A host intracellular microenvironment-responsive recombinant pseudomonas aeruginosa and application thereof

Abstract

The application discloses a host intracellular microenvironment responsive recombinant pseudomonas aeruginosa and application thereof. The recombinant pseudomonas aeruginosa contains an expression vector, wherein a host intracellular microenvironment responsive promoter is activated by an intracellular restrictive microenvironment after entering a host cell; a reporter gene is connected with the host intracellular microenvironment responsive promoter, driven by the host intracellular microenvironment responsive promoter and expresses a reporter signal when the host intracellular microenvironment responsive promoter is activated; and the application is used for specific identification of intracellular bacteria in a host cell or comparison and evaluation of invasion abilities of different strains, or screening of candidate drugs against intracellular bacteria in a host cell. The application utilizes the report expression induced by the restrictive microenvironment in a host cell, keeps a low background when bacteria are located outside a cell, is favorable for distinguishing intracellular and extracellular bacteria states, reduces multiple washing or antibiotic protection steps in a traditional infection experiment and simplifies a detection process.

Description

Technical Field

[0001] This invention belongs to the fields of microbial engineering, infection biology and drug screening technology, specifically relating to a recombinant Pseudomonas aeruginosa activated by the restrictive microenvironment within the host cell, and the application of this recombinant Pseudomonas aeruginosa in identifying the invasive state within the host cell, evaluating bacterial invasive ability and screening candidate drugs against intracellular bacteria. Background Technology

[0002] Many bacteria can invade host cells during infection and evade immune clearance, forming persistent infections or enhancing tolerance within the intracellular environment. Current research often employs methods such as strains continuously expressing fluorescent proteins, chemical fluorescent dye labeling, or antibiotic protection assays to study bacterial invasion behavior. While these methods provide some information, they have several limitations in practical use: they struggle to effectively distinguish between extracellularly attached bacteria and those that have actually entered the host cell, resulting in high background signals; they typically rely on additional washing, inhibition, or antibiotic protection steps, leading to lengthy experimental procedures and narrow operational windows; some inducible reporter systems depend on exogenous inducers, deviating from the natural infection process and making them difficult to directly apply to complex infection models or drug screening scenarios; and in drug evaluation, they lack the ability to provide rapid and visual interpretation of whether intracellular bacteria are effectively inhibited.

[0003] After entering a host cell, bacteria are exposed to an intracellular microenvironment significantly different from the extracellular environment, including iron restriction, phosphorus deficiency, enhanced oxidative stress, increased membrane damage-related stress, and limited energy metabolism. These changes can be sensed by the bacteria's own regulatory network, thereby inducing the activation of specific gene promoters. Therefore, by coupling intracellular environment-responsive promoters with detectable reporter genes, it is possible to construct a reporter system that can automatically distinguish between intracellular and extracellular bacterial states without the need for external inducers.

[0004] Therefore, there is an urgent need for a detection scheme and engineered strain that closely approximates the natural infection process and can directly serve the interpretation of intracellular invasion status, evaluation of invasive ability, and screening of anti-intracellular bacterial drugs. Summary of the Invention

[0005] The purpose of this invention is to overcome the aforementioned deficiencies of the prior art and provide a host cell intracellular environment-responsive recombinant *Pseudomonas aeruginosa*. In a preferred embodiment, the recombinant *Pseudomonas aeruginosa* is a *Pseudomonas aeruginosa* strain capable of invading host cells. This recombinant *Pseudomonas aeruginosa* utilizes the restrictive microenvironmental signals it experiences after entering the host cell to drive the specific expression of a reporter gene, thereby maintaining a low background when located outside the host cell and generating a detectable signal / reporter signal after invading the host cell.

[0006] Another object of the present invention is to provide applications of this recombinant Pseudomonas aeruginosa. Based on this recombinant Pseudomonas aeruginosa, specific recognition of intracellular invading bacteria and comparative evaluation of the invasive abilities of different strains can be achieved, and it can be used for rapid screening of candidate drugs against intracellular bacteria. In a preferred embodiment, relying on the low extracellular background characteristics of the system of the present invention, traditional washing or antibiotic protection steps can be reduced, making it suitable for high-throughput signal reading in multi-well plate systems.

[0007] To achieve the above objectives, the present invention adopts the following technical solution: I. A host-intracellular microenvironment-responsive recombinant Pseudomonas aeruginosa: The recombinant Pseudomonas aeruginosa contains an expression vector within its cells, the expression vector comprising: Host cell intracellular environment-responsive promoters: These promoters are activated by the restrictive intracellular microenvironment after entering the host cell; Reporter gene: functionally linked to the host cell's intracellular environment-responsive promoter, driven by the host cell's intracellular environment-responsive promoter, and expressing a reporter signal as a detectable signal when activated.

[0008] The reporter signal is a fluorescent signal, specifically the fluorescent signal corresponding to the reporter protein expressed by the reporter gene.

[0009] The recombinant Pseudomonas aeruginosa was prepared by introducing an expression vector containing a host cell intracellular environment-responsive promoter and a reporter gene into Pseudomonas aeruginosa for culture, expression, and screening.

[0010] When the recombinant Pseudomonas aeruginosa does not enter the host cell, it maintains low expression or almost no expression under normal in vitro culture conditions; when the recombinant Pseudomonas aeruginosa enters the host cell, it is activated by the restrictive microenvironment signals within the host cell and then specifically expresses the reporter gene.

[0011] Because the intensity of the reporter signal can be affected by factors such as the type of reporter gene and the detection equipment, low expression or almost no expression is difficult to quantify to a fixed absolute expression level. The term "low expression or almost no expression" mainly refers to the fact that under conventional in vitro culture conditions, the reporter signal produced by recombinant *Pseudomonas aeruginosa* is weak, close to the background signal level of the detection system itself, and difficult to distinguish from the background signal in the uninduced state. However, when the recombinant *Pseudomonas aeruginosa* enters the host cell, under the induction of restrictive microenvironment signals within the host cell, the reporter signal is significantly enhanced, thus enabling differentiation from the extracellular low background state.

[0012] The limiting microenvironment signals within the host cell are selected from at least one of the following: iron-limited environment, phosphorus-deficient environment, oxidative stress environment, membrane damage-related stress environment, and energy metabolism-restricted environment. They are usually generated by the host cell itself due to physiological or disease-related factors.

[0013] Preferably, the promoter is induced to activate under one or more of the above-described environmental conditions.

[0014] The host cell intracellular environment-responsive promoter is preferably derived from the promoter region or promoter-related regulatory sequence upstream of the psdV, fptA, or hxuA genes of Pseudomonas aeruginosa.

[0015] The reporter gene is preferably a fluorescent protein-encoding gene.

[0016] The host cell is preferably an isolated epithelial cell, and more preferably a Caco-2 cell. For example, epithelial cells of animals such as mice.

[0017] II. Application of a host intracellular microenvironment-responsive recombinant Pseudomonas aeruginosa: It can be used to achieve specific recognition of bacteria invading host cells or to compare and evaluate the invasive ability of different strains, or to rapidly screen candidate drugs against bacteria in host cells.

[0018] III. A method for identifying the intracellular invasion status of host-intracellular microenvironment-responsive recombinant Pseudomonas aeruginosa: The recombinant Pseudomonas aeruginosa was added to the host cell culture medium to form a host cell infection model by infecting the host cells with the recombinant Pseudomonas aeruginosa. By real-time monitoring of the reporter signal expressed by the recombinant Pseudomonas aeruginosa, bacteria located inside the host cells were effectively distinguished from bacteria located outside the host cells. Based on the reporter signal, it was determined whether the reporter gene was activated in the host cell infection model, and the recombinant Pseudomonas aeruginosa that had actually entered the host cells was identified and visualized, thereby achieving specific identification of invading bacteria inside the host cells.

[0019] IV. A method for comparing and evaluating the invasive ability of different strains of host-intracellular microenvironment-responsive recombinant Pseudomonas aeruginosa: The method involves adding recombinant Pseudomonas aeruginosa from different sources or with different genetic backgrounds to host cell cultures to create different host cell infection models. The recombinant Pseudomonas aeruginosa from different sources or with different genetic backgrounds includes at least one of wild-type strains, clinical isolates, drug-resistant strains, virulence-related mutant strains, gene knockout strains, gene overexpression strains, or gene complementation strains. The signal intensity or occurrence time of the reporter signal obtained by each strain after infection with host cells is compared and judged to evaluate the host cell invasion ability and differences of different strains.

[0020] The report signal is obtained by observation using a fluorescence microscope, or by reading it using at least one of a fluorescence microplate reader, a cell imager, a live cell imaging system, or a flow cytometer.

[0021] V. A rapid screening method for anti-host intracellular bacterial candidate drugs of host intracellular microenvironment-responsive recombinant Pseudomonas aeruginosa: The method involves adding the recombinant Pseudomonas aeruginosa to a host cell culture medium to infect the host cells, thereby creating a host cell infection model. A candidate drug is then added to the host cell infection model, and the reporter signal expressed by the recombinant Pseudomonas aeruginosa is detected. The drug efficacy is evaluated based on the changes in the reporter signal obtained from different treatment groups.

[0022] The recombinant Pseudomonas aeruginosa described in this invention has a wide range of applications, including: Intracellular invasion status identification: Based on whether the report signal is activated in the host cell infection model, bacteria that have actually entered the host cell are identified and visualized.

[0023] Invasive ability assessment: Compare the intensity or timing of reporter signals in host cells of different strains, clinical isolates or mutant strains to evaluate differences in invasive ability.

[0024] Screening of candidate drugs against intracellular bacteria: High-throughput or semi-high-throughput screening using multi-well plate systems is preferred. Candidate drugs are added to a host cell infection model, and drug efficacy is evaluated based on changes in reporter signals.

[0025] Specifically, during the drug screening described above, recombinant Pseudomonas aeruginosa can be co-cultured with host cells in a multi-well plate for infection, followed by the addition of candidate drugs for further incubation. Based on the low extracellular background characteristic of the system of this invention, in some embodiments, in situ signal reading can be performed directly using a fluorescence microplate reader or cell imaging system without multiple washing or additional extracellular sterilization steps, thus making it suitable for high-throughput screening of anti-infective drugs.

[0026] The beneficial effects of this invention are: (1) The present invention utilizes the restrictive microenvironment within the host cell to induce reporter expression, which can maintain a low background when bacteria are located outside the cell, thus facilitating the differentiation between intracellular and extracellular bacterial states.

[0027] (2) In some embodiments, the present invention can reduce the number of washing and antibiotic protection steps in traditional infection experiments and simplify the detection process.

[0028] (3) This invention does not require exogenous inducers and is closer to the natural infection process.

[0029] (4) This invention can be used for signal reading in a multi-well plate system and has the potential for high-throughput or semi-high-throughput screening applications.

[0030] (5) This invention provides a variety of replaceable intracellular environment-responsive promoters, which is beneficial for optimizing detection effects according to different models and improving method stability. Attached Figure Description

[0031] Figure 1 This is a schematic diagram of the PpsdV-Reporter expression vector structure; Figure 2 This is a fluorescence imaging result of Pseudomonas aeruginosa invading Caco-2 cells, as shown in the PpsdV-Reporter image. Figure 3 A comparative diagram of reporter gene expression in PsdV-Reporter Pseudomonas aeruginosa under phosphorus-limited conditions; Figure 4 This is a fluorescence imaging result of Pseudomonas aeruginosa invading Caco-2 cells, as shown in the PfptA-Reporter image. Figure 5 This is a fluorescence imaging result of Pseudomonas aeruginosa invading Caco-2 cells, as shown in the PhxuA-Reporter image. Figure 6 This is a flowchart of drug screening and invasion evaluation for host microenvironment-responsive recombinant Pseudomonas aeruginosa. Detailed Implementation

[0032] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments.

[0033] The method and recombinant Pseudomonas aeruginosa strain provided by this invention have the following specific implementation directions: (1) Screening of candidate drugs for anti-intracellular infection: Applicable to screening systems such as 96-well or 384-well plates, and can be used for the initial screening of candidate compounds and comparison of efficacy.

[0034] (2) Bacterial invasion ability and virulence evaluation tools: used to evaluate the cell invasion ability of clinical isolates or laboratory mutants from different sources, serving clinical drug resistance monitoring and pathogenic mechanism experiments.

[0035] (3) Visual dynamic monitoring of the infection process: In experiments not for diagnostic purposes, live cell imaging technology is used to observe the bacterial invasion process or evaluate the effect of treatment on intracellular bacterial load.

[0036] The embodiments of the present invention are as follows: Example 1: Construction and validation of intracellular specific reporter systems for bacteria based on different environmentally responsive promoters (1) Obtaining the promoter fragment During infection, after entering the host cell, *Pseudomonas aeruginosa* can thrive in a restrictive intracellular microenvironment characterized by low iron, low oxygen, nutrient limitation, or increased stress. The upstream promoter regions or promoter-related regulatory sequences of some *P. aeruginosa* endogenous genes can sense these environmental changes and regulate downstream gene expression, thereby participating in *P. aeruginosa*'s adaptation to the host's intracellular environment of low iron, low oxygen, or increased stress. In this embodiment, *P. aeruginosa* strain PAO1 was used as the material. Its genomic DNA was extracted, and the promoter region upstream of the *psdV* gene was selected as an environmentally responsive promoter. The fragment containing its regulatory functional region was amplified by PCR.

[0037] (2) Construction of the report carrier The reporter plasmid pPROBE_NT_6807_GT was digested with restriction endonucleases HindIII and EcoRI, and the linear fragment was recovered using a DNA recovery kit to obtain the linearized pPROBE_NT_6807_GT plasmid described below.

[0038] Primers PROBE-psdV-F and PROBE-psdV-R were designed to amplify the psdV promoter fragment. The PROBE-psdV-F primer is 42 bp in length, with the first 21 bp representing the extension sequence of the HindIII restriction enzyme on the plasmid, and the last 21 bp representing the promoter sequence. The PROBE-psdV-R primer is also 42 bp in length, with the first 21 bp representing the extension sequence of the EcoRI restriction enzyme on the plasmid, and the last 21 bp representing the promoter sequence.

[0039] The psdV promoter fragment was further amplified using high-fidelity DNA polymerase. Homologous recombination with the linearized pPROBE_NT_6807_GT plasmid was then performed using the ClonExpress UltraOne Step Cloning Kit V2 to clone the promoter fragment upstream of the reporter gene coding sequence, constructing the PpsdV-Reporter expression vector. This expression vector was then transformed into *Escherichia coli* DH5α for amplification. Its structural diagram is shown below. Figure 1 As shown, the functional connection between the promoter and the reporter gene was verified using molecular biology methods.

[0040] The primer sequences are as follows: PROBE-psdV-F: ggaattggggatcggaagcttTGCCGACCTCCTTGGCCCGCT, SEQ ID No. 1; PROBE-psdV-R:ctttagttagttagggaattcGGAAATCACCTTGCTGCGGAG, SEQ ID No. 2.

[0041] (3) Obtaining recombinant Pseudomonas aeruginosa strains A gentamicin-resistant *E. coli* strain carrying the correct recombinant plasmid was obtained by PCR detection and sent to a sequencing company for confirmation. After confirmation, the strain was cultured and stored in sterile glycerol at −80°C. The constructed reporter plasmid was extracted using a plasmid extraction kit, and *Pseudomonas aeruginosa* competent cells were prepared with 10% sterile sucrose solution. 2 μL (500 ng) of the reporter plasmid was transformed into *P. aeruginosa* competent cells using a Bio-Rad MicroPulser electroporator (0.2 cm electroporation cuvette, 2500 V, 200 Ω). After 1 hour of recovery in LB medium, the cells were plated on selective plates containing the appropriate antibiotics for culture. Recombinant *P. aeruginosa* strains carrying the PpsdV-Reporter expression vector were screened, and stably inherited strains were obtained under selective conditions.

[0042] Example 2: Verification of specific activation under host cell infection conditions Caco-2 cells, derived from human colon adenocarcinoma, were selected as a host cell model to simulate the process of bacterial invasion of host epithelial cells. Caco-2 cells were cultured under standard mammalian cell culture conditions, preferably a complete medium containing basal medium and serum components (such as DMEM basal medium supplemented with fetal bovine serum), at 37°C, 5% CO2, and saturated humidity. Caco-2 cells were seeded into cell culture dishes, and after cell adhesion and growth to a suitable density, subsequent co-culture experiments were performed.

[0043] Before co-culturing, the cell culture medium was replaced with an antibiotic-free medium. Subsequently, the recombinant *Pseudomonas aeruginosa* obtained in Example 1 was added to the Caco-2 cell culture system and co-cultured with Caco-2 cells to simulate the contact and invasion process between bacteria and host epithelial cells. The multiplicity of infection (MOI) between the bacteria and host cells can be selected according to experimental needs, preferably in the range of approximately 10-50; in this example, an MOI of approximately 50 is preferred.

[0044] Four hours after infection and co-culturing, the culture medium was removed from the co-culture system, and the cells were washed once with phosphate-buffered saline (PBS) to remove most of the bacteria that had not invaded the host cells. The co-culture system was then observed using fluorescence microscopy. The results showed that the PpsdV-Reporter Pseudomonas aeruginosa outside the host cells maintained a low background reporter signal; while bacteria inside the host cells showed a significantly enhanced reporter signal, indicating that the PpsdV-Reporter reporter expression system can be specifically activated after bacterial invasion of the host cell. Figure 2 As shown.

[0045] Example 3: Verification of promoter activation under phosphorus-limited conditions The recombinant Pseudomonas aeruginosa strain (PpsdV-Reporter) described in Example 1 was inoculated into LB medium (conventional culture conditions) and cultured under phosphorus-deficient conditions, respectively. After 8 hours of culture, its reporter signal was observed using a fluorescence microscope. The phosphorus-deficient medium was Pseudomonas broth (PB) medium: 20 g / L pancreatic digest of gelatin, 1.4 g / L magnesium chloride, and 10 g / L potassium sulfate.

[0046] The results showed that under standard LB culture conditions, the reporter signal of the recombinant *Pseudomonas aeruginosa* strain remained at a low background level; however, under phosphorus-limited culture conditions, reporter gene expression was significantly enhanced, indicating that the environmentally responsive promoter was effectively activated under phosphorus-deficient conditions. Figure 3 As shown.

[0047] Example 4: Equivalent System Based on fptA Promoter (PfptA-Reporter) The fptA gene encodes an outer membrane receptor protein involved in iron uptake. Its expression is significantly induced under iron-limited conditions, but its expression level is low under conventional in vitro culture conditions. Since the host cell intracellular environment is typically iron-limited, the promoter region upstream of the fptA gene can respond to this environmental change, possessing the characteristics of an environmentally responsive promoter. Therefore, in this embodiment, the promoter region upstream of the fptA gene was selected to construct the PfptA-Reporter expression system.

[0048] Following the method described in Example 1, new primers PROBE-fptA-F and PROBE-fptA-R were designed to amplify the promoter sequence. The promoter region upstream of the fptA gene of Pseudomonas aeruginosa was constructed into a PfptA-Reporter expression vector and introduced into Pseudomonas aeruginosa.

[0049] The primer sequences are as follows: PROBE-fptA-F: ggaattggggatcggaagcttCGCGTCAGGCCGACCAGGTAC, SEQ ID No. 3; PROBE-fptA-R:ctttagttagttagggaattcCGTTCGAACAGCCTCGGGGGA, SEQ ID No. 4.

[0050] Following the method described in Example 2, the host cell infection experiment was performed. The PfptA-Reporter system exhibited the same intracellular specific activation characteristics as in Example 2, i.e., the PfptA-Reporter Pseudomonas aeruginosa reporter signal located outside the host cell was in a low background state; while a significantly enhanced reporter signal could be detected in bacteria inside the host cell. Figure 4 As shown.

[0051] Example 5: Equivalent System Based on hxuA Promoter (PhxuA-Reporter) The hxuA gene encodes a functional protein associated with the utilization of heme or host-derived iron, and its expression is induced to be enhanced in the host cellular environment. The promoter region upstream of this gene can sense and activate the iron-limiting microenvironment within the host cell, making it suitable as an environment-responsive promoter. Therefore, this embodiment utilizes the promoter region upstream of the hxuA gene to construct the PhxuA-Reporter expression system.

[0052] Following the method described in Example 1, new primers PROBE-hxuA-F and PROBE-hxuA-R were designed to amplify the promoter sequence. The promoter region upstream of the hxuA gene of Pseudomonas aeruginosa was constructed into the PhxuA-Reporter expression vector and introduced into Pseudomonas aeruginosa.

[0053] The primer sequences are as follows: PROBE-hxuA-F: ggaattggggatcggaagcttCGGGTACGGTGCGGATCGCCCG, SEQ ID No. 5; PROBE-hxuA-R:ctttagttagttagggaattcGCTGGAACTCTCCCCAAGTGA, SEQ ID No. 6.

[0054] Following the method described in Example 2, host cell infection experiments were performed. The PhxuA-Reporter system exhibited the same intracellular-specific activation characteristics as in Example 2, i.e., the PhxuA-Reporter Pseudomonas aeruginosa reporter signal located outside the host cell was in a low background state; while a significantly enhanced reporter signal could be detected in bacteria inside the host cell. Figure 5 As shown.

[0055] Example 6: Evaluation of Invasive Phenotype and Screening of Anti-Intracellular Infection Drugs Based on Recombinant Pseudomonas aeruginosa This embodiment further verifies the specific operating procedures of the recombinant Pseudomonas aeruginosa under different practical application scenarios, including the following steps: (1) Establishment of co-culture and infection model Caco-2 host cells were seeded into 96-well or 384-well clear-bottom microplates and cultured to an appropriate density. Recombinant Pseudomonas aeruginosa (as obtained in Example 1) in a low extracellular background state was collected and added to each test well at the set multiplicity of infection (MOI=50). The cells were co-cultured at 37°C and 5% CO2 (e.g., for 4 hours) to allow the recombinant Pseudomonas aeruginosa to invade the host cells. After co-culture, the following procedures were performed according to the specific application requirements.

[0056] (2) Application Scenario 1: Invasion Capability Assessment Process When evaluating bacterial invasiveness, different experimental groups (e.g., wild-type strains and mutant strains, or clinical isolates from different sources) can be co-cultured with host cells following the steps described above. Subsequently, in situ signal readings are performed directly using a live-cell imaging system or a multi-well fluorescent microplate reader. By statistically analyzing and comparing the report signal intensity and fluorescence positivity rate of each test group, the impact of specific target gene deletions, external stimuli, or clinical drug resistance phenotypes on the ability of bacteria to invade host cells can be quantitatively assessed.

[0057] (3) Application Scenario 2: High-throughput drug screening process for anti-intracellular bacteria During candidate drug screening, after the co-culture is completed, a preset concentration of the test compound (such as a compound library) is directly added to different test wells, and a corresponding solvent control group is set up. Based on the low extracellular background of this system, in some embodiments, the extracellular bacterial washing operation in traditional methods can be reduced, or the additional step of adding antibiotics (such as gentamicin) for extracellular bactericidal protection can be reduced. After drug addition, the multi-well plate is incubated for 12-24 hours; after incubation, the microplate is placed in a multifunctional fluorescent microplate reader to read the signal of each well in situ. If the relative fluorescence intensity of a well treated with a certain compound is significantly lower than that of the control group, it indicates that the tested compound has an inhibitory effect on the survival, proliferation, persistent infection state, or related intracellular adaptation processes of bacteria in the host cell. Based on this, it can be preliminarily determined that the compound has the potential to penetrate the host cell membrane and exert anti-intracellular bacterial activity, and can be used as a candidate lead compound for subsequent pharmacological validation.

[0058] The above specific embodiments are used to explain and illustrate the present invention, but not to limit the present invention. Any modifications and changes made to the present invention within the spirit and scope of the claims shall fall within the protection scope of the present invention.

[0059] The above description is only a preferred embodiment of the present invention. Therefore, all equivalent changes or modifications made to the structure, features and principles described in the claims of this patent application are included in the scope of this patent application.

[0060] The gene sequence involved in this invention is as follows: SEQ ID No.1; Name: PROBE-psdV-F primers DNA type: other DNA Biological origin: Artificial Sequence / synthetic construct ggaattggggatcggaagctttgccgacctccttgcgccgct SEQ ID No.2; Name: PROBE-psdV-R primers DNA type: other DNA Biological origin: Artificial Sequence / synthetic construct ctttagttagttagggaattcggaaatcaccttgctgcggag SEQ ID No. 3; Name: PROBE-fptA-F primers DNA type: other DNA Biological origin: Artificial Sequence / synthetic construct ggaattggggatcggaagcttcgcgtcaggccgaccaggtac SEQ ID No.4; Name: PROBE-fptA-R primers DNA type: other DNA Biological origin: Artificial Sequence / synthetic construct ctttagttagttagggaattccgttcgaacagcctcggggga SEQ ID No. 5; Name: PROBE-hxuA-F primers DNA type: other DNA Biological origin: Artificial Sequence / synthetic construct ggaattggggatcggaagcttcggtacggtgcggatcgcccg SEQ ID No. 6; Name: PROBE-hxuA-R primers DNA type: other DNA Biological origin: Artificial Sequence / synthetic construct ctttagttagttagggaattcgctggaactctccccaagtga.

Claims

1. The application of a host intracellular microenvironment-responsive recombinant Pseudomonas aeruginosa, characterized in that: It is used to achieve specific recognition of bacteria invading host cells or to compare and evaluate the invasive ability of different strains, or to screen candidate drugs against bacteria in host cells. The recombinant Pseudomonas aeruginosa contains an expression vector within its cells, the expression vector comprising: Host cell intracellular environment-responsive promoters: These promoters are activated by the restrictive intracellular microenvironment after entering the host cell; Reporter gene: linked to the host cell's intracellular environment-responsive promoter, driven by the host cell's intracellular environment-responsive promoter, and expressing a reporter signal when activated.

2. The application according to claim 1, characterized in that: The recombinant Pseudomonas aeruginosa was prepared by introducing an expression vector containing a host cell intracellular environment-responsive promoter and a reporter gene into Pseudomonas aeruginosa for culture, expression, and screening.

3. The application according to claim 1, characterized in that: The host cell intracellular environment-responsive promoter is derived from the promoter region or promoter-related regulatory sequence upstream of the psdV, fptA, or hxuA genes of Pseudomonas aeruginosa; the reporter gene is a fluorescent protein-encoding gene.

4. The application according to claim 1, characterized in that: The host cell is an epithelial cell.

5. A method for identifying intracellular invasion state based on any one of the applications described in claims 1-4, characterized in that: The recombinant Pseudomonas aeruginosa was added to the host cell culture medium to form a host cell infection model by infecting the host cells with the recombinant Pseudomonas aeruginosa. By real-time monitoring of the reporter signal expressed by the recombinant Pseudomonas aeruginosa, the bacteria located inside the host cells were distinguished from the bacteria located outside the host cells, and the recombinant Pseudomonas aeruginosa that actually entered the host cells was identified and visualized.

6. The method according to claim 5, characterized in that: When the recombinant Pseudomonas aeruginosa does not enter the host cell, it maintains low expression or no expression; when the recombinant Pseudomonas aeruginosa enters the host cell, it is activated by restrictive microenvironment signals and then specifically expresses the reporter gene.

7. A method for comparing and evaluating the invasive ability of different strains based on any of the applications described in claims 1-4, characterized in that: The method involves adding recombinant Pseudomonas aeruginosa from different sources or with different genetic backgrounds to host cell cultures to create different host cell infection models. The recombinant Pseudomonas aeruginosa from different sources or with different genetic backgrounds includes at least one of wild-type strains, clinical isolates, drug-resistant strains, virulence-related mutant strains, gene knockout strains, gene overexpression strains, or gene complementation strains. The signal intensity or occurrence time of the reporter signal obtained by each strain after infection with host cells is compared and judged to evaluate the host cell invasion ability and differences of different strains.

8. The method according to claim 7, characterized in that: When the recombinant Pseudomonas aeruginosa does not enter the host cell, it maintains low expression or no expression; when the recombinant Pseudomonas aeruginosa enters the host cell, it is activated by restrictive microenvironment signals and then specifically expresses the reporter gene.

9. A method for screening candidate drugs against intracellular bacteria based on any one of the applications described in claims 1-4, characterized in that: The method involves adding the recombinant Pseudomonas aeruginosa to a host cell culture medium to infect the host cells, thereby creating a host cell infection model. A candidate drug is then added to the host cell infection model, and the reporter signal expressed by the recombinant Pseudomonas aeruginosa is detected. The drug efficacy is evaluated based on the changes in the reporter signal obtained from different treatment groups.

10. The method according to claim 9, characterized in that: When the recombinant Pseudomonas aeruginosa does not enter the host cell, it maintains low expression or no expression; when the recombinant Pseudomonas aeruginosa enters the host cell, it is activated by restrictive microenvironment signals and then specifically expresses the reporter gene.

Images