Toxoplasma gondii attenuated strain, construction method and application thereof

Abstract

The application discloses a Toxoplasma gondii attenuated strain and a construction method and application thereof, and relates to the construction of the Toxoplasma gondii attenuated strain by knocking out a TgAP2XI-2 gene of the Toxoplasma gondii to affect intracellular proliferation and virulence of the Toxoplasma gondii. Compared with a wild strain, the Toxoplasma gondii attenuated strain with the TgAP2XI-2 gene deleted loses the ability to form a cyst and has significantly reduced pathogenicity, and infected mice show no disease and no death, and have high safety to a host. Meanwhile, after mice are immunized by the Toxoplasma gondii attenuated strain with the TgAP2XI-2 gene deleted, high IgG antibody levels and high levels of cytokines are generated, and the mice can provide significant immune protection efficacy for high-dose Toxoplasma gondii RH, PYS tachyzoite and Pru cyst re-infection, and can be used for preventing re-infection of the Toxoplasma gondii, and are the attenuated live vaccine with great application value, and provide a reliable technical basis for large-scale production of the Toxoplasma gondii attenuated live vaccine.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to a weakened strain of Toxoplasma gondii, its construction method, and its application. Background Technology

[0002] Toxoplasma gondii is an obligate intracellular parasite that is an opportunistic pathogen that can infect almost all warm-blooded animals, including humans, and is widely distributed throughout the world.

[0003] The life cycle of Toxoplasma gondii is complex, with multiple life stages and host alternation. When a person ingests raw meat containing Toxoplasma gondii tissue cysts or water contaminated with oocysts from cat feces, the tissue cysts or oocysts rupture, and the parasite enters the digestive tract and invades the intestinal mucosal cells. The sporozoites released by the oocysts or the bradyzoites released by the tissue cysts transform into tachyzoites, which eventually distribute to various parts of the body, causing Toxoplasma gondii infection in the host.

[0004] When people with normal immune systems are infected with Toxoplasma gondii, the host does not show obvious clinical symptoms due to the action of the body's immune system. However, for patients with weakened immune function, such as organ transplant patients and AIDS patients, Toxoplasma gondii infection carries a high risk and can even lead to the death of the host in severe cases.

[0005] The reason why toxoplasmosis is difficult to cure is that existing drugs only work on the tachyzoite stage of the parasite, and have little effect on the bradyzoites inside the cysts. Once the body's immunity declines, the bradyzoites released from the cysts will transform into tachyzoites and cause reinfection. In addition, the use of drugs has certain toxic side effects.

[0006] In recent years, scholars at home and abroad have generally believed that an effective measure to control toxoplasmosis may be to develop vaccines to immunize the host.

[0007] Currently, toxoplasmosis vaccine development mainly focuses on inactivated vaccines, subunit vaccines, and nucleic acid vaccines. However, these vaccines only provide partial immune protection and cannot achieve complete protection, resulting in less than ideal immune protection. Attenuated live vaccines, due to their advantages such as good immunogenicity and long-lasting immunity, have become one of the best choices for toxoplasmosis control. However, currently only one strain of S48 Toxoplasma gondii attenuated live vaccine is approved for use in preventing abortion in goats and sheep, but this vaccine is limited to use in countries such as New Zealand, and its genetic background is unclear.

[0008] Therefore, in order to solve the above-mentioned technical problems, finding new and effective vaccine candidate antigens for the development of anti-toxoplasmosis vaccines has become an important task for protecting human health. Summary of the Invention

[0009] In view of this, the present invention provides a Toxoplasma gondii attenuated strain, its construction method and application. By knocking out the TgAP2XI-2 gene in Toxoplasma gondii, a Toxoplasma gondii attenuated strain with TgAP2XI-2 gene deletion is finally obtained. It was found that after knocking out TgAP2XI-2, Toxoplasma gondii cannot form cysts in mice. Low doses of the Toxoplasma gondii attenuated strain can provide immune protection against acute and chronic Toxoplasma gondii infection.

[0010] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:

[0011] A method for constructing a Toxoplasma gondii attenuated strain involves knocking out the TgAP2XI-2 gene of Toxoplasma gondii to affect the intracellular proliferation and virulence of the parasite, thereby constructing an attenuated Toxoplasma gondii strain.

[0012] The nucleotide sequence of the TgAP2XI-2 gene is shown in SEQ ID NO.1.

[0013] Preferably, the knockout of the TgAP2XI-2 gene is achieved using CRISPR-Cas9 technology.

[0014] Preferably, the nucleotide sequence of the sgRNA used in the CRISPR / Cas9 system is shown in SEQ ID NO.2.

[0015] Preferably, it includes the following steps:

[0016] (1) Construction of knockout plasmid: Replace UPRT in pSAG1-Cas9-SgUPRT with TgAP2XI-2, that is, construct plasmid pSAG1-Cas9-SgTgAP2XI-2;

[0017] Construct a homologous fragment DHFR containing TgAP2XI-2, and design 5' and 3' homologous arms primers before the start codon and after the stop codon of the TgAP2XI-2 gene.

[0018] Simultaneously, universal amplification primers for pUPRT-DHFR-D and pUC19 were designed and ligated.

[0019] Finally, the successfully sequenced DHFR plasmid was amplified.

[0020] (2) Construction of attenuated Toxoplasma gondii strain: The above-mentioned pSAG1-Cas9-SgTgAP2XI-2 knockout plasmid and the resistance fragment containing the AP2XI-2 homologous arm were electroporated into Toxoplasma gondii. After screening and identification, the attenuated Toxoplasma gondii strain was obtained and named PruΔap2XI-2.

[0021] A strain of Toxoplasma gondii attenuated virus, wherein the attenuated virus strain is constructed by the method for constructing the attenuated Toxoplasma gondii strain.

[0022] The use of the attenuated Toxoplasma gondii strain in the preparation of drugs for the prevention or treatment of Toxoplasma gondii infection.

[0023] A live attenuated Toxoplasma gondii vaccine, the vaccine comprising the attenuated Toxoplasma gondii strain.

[0024] The present invention achieves the following technical effects compared to the prior art:

[0025] This invention obtains a TgAP2XI-2 gene-deficient attenuated Toxoplasma gondii strain by knocking out the TgAP2XI-2 gene in Toxoplasma gondii. Compared with the wild strain, the TgAP2XI-2 gene-deficient attenuated Toxoplasma gondii strain loses its ability to form cysts, has significantly reduced pathogenicity, and exhibits no disease or death in infected mice, thus having high safety for the host.

[0026] Meanwhile, immunization of mice with a TgAP2XI-2 gene-deleted attenuated Toxoplasma gondii strain produced high levels of IgG antibodies and cytokines, providing significant immunoprotective efficacy against reinfection with high doses of Toxoplasma gondii RH, PYS tachyzoites, and Pru cysts. It can be used to prevent reinfection with Toxoplasma gondii and is an attenuated live vaccine with great application value. Attached Figure Description

[0027] Figure 1 These are effect diagrams of an embodiment of the present invention; wherein,

[0028] Figure A is a schematic diagram of the construction of the attenuated Toxoplasma gondii strain PruΔap2XI-2;

[0029] Figure B shows the PCR identification results of the PruΔap2XI-2 strain;

[0030] Among them, PCR1 and PCR3 represent the 5' and 3' integration of homologous fragments, respectively, and PCR2 represents whether the TgAP2XI-2 gene has been successfully replaced;

[0031] Figure C shows the phagocytic plaques of wild-type strains WT (Pru) and PruΔap2XI-2;

[0032] Figure D is a statistical chart of plaque area;

[0033] Figure E shows the survival time of mice under different worm attack doses;

[0034] Figure F shows the average body weight of mice in the immunized group and the control group;

[0035] Figure G is an indirect immunofluorescence image of the Toxoplasma gondii bradyzoite transformation assay;

[0036] Figure H is a statistical graph of bradyzoite conversion rate; scale bar: 2 μm;

[0037] Figure I shows the antibody levels of IgG, IgG1, and IgG2a in the serum of immunized mice and blank mice;

[0038] Figure J shows the serum levels of IL-2, IL-10, IL-12, and IFN-γ cytokines in immunized mice and blank mice;

[0039] Figure K shows the number of brain cysts in mice that survived chronic infection;

[0040] Figure L shows the survival rates of the immunized group and the control group after RH or PYS tachyzoite infection.

[0041] Figure M shows the survival rates of the immunized group and the control group after Pru ​​cyst infection;

[0042] "*" represents p<0.05, indicating a significant difference; "**" represents p<0.01, indicating a moderately significant difference; "***" represents p<0.001, indicating a highly significant difference; "****" represents p<0.0001, indicating an extremely significant difference. Detailed Implementation

[0043] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0044] Unless otherwise specified, the methods used in the embodiments and test examples of this invention are conventional methods.

[0045] The Toxoplasma gondii strain used in this invention is disclosed in (Fox BA, Falla A, Rommereim LM, Tomita T, Gigley JP, Mercier C, Cesbron-Delauw MF, Weiss LM, Bzik DJ. Type II Toxoplasmagondii KU80 knockout strains enable functional analysis of genes required for cyst development and latent infection. Eukaryot Cell. 2011 Sep; 10(9): 1193-206. doi: 10.1128 / EC.00297-10.).

[0046] This invention discloses a method for constructing a Toxoplasma gondii attenuated strain, which affects the intracellular proliferation and virulence of Toxoplasma gondii by knocking out the TgAP2XI-2 gene, thereby constructing a Toxoplasma gondii attenuated strain;

[0047] The nucleotide sequence of the TgAP2XI-2 gene is shown in SEQ ID NO.1.

[0048] The knockout of the TgAP2XI-2 gene was achieved using CRISPR-Cas9 technology.

[0049] The nucleotide sequence of the sgRNA used in the CRISPR / Cas9 system is shown in SEQ ID NO.2.

[0050] Includes the following steps:

[0051] (1) Construction of knockout plasmid: Replace UPRT in pSAG1-Cas9-SgUPRT with TgAP2XI-2, that is, construct plasmid pSAG1-Cas9-SgTgAP2XI-2;

[0052] Construct a homologous fragment DHFR containing TgAP2XI-2, and design 5' and 3' homologous arms primers before the start codon and after the stop codon of the TgAP2XI-2 gene.

[0053] Simultaneously, universal amplification primers for pUPRT-DHFR-D and pUC19 were designed and ligated.

[0054] Finally, the successfully sequenced DHFR plasmid was amplified.

[0055] (2) Construction of attenuated Toxoplasma gondii strain: The above-mentioned pSAG1-Cas9-SgTgAP2XI-2 knockout plasmid and the resistance fragment containing the AP2XI-2 homologous arm were electroporated into Toxoplasma gondii. After screening and identification, the attenuated Toxoplasma gondii strain was obtained and named PruΔap2XI-2.

[0056] The present invention also discloses a toxoplasmosis attenuated strain, which is constructed by a method for constructing a toxoplasmosis attenuated strain.

[0057] Application of attenuated strains of Toxoplasma gondii in the preparation of drugs for the prevention or treatment of Toxoplasma gondii infection.

[0058] The present invention also discloses a live attenuated Toxoplasma gondii vaccine, wherein the vaccine contains an attenuated Toxoplasma gondii strain.

[0059] Example 1:

[0060] (1) Construction of knockout plasmid:

[0061] sgRNA was designed based on the TgAP2XI-2 gene (TGGT1_310900) from the Toxoplasma gondii genome website ToxoDB, and its nucleotide sequence is shown in SEQ ID NO.2.

[0062] Using the Q5 site-directed mutagenesis kit, UPRT in pSAG1-Cas9-SgUPRT was replaced with TgAP2XI-2, thus constructing the plasmid pSAG1::Cas9::SgTgAP2XI-2.

[0063] To construct the TgAP2XI-2 homologous fragment DHFR, primers for 5' homologous arms and 3' homologous arms were designed with the start codon before the start codon and the stop codon after the stop codon of the AP2XI-2 gene.

[0064] The nucleotide sequence of the upstream primer of the 5' homologous arm primer is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.4.

[0065] The nucleotide sequence of the upstream primer of the 3' homologous arm primer is shown in SEQ ID NO.5, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.6.

[0066] Design amplification primers for DHFR and pUC19;

[0067] The nucleotide sequence of the upstream primer of the universal amplification primer for DHFR from the pUPRT-DHFR-D vector is shown in SEQ ID NO.7, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.8.

[0068] The nucleotide sequence of the upstream primer for pUC19 is shown in SEQ ID NO.9, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.10.

[0069] Connect using the ClonExpress® MultiS One Step Cloning Kit. The connection system is as follows:

[0070] dd 6.0 μL

[0071] TgAP2XI-2-U5 fragment (50 ng / mL) 2.0 μL

[0072] TgAP2XI-2-U3 fragment (50 ng / mL) 2.0 μL

[0073] PUC19 fragment (50 ng / mL) 2.0 μL

[0074] DHFR fragment (50 ng / mL) 2.0 μL

[0075] 5×CE MultiS Buffer 4.0 μL

[0076] Exnase MultiS 2.0 μL

[0077] Total volume 20 μL;

[0078] The ligation product was then transformed into DH5α competent cells. Finally, the successfully sequenced DHFR plasmid PUC19-TgAP2XI-2-DHFR was amplified, i.e., the homologous fragment DHFR was amplified. The nucleotide sequence of the upstream primer is shown in SEQ ID NO.11 above, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.12.

[0079] The amplification reaction system is as follows:

[0080] dd 18 μL

[0081] 2 × Phanta® Flash Master Mix 25 μL

[0082] SEQ ID NO.11 (10 μmol / L) 2.5 μL

[0083] SEQ ID NO.13 (10 μmol / L) 2.5 μL

[0084] Template PUC19-TgAP2XI-2-DHFR 2.0 μL

[0085] Total volume 50 μL

[0086] The reaction conditions were: 95 °C pre-denaturation for 3 min; 95 °C denaturation for 30 s, 56 °C annealing for 30 s, 72 °C extension for 3 min, for a total of 30 cycles; and finally 72 °C extension for 10 min.

[0087] SEQ ID NO.1: GCGAACCGTCTAGCCTCGAG

[0088] SEQ ID NO.2: GCGAACCGTCTAGCCTCGAGGTTTTAGAGCTAGAAATAGC;

[0089] SEQ ID NO.3: GGTTTTCCCAGTCACGACGTTACGTATAGAGCGGCGCTTGTCCGT;

[0090] SEQ ID NO.4: ATCGATACCGTCGACCTCGAGTAGACTCGAAGCGGAGGATTCTAACAC;

[0091] SEQ ID NO.5: CGCCCTATAGTGAGTCGTATTACATCTGTCTTCAGAAACATTATTCCC;

[0092] SEQ ID NO.6: GAGCGGATAACAATTTCACACACGCTAGCACAGTAGAACTTGGT;

[0093] SEQ ID NO.7: AAGCTTCGCCAGGCTGTAAATCC

[0094] SEQ ID NO.8: GAATTCATCCTGCAAGTGCATAG;

[0095] SEQ ID NO.9: TGTGAAATTGTTATCCGCTC;

[0096] SEQ ID NO.10: AACGTCGTGACTGGGAAAACC;

[0097] SEQ ID NO.11: ACGTATAGAGCGGCGCTTGTCCGT;

[0098] SEQ ID NO. 12: CGCTAGCACAGTAGAACTTGGT.

[0099] (2) Construction of the PruΔap2XI-2 strain:

[0100] HFF cells were seeded into 25T cell culture flasks, and 7 mL of DMEM medium containing 10% FBS was added. The cells were cultured in a CO2 incubator at 37°C. After the cells were fully confluent, the medium was replaced with 7 mL of DMEM medium containing 1% FBS, and 500 µL of the newly released Pru tachyzoites were added. The cells were cultured until they were fully released, and then the tachyzoites were collected and purified for electroporation of Toxoplasma gondii.

[0101] The pSAG1-Cas9-SgTgAP2XI-2 plasmid and the DHFR resistance fragment containing the TgAP2XI-2 homologous arm were transfected into Toxoplasma gondii via electroporation. After screening with pyrimethamine and limiting dilution in 96-well cell plates, monoclonal strains were obtained. After expansion culture, genomic DNA was extracted, and the 5' and 3' homologous arms of the AP2XI-2 gene and the DHFR open reading frame were amplified to verify whether the TgAP2XI-2 gene was knocked out.

[0102] The nucleotide sequences of the amplification primers are shown in SEQ ID NO.13 to SEQ ID NO.18.

[0103] SEQ ID NO.13 to SEQ ID NO.14 are the upstream and downstream primers for amplifying the 5' homologous arm, respectively; the reaction system is as follows:

[0104] dd 15 μL

[0105] 2× Phanta® Flash Master Mix25 μL

[0106] SEQ ID NO.13 (10 μmol / L) 2.5 μL

[0107] SEQ ID NO.14 (10 μmol / L) 2.5 μL

[0108] DNA template (50 ng / ul) 5.0 μL

[0109] Total volume 50 μL;

[0110] The reaction conditions were: 95 °C pre-denaturation for 3 min; 95 °C denaturation for 30 s, 56 °C annealing for 30 s, 72 °C extension for 2 min, for a total of 30 cycles; and finally 72 °C extension for 10 min.

[0111] SEQ ID NO.15 to SEQ ID NO.16 are the upstream and downstream primers for amplifying the 3' homologous arm, respectively;

[0112] The amplification reaction system is as follows:

[0113] dd 15 μL

[0114] 2 × Phanta® Flash Master Mix 25 μL

[0115] SEQ ID NO.15 (10 μmol / L) 2.5 μL

[0116] SEQ ID NO.16 (10 μmol / L) 2.5 μL

[0117] DNA template (50 ng / μL) 5.0 μL

[0118] Total volume 50 μL;

[0119] The reaction conditions were: 95 °C pre-denaturation for 3 min; 95 °C denaturation for 30 s, 56 °C annealing for 30 s, 72 °C extension for 2 min, for a total of 30 cycles; and finally 72 °C extension for 10 min.

[0120] SEQ ID NO.17~SEQ ID NO.18 are the upstream and downstream primers for amplifying the AP2XI-2 open reading frame, respectively.

[0121] The reaction system is as follows:

[0122] dd 15 μL

[0123] 2× Phanta® Flash Master Mix 25 μL

[0124] SEQ ID NO.17 (10 μmol / L) 2.5 μL

[0125] SEQ ID NO.18 (10 μmol / L) 2.5 μL

[0126] DNA template (50 ng / μL) 5.0 μL

[0127] Total volume 50 μL;

[0128] The reaction conditions were: 95 °C pre-denaturation for 3 min; 95 °C denaturation for 30 s, 56 °C annealing for 30 s, 72 °C extension for 1 min, for a total of 30 cycles; and finally 72 °C extension for 10 min.

[0129] SEQ ID NO.13: AGTGAAACGCGCCTTTGTCTG;

[0130] SEQ ID NO.14: GCCAAGTAGAAAGGAATTAGCAT;

[0131] SEQ ID NO.15: TGACGCAGATGTGCGTGTATCCAC;

[0132] SEQ ID NO.16: GTAGCCCGGTGGATTTCTCATCT;

[0133] SEQ ID NO.17: ATGGCTCCGGGCACTCCGGAAAGT;

[0134] SEQ ID NO.18: TTCGGCTCTGACGCCACGGAC;

[0135] PCR results showed that PCR1 and PCR3 had specific bands, while PCR2 had no specific band, confirming that TgAP2XI-2 had been knocked out.

[0136] test:

[0137] (1) Basic phenotypic analysis:

[0138] Tachyzoites transformation assay: Wild-type Pru and PruΔap2XI-2 strains that had completely escaped were taken from 25T cell flasks, counted, and diluted to a final concentration of 1×105 cells / mL. 100 μL of each strain was transferred to a small dish covered with HFF and cultured in normal medium for 4 h. Uninvaded tachyzoites were then washed away with preheated DMEM solution.

[0139] Change to medium with pH 8.2 and continue culturing for 3 days (change the medium daily to maintain high alkalinity). After 3 days of culture, discard the supernatant, add tissue fixative and fix for 30 min, wash 3 times with PBS solution, add 0.1% Triton X-100 and penetrate for 30 min.

[0140] Wash 3 times with PBS solution, add 1% BSA, and block for 60 min; wash 3 times with PBS solution, add rabbit anti-Toxoplasma gondii IMC1 monoclonal antibody (1:500) and mouse anti-Toxoplasma gondii BAG1 monoclonal antibody (1:500), and incubate overnight at 4°C;

[0141] Wash three times with PBS solution, add Alexa Fluor 594 goat anti-rabbit IgG (H+L), Alexa Fluor 647 goat anti-mouse IgG (H+L) and FITC-labeled Dolichos biflorus lectin (DBL) (1:330), and incubate at 37°C for 1 h;

[0142] Wash three times with PBS solution, add DPAI (1:1000) and incubate for 10 min, wash three times with PBS solution, retain 1 mL of PBS, and record and count the proportion of DBL positive spots under a fluorescence microscope.

[0143] Plaques: A small number of wild-type Pru and PruΔap2XI-2 worms that had completely escaped were inoculated from 25T cell flasks, counted, and their final concentration was brought to 10. 3200 μL of HFF was added to each well of a 12-well plate, and the tachyzoites were gently pipetted to distribute them evenly in the wells. Finally, the plate was placed in a cell culture incubator.

[0144] After culturing for 7 days, discard the supernatant and wash gently 3 times with PBS solution.

[0145] Add 1 mL of tissue fixative and fix for 30 min. Discard the supernatant and wash 3 times with PBS solution.

[0146] Add 1 mL of 0.25% crystal violet to each well and stain for 30 min. Discard the supernatant, wash 3 times with PBS solution, discard the remaining liquid, air dry, take pictures and observe, and calculate the size and number of insect spots.

[0147] (2) Preparation of live attenuated vaccine:

[0148] HFF cells were seeded into 25T cell culture flasks, and 8 mL of DMEM medium containing 10% FBS was added. The cells were cultured in a CO2 incubator at 37°C. After the cells were fully confluent, the medium was replaced with 8 mL of RPMI medium containing 1% FBS, and 100 µL of PruΔap2XI-2 insect strain was added. The cells were cultured in a CO2 incubator at 37°C until the insects escaped from the cells, and the PruΔap2XI-2 tachyzoites were collected.

[0149] The collected worm suspension was filtered through a 3 µm filter to remove cell debris, and then the tachyzoite concentration was adjusted to 10 with sterile PBS. 4 A live attenuated vaccine was prepared by using 100 µL of 100 µL.

[0150] (3) Mouse toxicity test:

[0151] Before inoculation, the purchased female Kunming mice were housed for one week to reduce stress. Two groups were established: wild-type and knockout strains, and each group was intraperitoneally injected with 2×10⁻⁶ mmol / L. 4 Each / item and 2×10 5 Two dosages per unit / piece.

[0152] Among them, 2×10 4 Each group of 15 mice was injected with 2 × 10⁸ doses. 4 Ten mice were injected per group.

[0153] The survival and weight gain of the mice were observed, and the surviving mice were euthanized after 30 days, and the cysts in the brain tissue were counted.

[0154] (4) Immunization of mice:

[0155] Mice were divided into two groups: an immunization group and an intraperitoneal injection of 200 µL (2 × 10⁶) of immunization into each mouse.4 (1) PruΔap2XI-2 tachyzoites;

[0156] The other group served as the control group: each mouse was injected intraperitoneally with 200 µL of sterile PBS.

[0157] (4) Evaluation of immune response:

[0158] Acute Toxoplasma gondii infection group: On day 45 post-immunization, 8 Kunming rats from the PruΔap2XI-2 immunization group and the blank control group were collected. A small amount of completely released wild-type RH and PYS tachyzoites were collected from 25T cell flasks and counted using a hemocytometer to dilute the final concentration to 1×10⁻⁶. 4 200 μL of tachyzoites per mL were injected intraperitoneally into mice. The health status of the mice was observed daily after infection, and their survival time was recorded.

[0159] On day 30 post-infection, surviving mice were euthanized.

[0160] Chronic Toxoplasma gondii infection group: On day 45 after immunization, 12 PruΔap2XI-2 immunized mice and blank control group Kunming mice were orally infected with 30 type II PRU cysts. The health status of the mice was observed daily after the challenge and their survival time was recorded.

[0161] On day 30 after infection with PRU cysts, surviving mice were euthanized and the number of cysts in their brain tissue was examined.

[0162] (5) Evaluation of immunization efficacy:

[0163] Antibody monitoring between different groups: Serum from 6 immunized mice and blank mice was collected on day 45 after immunization to detect the levels of IgG antibodies and IgG1 and IgG2a antibody subclasses.

[0164] Cytokine monitoring between different groups: Serum from 6 immunized mice and blank mice was collected on day 45 after immunization to detect the levels of IL-2, IL-10, IL-12 and IFN-γ.

[0165] result:

[0166] (1) Basic phenotypic analysis:

[0167] ① Plaque test: The results of the plaque test are shown in Figure C. As can be seen from Figure C, the plaques formed by PruΔap2XI-2 are significantly smaller and fewer than those formed by wild Pru, and PruΔap2XI-2 can hardly form plaques.

[0168] ② Toxoplasma gondii bradyzoite transformation experiment: The results of the Toxoplasma gondii bradyzoite transformation experiment are shown in Figures G and H. As can be seen from Figures G and H, the deletion of TgAP2XI-2 prevents Toxoplasma gondii from forming cysts after in vitro alkaline induction.

[0169] (2) Toxoplasma gondii virulence test:

[0170] The virulence test results of wild-type Pru strain and PruΔap2XI-2 strain of Toxoplasma gondii are shown in Figures E and F. Figures E and F show that 2 × 10⁻⁶ tachyzoites... 4 At a dose of 1 per mouse, only 30% of the mice in the Pru group survived;

[0171] 2×10 5 At the dose of one mouse per mouse, all mice in the Pru group died; at both doses, no mice infected with PruΔap2XI-2 tachyzoites died, no brain cysts were detected in the mouse brain tissue, and the average body weight steadily increased in the first 30 days.

[0172] The survival time of mice infected with PruΔap2XI-2 tachyzoites was significantly different from that of the control group (p < 0.0001), indicating that the virulence of the PruΔap2XI-2 strain was lost.

[0173] (3) Acute infection test of Toxoplasma gondii RH and PYS strains:

[0174] The results of acute infection experiments with Toxoplasma gondii RH and PYS strains are shown in Figure L. As can be seen from Figure L, all mice in the control group died within 10 days after infection with RH or PYS tachyzoites, while the PruΔap2XI-2 immunized group died within 10 days. 3 No deaths occurred after RH or PYS tachyzoites were detected, and the survival time of mice infected with PruΔap2XI-2 tachyzoites was significantly different from that of the control group (p < 0.0001), indicating that the PruΔap2XI-2 strain can effectively resist acute reinfection with RH and PYS.

[0175] (4) Chronic infection test of Toxoplasma gondii Pru cysts:

[0176] The results of the chronic toxoplasmosis infection experiment are shown in Figure M. As can be seen from Figure M, the mice in the control group began to develop the disease and some died 14 days after infection, with a survival rate of 58.3%, while the mice immunized with PruΔap2XI-2 did not develop the disease or die (p<0.05).

[0177] The number of brain cysts in surviving mice was counted, and the results are shown in Figure K. The number of brain cysts in mice immunized with PruΔap2XI-2 was significantly different from that in mice in the blank control group (p < 0.0001).

[0178] (5) Evaluate the immune response induced by PruΔap2XI-2:

[0179] Serum from immunized mice was collected on day 45 post-immunization to detect levels of anti-Toxoplasma gondii IgG, IgG1, and IgG2a antibodies, as well as levels of IL-2, IL-10, IL-12, and IFN-γ cytokines.

[0180] As shown in Figure I, the IgG1 level of mice in the PruΔap2XI-2 immunized group was significantly different from that of the blank mice (p<0.01), and the IgG and IgG2a levels were extremely significantly different (p<0.001).

[0181] As shown in Figure J, among the detected cytokines, IFN-γ showed a highly significant increase in the immune group (p < 0.0001), IL-10 showed a moderately significant change (p < 0.001), and IL-2 and IL-12 showed significant changes (p < 0.01).

[0182] This result indicates that immunization with PruΔap2XI-2 can effectively induce humoral immune responses against Toxoplasma gondii in mice, while also exhibiting a Th1-type cellular immune response. This immune pattern is a key immune type for resisting Toxoplasma gondii infection, consistent with the previously observed results that PruΔap2XI-2 can provide effective immune protection.

[0183] The above description is merely a preferred embodiment of the present invention and does not constitute any limitation on the technical scope of the present invention. Therefore, any minor modifications, equivalent changes, and alterations made to the above embodiments based on the technical essence of the present invention shall still fall within the scope of the technical solution of the present invention.

Claims

1. A method for constructing a attenuated strain of Toxoplasma gondii, characterized in that, By knocking out the TgAP2XI-2 gene of Toxoplasma gondii, the intracellular proliferation and virulence of Toxoplasma gondii were affected, thereby constructing a attenuated strain of Toxoplasma gondii. The nucleotide sequence of the TgAP2XI-2 gene is shown in SEQ ID NO.

1.

2. The method for constructing a attenuated strain of Toxoplasma gondii according to claim 1, characterized in that, The TgAP2XI-2 gene knockout was achieved using CRISPR-Cas9 technology.

3. The method for constructing a attenuated strain of Toxoplasma gondii according to claim 2, characterized in that, The nucleotide sequence of the sgRNA used in the CRISPR / Cas9 system is shown in SEQ ID NO.

2.

4. The method for constructing a attenuated strain of Toxoplasma gondii according to claim 1, characterized in that, Includes the following steps: (1) Construction of knockout plasmid: Replace UPRT in pSAG1-Cas9-SgUPRT with TgAP2XI-2, that is, construct plasmid pSAG1-Cas9-SgTgAP2XI-2; Construct a homologous fragment DHFR containing TgAP2XI-2, and design 5' and 3' homologous arms primers before the start codon and after the stop codon of the TgAP2XI-2 gene. Simultaneously, universal amplification primers for pUPRT-DHFR-D and pUC19 were designed and ligated. Finally, the successfully sequenced DHFR plasmid was amplified. (2) Construction of attenuated Toxoplasma gondii strain: The above-mentioned pSAG1-Cas9-SgTgAP2XI-2 knockout plasmid and the resistance fragment containing the AP2XI-2 homologous arm were electroporated into Toxoplasma gondii. After screening and identification, the attenuated Toxoplasma gondii strain was obtained and named PruΔap2XI-2.

5. A strain of Toxoplasma gondii with attenuated virulence, characterized in that, The attenuated strain is constructed using the method for constructing an attenuated Toxoplasma gondii strain according to any one of claims 1-4.

6. The use of the attenuated Toxoplasma gondii strain according to claim 5 in the preparation of a medicament for the prevention or treatment of Toxoplasma gondii infection.

7. A live attenuated Toxoplasma gondii vaccine, characterized in that, The vaccine contains the attenuated Toxoplasma gondii strain as described in claim 5.

Images