-induced intelligent regulation system of the present invention realizes dynamic and automated regulation of metabolic pathways, without the need for exogenous addition of inducers, thereby reducing fermentation costs and improving process stability.

[0043] (2) The use of sRNA-mediated downregulation mechanism avoids the irreversible damage to host metabolism caused by gene knockout, balances the relationship between strain growth and product synthesis, and significantly increases inositol production.

[0044] (3) The regulatory system has modular design features. It can be adapted to the synthesis pathway of different target products by replacing the target gene recognition sequence of sRNA, and has a wide range of applications. Attached Figure Description

[0045] Figure 1 A schematic diagram illustrating the downregulation mechanism of SgrS-Hfq type artificial small RNA.

[0046] Figure 2A schematic diagram illustrating the strategies by which QS and GPP regulate small RNAs.

[0047] Figure 3 Establishment and testing of QS and GPP automatic and intelligent control systems: (A) Schematic diagram of strain construction; (B) Growth curves of ElwR-AHLMC at different sucrose concentrations; (C) Changes in Mcherry fluorescence intensity of ElwR-AHLMC; (D) Growth curves of ElwR-SAGFP and ElwR-SLGFP; (E) GFP / Mcherry fluorescence intensity ratio of ElwR-SAGFP and ElwR-SLGFP.

[0048] Figure 4 QS and GPP systems control sRNA regulation of competitive pathways and key enzymes: (A) Schematic diagram of strain construction; (B) Growth curves of strains downregulated by pfkA, pfkB, zwf and pgi; (C) Inositol production of the above strains; (D) Growth curves of strains downregulated by INO1; (E) Inositol production of strains downregulated by INO1.

[0049] Figure 5 The QS and GPP systems control four sRNA-regulated competitive pathways and key enzymes: (A) Schematic diagram of the construction of R-PAISat4 strain; (B) Growth curves of this strain under high and low sucrose concentrations; (C) Inositol production of this strain under high and low sucrose concentrations. Detailed Implementation

[0050] The technical solution of the present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are merely illustrative and explanatory of the present invention, and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are covered within the scope of protection intended by the present invention.

[0051] Unless otherwise stated, the raw materials and reagents used in the following examples are commercially available products or can be prepared by known methods.

[0052] This invention utilizes the QS system to downregulate key genes (pfkA, pfkB, zwf) in the glycolysis (EMP) and pentose phosphate pathway (HMP) during the later stages of strain growth, while simultaneously using the GPP system to inhibit the expression of the key inositol synthesis gene (INO1) during the strain's growth phase, thus forming a growth-production separation model of "focused growth in the early stage and efficient production in the later stage." The engineered strain R-PAISat4, constructed using this system, achieved a maximum inositol yield of 486.9 mg / L in sucrose medium, a 173.2% increase compared to the original strain, significantly improving the balance between growth and biosynthesis in the carbon metabolism module. The self-induced intelligent regulation system provided by this invention has advantages such as modularity, automation, and low metabolic burden, and can be widely applied to the optimization of metabolic flux in microbial cell factories, providing technical support for the efficient synthesis of high-value compounds.

[0053] The self-induced intelligent regulation system of this invention consists of three parts: a regulatory element, an actuator, and a target gene. Regulatory elements include the quorum sensing system (QS) and the growth-coupled promoter (GPP). The QS system consists of the luxI gene (encoding N-acylhomoserine lactone synthase) and the Plux-responsive promoter. When cell density reaches a threshold, the AHL signaling molecules synthesized by LuxI accumulate and activate the Plux promoter, driving downstream gene expression. The GPP system uses P... SA The promoter activity is high during the growth phase of the strain and decreases significantly after entering the stationary phase.

[0054] The execution element is an artificial small RNA (sRNA) of type SgrS-Hfq. The seed region of the sRNA is designed to be complementary to the first 24 nt of the translation initiation region of the target gene mRNA, and the scaffold region can recruit the chaperone protein Hfq to form a complex. By crowding out the ribosome binding site, the complex inhibits the translation of the target gene, thereby downregulating rather than completely blocking gene expression and avoiding irreversible effects on host growth.

[0055] Target genes: pfkA and pfkB genes of the EMP pathway and zwf gene of the HMP pathway were selected as competitive pathway target genes, and INO1, a key gene for inositol synthesis, was selected as the product synthesis target gene.

[0056] The working mechanism of the control system of the present invention: The growth period of the strain (0~24h): P of the GPP system SAThe promoter is in a highly active state, driving the expression of sRNA targeting the INO1 gene, inhibiting the translation of the INO1 gene, reducing the carbon flux occupied by the inositol synthesis pathway, reducing the metabolic burden, and ensuring the rapid accumulation of biomass by the strain. At this time, due to the low cell density in the QS system, the AHL signaling molecules have not reached the threshold, the Plux promoter is in a silent state, and the competing pathway genes (pfkA, pfkB, zwf) are expressed normally, meeting the strain's needs for energy and intermediate metabolites.

[0057] Stable period of the strain (after 24 hours): Cell density reaches the threshold, AHL signaling molecules accumulate in the QS system and activate the Plux promoter, driving the expression of sRNAs targeting pfkA, pfkB, and zwf genes, and downregulating carbon flux in competitive pathways; simultaneously, P in the GPP system... SA The promoter activity decreases, the expression of sRNA targeting the INO1 gene weakens, the INO1 gene is expressed normally, and the carbon flux is redirected to the inositol synthesis pathway, thus achieving efficient inositol synthesis.

[0058] The primer sequences used in this invention are shown in Table 1.

[0059] Table 1 Primer Sequences

[0060]

[0061] Example 1: Construction of Escherichia coli ElwR-PAIS and Inositol Synthesis Test The construction process, using *Escherichia coli* ElwR-PA (an optimized sucrose-utilizing strain) as the starting strain, is as follows: Step S1, constructing the recombinant plasmid for inositol synthesis: clone the expression cassette of the INO1 gene and suhB gene driven by the Ptac promoter into the vector pUC19 to obtain the recombinant plasmid pUC19-INO1-suhB.

[0062] Step S2, Construction of inositol-synthesizing strain: The pUC19-INO1-suhB plasmid was transformed into Escherichia coli ElwR-PA to obtain the recombinant strain ElwR-PAIS that can synthesize inositol using sucrose.

[0063] Step S3, inositol fermentation with recombinant strain: The recombinant strain ElwR-PAIS was inoculated into CoLBG11 medium containing 1,10 g / L sucrose and fermented at 37°C and 200 rpm for 48–72 h. The final inositol yields were 27.2 mg / L and 178.2 mg / L, respectively.

[0064] Example 2: Construction and testing of a self-induced intelligent regulation system and construction and testing of inositol-synthesizing strains Step S1, Construction of test plasmid for self-induced intelligent regulation system: a. Constructing the QS reporter plasmid pQS-mCherry: PJ23104-luxI and Plux-mCherry were cloned into the pACYC184 vector and transformed into Escherichia coli ElwR to obtain strain ElwR-AHLMC.

[0065] b. Constructing the GPP reporter plasmid pGPP-GFP: PSA-GFP and constitutive promoter-driven mCherry were cloned into the pACYC184 vector and transformed into E. coli ElwR to obtain the strain ElwR-SAGFP.

[0066] Step S2, Intelligent Control System Test: a. QS System Test: ElwR-AHLMCs were inoculated into CoLBG11 medium containing 1 g / L and 10 g / L sucrose and cultured for 72 h. OD600 and mCherry fluorescence intensity were measured every 12 h. Results are as follows: Figure 3 As shown, the fluorescence intensity of mCherry increased significantly after 12 hours, proving that the QS system can automatically activate expression based on cell density.

[0067] b. GPP system test: ElwR-SAGFP was inoculated into the above-mentioned medium and cultured for 72 h. The GFP / Mcherry ratio was then measured. The results are as follows: Figure 3 As shown, the ratio is higher in the early stage and decreases significantly in the later stage, proving that the GPP system has growth stage-dependent expression characteristics.

[0068] Step S3, Construction and fermentation performance verification of engineered strain R-PAISat4: a. Construction of recombinant plasmids for the QS regulatory module: The luxI gene driven by the PJ23104 promoter and the sRNA expression cassette (targeting pfkA, pfkB, and zwf) controlled by the Plux promoter were cloned into the vector pACYC184 to obtain the recombinant plasmid pQS-sRNAs. The sRNA sequence targeting pfkA is shown in SEQ ID NO:3, the sRNA sequence targeting pfkB is shown in SEQ ID NO:4, and the sRNA sequence targeting zwf is shown in SEQ ID NO:5.

[0069] b. Constructing the GPP regulatory module recombinant plasmid: P SA The promoter-controlled sRNA expression cassette (targeting INO1) was cloned into the vector pACYC184 to obtain the recombinant plasmid pGPP-anti-INO1. The sRNA sequence targeting INO1 is shown in SEQ ID NO:6.

[0070] c. Constructing a recombinant plasmid with an orthogonal QS-GPP regulatory module: Amplify the GPP-anti-INO1 module from the pGPP-anti-INO1 plasmid and ligate it into the pQS-sRNAs plasmid to obtain the recombinant plasmid pQS-sRNAs-GPP-anti-INO1.

[0071] d. Construction of engineered strains: pQS-sRNAs-GPP-anti-INO1 and pUC19-INO1-suhB plasmids were co-transformed into Escherichia coli ElwR to obtain engineered strain R-PAISat4, which integrates four gene regulatory modules.

[0072] Step S4, verification of the fermentation performance of engineered strain R-PAISat4: a. Shake-flask fermentation: R-PAISat4 and the control strain ElwR-PAIS were inoculated into CoLBG11 medium containing 1 g / L and 10 g / L sucrose, respectively, and fermented at 37°C and 200 rpm for 72 h. The results are as follows: Figure 5 As shown, R-PAISat4 produced 486.9 mg / L of inositol under 10 g / L sucrose conditions, which was 173.2% higher than the control; and 47.8 mg / L under 1 g / L sucrose conditions, which was 75.7% higher than the control.

[0073] b. qRT-PCR verification: Samples were taken during fermentation to detect the transcriptional levels of pfkA, pfkB, zwf, and INO1 genes. Results are as follows: Figure 5 As shown, after 24 hours, the transcriptional levels of pfkA, pfkB, and zwf genes were significantly downregulated, while the transcriptional level of INO1 gene was significantly upregulated, demonstrating the orthogonality and effectiveness of the regulatory system.

[0074] Construction and screening of comparative single-target gene-regulated strains and inositol synthesis assay Step S1, Construction of single-target gene-regulated strains: Genes related to inositol synthesis were selected, and sRNA expression plasmids targeting pfkA, pfkB, zwf, pgi, and INO1 genes were constructed. These plasmids were combined with QS and GPP regulatory elements, respectively, and transformed into ElwR-PAIS to obtain a series of engineered strains, named R-PAISatA, R-PAISatB, R-PAISatF, R-PAISatI, and R-PAISO1, respectively. GPP .

[0075] Step S2, shake-flask fermentation screening: Each strain was inoculated into CoLBG11 medium containing 10 g / L sucrose and fermented for 72 h. Growth curves and inositol yield were then measured. Results are as follows: Figure 4As shown, strains targeting pgi exhibited severe growth defects and decreased inositol production, with an inositol production of only 107.5 mg / L compared to the control strain ElwR-PAIS, thus excluding the pgi gene. Strains targeting pfkA, pfkB, and zwf produced inositol at 289.0 mg / L, 197.6 mg / L, and 210.7 mg / L, respectively, representing increases of 62.2%, 10.9%, and 18.2% compared to the control ElwR-PAIS, but significantly lower than the final engineered strain R-PAISat4. The strain targeting INO1 produced inositol at 372.1 mg / L, an increase of 108.8% compared to the control ElwR-PAIS, but still lower than the 486.9 mg / L inositol production of the engineered strain R-PAISat4.

[0076] The above results indicate that the final engineered strain R-PAISat4, regulated by four genes simultaneously, exhibits optimal inositol synthesis performance under sucrose-based carbon source conditions. Furthermore, the orthogonal self-inducible regulatory systems QS and GPP employed by this strain also show potential for application in strains synthesizing other target products using *E. coli* as a chassis, aiming to achieve phase separation between the growth and production of engineered strains and obtain higher concentrations of the target product.

[0077] Gene sequence: The INO1 gene is derived from Saccharomyces cerevisiae (SEQ ID NO:1): The suhB gene is derived from Escherichia coli (SEQ ID NO:2): atgcatccgatgctgaacatcgccgtgcgcgcagcgcgcaaggcgggtaatttaattgccaaaaactatgaaaccccggacgctgtagaagcgagccagaaaggcagtaacgatttcgtgaccaacgtagataaagctgccgaagcggtgattatcgacacgattcgtaaatcttacccacagcacaccatcatcaccgaagaaagcggtgaacttgaaggtactgatcaggatgttcaatgggttatcgatccactggatggcactaccaactttatcaaacgtctgccgcacttcgcggtatctatcgctgttcgtatcaaaggccgcaccgaagttgctgtggtatacgatcctatgcgtaacgaactgttcaccgccactcgcggtcagggcgcacagctgaacggctaccgactgcgcggcagcaccgctcgcgatctcgacggtactattctggcgaccggcttcccgttcaaagcaaaacagtacgccactacctacatcaacatcgtcggcaaactgttcaacgaatgtgcagacttccgtcgtaccggttctgcggcgctggatctggcttacgtcgctgcgggtcgtgttgacggtttctttgaaatcggtctgcgcccgtgggacttcgccgcaggcgagctgctggttcgtgaagcgggcggcatcgtcagcgacttcaccggtggtcataactacatgctgaccggtaacatcgttgctggtaacccgcgcgttgttaaagccatgctggcgaacatgcgtgacgagttaagcgacgctctgaagcgttaa Sequence of anti-pfkA-sRNA (SEQ ID NO:3): caacacaccgattttcttaatcatTATTGGTGTAAAATCACCCGCCAGCAGATTATACCTGCTGGTTTTTTTT anti-pfkB-sRNA sequence (SEQ ID NO:4): tgtcaacgtatagatacgtaccatTATTGGTGTAAAATCACCCGCCAGCAGATTATACCTGCTGGTTTTTTTT anti-zwf-sRNA sequence (SEQ ID NO:5): ctgggctgtttgcgttaccgccatTATTGGTGTAAAATCACCCGCCAGCAGATTATACCTGCTGGTTTTTTTT anti-INO1-sRNA sequence (SEQ ID NO:6): tggagcaatattatcttctgtcat TATTGGTGTAAAATCACCCGCCAGCAGATTATACCTGCTGGTTTTTTTT Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. A recombinant expression system for inositol synthesis, characterized in that, The recombinant expression system includes at least one key gene of the inositol biosynthesis pathway and at least one gene related to a competing metabolic pathway. The expression of the key genes and competing metabolic pathway-related genes is dynamically controlled by regulatory elements, so that the recombinant strain preferentially expresses competing metabolic pathway-related genes during the growth stage to support cell growth, and preferentially expresses key genes of the inositol biosynthesis pathway during the production stage to promote inositol synthesis, thereby achieving a dynamic balance between cell growth and inositol production.

2. The recombinant expression system for inositol synthesis according to claim 1, characterized in that, The regulatory elements include quorum sensing (QS) regulatory elements and growth phase-dependent promoter (GPP) regulatory elements; the two work together to drive the temporal expression of artificial small RNA (sRNA) and differentially regulate key genes in the inositol biosynthesis pathway and genes related to competing metabolic pathways. Preferably, during the cell growth stage, the expression level of sRNA targeting key genes in the inositol synthesis pathway is increased, while the expression level of sRNA targeting genes related to competing metabolic pathways is decreased, in order to maintain the carbon flow supply required for central metabolism and cell growth, and ensure cell growth and biomass accumulation. During the production stage, the expression level of sRNA targeting genes related to competing metabolic pathways is increased, while the expression level of sRNA targeting key genes in the inositol synthesis pathway is decreased, in order to promote the allocation of carbon sources to the inositol synthesis pathway, reduce the allocation of carbon sources to competing metabolic branches, and increase inositol production.

3. The recombinant expression system for inositol synthesis according to claim 2, characterized in that, The recombinant expression system comprises a combination of the following elements: (1) Inositol synthesis element, comprising at least one key gene expression cassette of the inositol biosynthesis pathway for overexpression of key enzymes in the inositol biosynthesis pathway; (2) Quorum sensing (QS) regulatory element comprising at least one first sRNA expression cassette driven by a density-dependent promoter, wherein the first sRNA is used to target and inhibit genes related to competing metabolic pathways, thereby achieving a directed redistribution of metabolic flow to the inositol synthesis pathway; (3) Growth phase-dependent (GPP) regulatory elements, including at least one second sRNA expression cassette driven by a growth phase-dependent promoter, wherein the second sRNA is used to dynamically negatively regulate the expression of key genes in the inositol synthesis pathway at a specific growth phase in order to optimize the metabolic balance between growth and production.

4. The recombinant expression system for inositol synthesis according to claim 3, characterized in that, The key genes of the inositol biosynthesis pathway are selected from one or more combinations of the following: inositol-1-phosphate synthase genes (such as INO1 or MIPS), inositol monophosphatase genes (such as suhB), and other precursor supply pathway genes (such as phosphogluconose isomerase gene pgi, phosphogluconose mutase gene, and glucokinase gene); preferably, the key genes of the inositol biosynthesis pathway are selected from INO1 and suhB; preferably, the key genes of the inositol biosynthesis pathway are driven by constitutive or inducible promoters (preferably Ptac). Preferably, the density-dependent promoter is selected from at least one of the Lux system promoter, Las system promoter, Rhl system promoter, Tra system promoter, Agr system promoter, and ComQXPA system promoter; preferably, the density-dependent promoter is selected from the Lux system promoter; more preferably, it is selected from at least one of Plux (such as PluxI, PluxR, PluxICDABE) or a functional variant; Preferably, the quorum sensing regulatory element further comprises an expression cassette of an acylhomoserine lactone (AHL) synthase gene (luxI class or its functional homologs, such as lasI, rhlI, etc.) and / or a LuxR gene; preferably, the AHL synthase gene and / or LuxR gene are expressed by a constitutive promoter; preferably, the constitutive promoter is the PJ23104 promoter; Preferably, the target gene of the first sRNA is selected from one or more of the glycolysis pathway, the pentose phosphate pathway, and other branch genes that consume glucose-6-phosphate; preferably pfkA and pfkB of the glycolysis pathway and zwf of the pentose phosphate pathway. Preferably, the quorum sensing regulatory element comprises a luxI gene driven by a constitutive promoter of PJ23104 or equivalent function, and a first sRNA expression cassette targeting pfkA, pfkB, and zwf genes driven by a density-response promoter of Plux or equivalent function. Preferably, the growth stage-dependent promoter includes at least one of the following: exponential growth promoter, stationary phase promoter, nutrient restriction-responsive promoter, or stress-responsive promoter; more preferably, the growth stage-dependent promoter includes at least one of PSA, PcsiD, Pdps, PbolA, PrpoS, PgadA, or Pfic. Preferably, the target gene of the second sRNA is selected from INO1; Preferably, the GPP regulatory element comprises a second sRNA expression cassette targeting the INO1 gene driven by a PSA or a functionally equivalent growth stage-dependent promoter. Preferably, the first or second sRNA is of the SgrS-Hfq type, whose seed region is complementary to the first 24 nt of the translation initiation region of the target gene mRNA, and whose scaffold region can recruit Hfq protein to form a complex, crowding out ribosome binding sites to inhibit the translation of the target gene. Preferably, the QS regulatory element and the GPP regulatory element are integrated in the same or different carriers to jointly achieve dynamic regulation of the inositol synthesis pathway; preferably, the QS regulatory element and the GPP regulatory element are integrated on pACYC184, pUC19, pET28a, pTrc99A or a carrier with equivalent function. Preferably, the inositol synthesis element is located on pUC19 or a functionally equivalent high-copy vector; Preferably, the density-dependent promoter and the growth stage-dependent promoter can be replaced by other functionally equivalent inductive promoters; Preferably, the system further includes gene expression cassettes that enhance precursor supply and / or modifications that knock out or weaken key genes in competing pathways; Preferably, the system further comprises at least one reporter gene expression cassette, wherein the reporter gene is selected from fluorescent protein genes (mCherry, GFP, etc.), enzyme genes, or antibiotic resistance genes; Preferably, the system can achieve efficient synthesis of inositol in shake flasks, fermenters, or continuous fermentation systems.

5. A method for constructing the recombinant expression system according to any one of claims 1-4, characterized in that, This includes the construction of inositol synthesis elements, QS regulatory elements, and GPP regulatory elements, with the optional step of orthogonally integrating QS and GPP elements.

6. A host cell containing the recombinant expression system according to any one of claims 1-4; Preferably, the host cells are selected from Escherichia coli, Bacillus subtilis, yeast, Pseudomonas, or Corynebacterium. Preferably, the host cell is Escherichia coli ElwR or a derivative strain (such as ElwR-PA), obtained by transformation or co-transformation of a plasmid containing the recombinant expression system.

7. A method for biosynthesizing inositol, comprising fermenting and culturing in a sucrose-containing medium using the recombinant expression system according to any one of claims 1-4 or the host cell according to claim 6; The preferred fermentation temperature is 30-40℃, the fermentation time is 4-72h, the shaking speed is 150-250rpm, and the sucrose concentration is 0.5-50g / L.

8. The use of the recombinant expression system according to any one of claims 1-4, the host cell according to claim 6, and the method according to claim 7 in the production of inositol.

9. An orthogonal regulatory system comprising a QS regulatory element and a GPP regulatory element for dynamic negative regulation of a target metabolic pathway (preferably the inositol synthesis pathway) in microbial cells, wherein the QS regulatory element and the GPP regulatory element are as described in claim 3.

10. A fermentation composition or kit comprising the host cell and culture medium as described in claim 6; Preferably, the kit further comprises the recombinant expression system and transformation reagent as described in any one of claims 1-4.

Images