A method for screening a homozygous gene back-supplementation strain of ceriporiopsis subvermispora

Abstract

The present application belongs to the field of fungal genetic engineering and molecular biology technology, and discloses a method for screening homozygous gene back-supplementation strains of Ceratocystis subrufa. The method comprises the following steps: constructing a gene knockout mutant strain, obtaining a back-supplementation transformant, and carrying out single spore separation culture for at least two rounds. After each round of separation, double identification is carried out through PCR and phenotype determination. The strain that passes the two times of purification and verification is the homozygous gene back-supplementation strain. The present application proposes a three-stage purification scheme of "single spore separation-resistant medium screening-PCR molecular verification" to solve the problems that the back-supplementation transformant is prone to inlaying nucleus and the homozygote is difficult to obtain in the prior art. The present application significantly improves the screening efficiency and preservation stability of the homozygous back-supplementation strain, and provides reliable technical support for the gene function research of Ceratocystis subrufa.

Description

Technical Field

[0001] This invention belongs to the field of fungal genetic engineering and molecular biology technology, and specifically relates to a method for screening homozygous gene-complementary strains of *Euphorbia milii*. Background Technology

[0002] Strange long-beaked shell fungus ( Ceratocystis paradoxa *Leptochrysis galbana*, belonging to the phylum Ascomycota, class Ascomycetes, order Hypocreales, family Lepidaceae, and genus *Leptochrysis*, is a plant pathogenic fungus of significant research value. Currently, the gene knockout and gene complementation technology for this fungus is not yet mature, severely hindering the systematic analysis of its gene function. Experimental studies have revealed that complementation transformants obtained through protoplast transformation generally exhibit nucleolysis, meaning that the same hyphae contain both the complement strain and the background strain's nuclei. Using conventional preservation methods, these chimeric strains are susceptible to interference from background strains, leading to the invalidation of subsequent gene function experiments. Therefore, there is an urgent need to establish a method for efficiently screening homozygous gene complementation strains to ensure the accuracy and reproducibility of *Leptochrysis galbana* gene function studies. Summary of the Invention

[0003] In view of the deficiencies in the prior art, the present invention proposes a method for screening strains of *Euphorbia pekinensis* with homozygous gene complementation.

[0004] The technical solution adopted in this invention: This invention discloses a method for screening homozygous gene complementation strains of *Bacillus simulans*, comprising the following steps: (1) Constructing the target gene knockout mutant strain; (2) Using the knockout mutant as the recipient, construct the complementation vector, transform the complementation vector, and obtain the complementation transformants by screening; (3) Perform at least two rounds of single-spore isolation culture on the complemented transformants. After each round of single-spore isolation, verify the results by PCR molecular detection and / or phenotypic determination to screen homozygous complemented strains.

[0005] Further, the construction of the knockout mutant in step (1) includes: constructing a knockout expression cassette containing an upstream homologous arm, a hygromycin B resistance marker, and a downstream homologous arm by SOE-PCR, transforming it into protoplasts, and obtaining it by hygromycin B screening and PCR identification.

[0006] Further, the construction process of the complement vector in step (2) is as follows: amplify the complement fragment containing the endogenous promoter region and the complete target gene, clone it into the linearized pKNTG vector, and obtain the recombinant plasmid, i.e., the complement vector.

[0007] Preferably, in step (2), the screening of the reintroduced transformants uses the G418 resistance marker, the final concentration of G418 in the regeneration medium is 160 μg / mL, and the final concentration of G418 in the screening medium is 300 μg / mL.

[0008] Further, the single-spore isolation culture described in step (3) includes: collecting the spores of the reintroduced transformants, preparing a spore suspension, diluting it in a gradient and spreading it on a resistance plate, picking a single colony for culture, wherein the resistance plate is a resistance plate containing G418.

[0009] Furthermore, the spore suspension was serially diluted to 10-1 -1 ~10 -3 The coating and incubation time was 48 hours, and the incubation temperature was 25℃. Compared with the prior art, the present invention has the following beneficial effects: (1) A complete gene knockout and complementation technology system for *Trichoderma micranthum* was established for the first time. This invention utilizes SOE-PCR technology to construct knockout expression cassettes and optimize protoplast preparation and transformation conditions. It is the first to achieve full-process technical coverage from gene knockout to gene replenishment in *Euphorbia milii*, filling a gap in the genetic manipulation system of this bacterium and laying a methodological foundation for subsequent gene function research.

[0010] (2) A three-level purification scheme of “single spore isolation - resistance screening - PCR verification” was established to significantly reduce nucleoside contamination of the strain and improve the genetic purity of the strain.

[0011] To address the common nucleolysis phenomenon in complemented transformants, this invention designs a purification process combining at least two rounds of single-spore isolation and resistance screening. Each round undergoes dual verification through PCR molecular detection and biological phenotypic determination. This approach effectively eliminates interference from background strains and significantly increases the probability of obtaining homozygous complemented strains with matching genotypes and phenotypes.

[0012] (3) Significantly improves the screening efficiency and preservation stability of homozygous complement strains. Traditional methods often fail to achieve functional assays for recovered strains due to chimeric interference. This invention, through a rigorous purification and validation process, significantly improves the success rate of homozygous screening. Figure 3 As shown, the homozygous complement strains screened by this method still exhibited stable phenotypes after 2 months under conventional storage conditions, demonstrating the long-term preservation stability of the strain and ensuring the accuracy and reproducibility of subsequent gene function experiments. Attached Figure Description

[0013] Figure 1The diagram shows the SOE-PCR knockout of the CpMK1 gene. (a) SOE-PCR knockout gene model diagram, (b) verification of gene knockout mutants and complement strains using primers In-F and In-R, and (c) verification of gene knockout mutants and complement strains using Out-F and HY / R.

[0014] Figure 2 This is a schematic diagram illustrating the phenotypic determination of gene knockout mutants and complement strains. Blank is the blank control, inoculated only with sterile agar blocks; X-3314 is the wild type; Δ CpMK1 -13 and Δ CpMK1 -20 represents a gene knockout mutant, Δ CpMK1 -Com is a gene-complementation strain.

[0015] Figure 3 The diagram shows the phenotypic stability test results. (a) is the result of inoculation on April 2, 2026, and (b) is the result of inoculation on June 5, 2026. This shows that the phenotype of the single-spore isolated bacteria remained very stable after two months of conventional storage. Detailed Implementation

[0016] The technical solutions of the embodiments of this application will be further clearly and completely described below with reference to the accompanying drawings. It should be noted that the described embodiments are only a part of the embodiments of this application, and not all of the embodiments. Based on the embodiments of this application, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this application.

[0017] Example 1: A method for screening homozygous gene complementation strains of *Bacillus simulans*. 1.1 Gene Knockout Box Construction (1) PCR was used to amplify the upstream and downstream homologous arm fragments of the target gene, with the fragment length controlled between 800 and 1200 bp; (2) PCR amplification of the full-length fragment of the hygromycin B resistance marker; (3) The upstream homologous arm, hygromycin B marker gene and downstream homologous arm are sequentially fused by SOE-PCR technology, and the splicing product is the target gene knockout expression cassette.

[0018] 1.2 Protoplast Preparation (1) Activation of strains: The strains were activated by culturing *Trichoderma micranthum* at 25°C for 48 h on PDA medium.

[0019] (2) Fresh mycelial culture: Add 10 mL of sterile water to a petri dish, scrape mycelia and spores from a sterile glass slide, filter through a Miracloth filter cloth to prepare a spore suspension and collect it into a 50 mL centrifuge tube; adjust the concentration of the spore suspension to 1×10⁻⁶.7 6 mL of spores were inoculated into 400 mL of SYM liquid medium and cultured on a shaker at 180 rpm and 28°C for 24 h. Mycelia were filtered out using Miracloth filter cloth and residual moisture on the surface of the mycelia was absorbed by sterile filter paper.

[0020] (3) Mycelial enzymatic hydrolysis: The mycelium was enzymatically hydrolyzed with 1% Driselase solution and kept at a constant temperature of 90 rpm and 31℃ for 4 h in a shaker.

[0021] (4) Protoplast purification and concentration determination: The enzymatic digest mixture was filtered through a Miracloth filter, and the filtrate was centrifuged at 4℃ and 5000 rpm for 10 min. The supernatant was discarded to obtain protoplast precipitate. The precipitate was resuspended in 20 mL of STC buffer and washed again by centrifugation. The washing was repeated twice. An appropriate amount of STC buffer was added to adjust the final concentration of protoplasts to 6.0 × 10⁻⁶. 7 ~3.0×10 8 per mL.

[0022] 1.3 Protoplast Transformation (1) Take 200 μL of protoplast suspension, mix in 20 μL of knockout cassette DNA with a concentration of >100 ng / μL, and incubate on ice for 30 min; add 1 mL of PTC solution dropwise and mix thoroughly, continue incubation on ice for 30 min; then add 6 mL of TB3 liquid culture medium, and incubate at 90 rpm and 25℃ in the dark for revival culture, with a revival time ≤12 h.

[0023] (2) Prepare 100 mL of sterile TB3 solid culture medium, add 80 μL of 50 mg / mL hygromycin B stock solution, mix with the revived protoplasts, and divide into 3 15 cm sterile culture plates.

[0024] (3) After incubation at 25℃ for 30 h, resistant transformants were picked and transferred to PDA solid medium containing screening antibiotics (100 mL PDA with 160 μL hygromycin B stock solution) for continuous screening.

[0025] 1.4 Validation of Knockout Mutants PCR amplification was performed using primers specific to the ORF of the target gene and primers on the flanking sides of the upstream of the target gene, combined with primers specific to the hygromycin resistance gene, to complete the molecular identification of positive knockout mutants. Statistical analysis showed that 48 hygromycin B resistant transformants were obtained in three independent transformation experiments. After double PCR identification, 3 positive knockout mutants were found, with a homologous recombination knockout rate of 6.25%. This knockout efficiency is comparable to the reported knockout efficiency (5%–15%) of PEG-mediated protoplast transformation in filamentous fungi. Among them, Δ CpMK1 -13 and Δ CpMK1 -20 was selected for subsequent phenotypic validation, and Δ CpMK1 -13 was used as the recipient strain in the subsequent complementation experiment. Two primer pairs were used to verify the gene knockout mutant and the complementation strain: the gene ORF primers In-F and In-R, and the upstream flanking primers paired with the hygromycin resistance gene-specific primers Out-F and HY / R. The results are as follows: Figure 1 As shown, the primers are as follows: In-F: TGCCCTTCAAGAAGAAGGTG (SEQ ID NO. 1); In-R: GGTCAGGTTGTCCTTGTGCT (SEQ ID NO. 2); Out-F: CAGCCCAAGTCAGACAAAAG (SEQ ID NO.3); HY / R: GTATTGACCGATTCCTTGCGGTCCGAA (SEQ ID NO. 4).

[0026] 2. Construction and transformation of replenishment carriers 2.1 Construction of the replenishment carrier The 2000 bp sequence upstream of the start codon of the target gene was selected as the endogenous promoter region. Upstream and downstream amplification primers were designed respectively. The forward primer introduced the vector homologous sequence AGGGAACAAAAGCTGGGTACC (SEQ ID NO.5) at the 5' end, and the reverse primer introduced the homologous sequence GCCCTTGCTCACCATAAGCTT (SEQ ID NO.6) at the 5' end. The complement fragment containing the endogenous promoter and the complete target gene was amplified by PCR, and the fragment was recovered by gel excision after agarose gel electrophoresis.

[0027] The pKNTG vector was linearized by double digestion with KpnⅠ and HindⅢ, and the linear vector was ligated to the target fragment using a full-length gold seamless cloning kit. After transformation of the ligation product, single clones were picked, and the sequence was verified by sequencing before the recombinant plasmid was extracted for later use.

[0028] 2.2 Protoplast Preparation Using the aforementioned target gene knockout mutant strain as the transformation recipient, the enzymatic digestion, purification, and concentration adjustment of protoplasts were performed in the same manner as the knockout system preparation method.

[0029] 2.3 Protoplast Transformation The transformation system, operation steps, and culture conditions follow the aforementioned protoplast transformation scheme; the formulation of the resistance screening medium is adjusted as follows: regenerated TB3 medium: 100 mL TB3 with 160 μL 100 mg / mL G418 added; transfer screening PDA medium: 100 mL PDA with 300 μL 100 mg / mL G418 added.

[0030] 2.4 Identification of Supplementary Strains PCR molecular detection was performed using primers specific to the ORF of the target gene, and biological phenotypic determination was carried out simultaneously. Transformants that were PCR positive and could recover the defective phenotype of the knockout mutant were identified as positive complement strains. A total of 10 positive complement strains were obtained, and the transformants with clear PCR bands and the best phenotypic recovery were selected. CpMK1 -Com was used as the starting strain for subsequent purification experiments.

[0031] Purification of 3 complement strains (1) Primary spore preparation The original plates of the positive transformed spores were incubated at 25°C for 5 days. 10 mL of sterile water was added to the plates, and hyphae and spores were scraped off with a sterile glass slide. The spore suspension was collected by filtering through Miracloth filter cloth and transferred to a 50 mL centrifuge tube.

[0032] (2) First-order gradient dilution Add 50 μL of spore stock solution to 450 μL of sterile water to prepare 10 -1 Gradient spore dilutions.

[0033] (3) First round of single-spore coating screening Take 50 μL of 10 -1 The spore dilution was evenly spread on PDA-resistant plates with a diameter of 9 cm containing 300 μg / mLG418 and incubated at 25°C for 48 h until 1-2 single colonies grew on the plate.

[0034] (4) Primary purification and identification The above single colonies were transferred to fresh G418-PDA medium of the same concentration, and the authenticity was verified by PCR molecular detection combined with strain phenotypic determination.

[0035] (5) Secondary spore collection and gradient dilution The first-generation validated strain was cultured at 25℃ for 5 days, and the spore suspension was prepared again according to step (1); the spore suspension was then serially diluted: 50 μL of the 10-spore suspension was taken. -1 Prepare 10 by adding diluent + 450 μL sterile water -2 Diluent, take another 50 μL of 10 -2 Prepare 10 by adding diluent + 450 μL sterile water -3 Diluent.

[0036] (6) Second-round coating purification and final validation Take 50 μL of 10 -3The spore dilution was spread onto G418 resistant PDA plates of the same size and incubated at 25°C for 48 h to obtain single colonies. After transfer and purification, PCR and phenotypic identification were performed again.

[0037] (7) Strain determination like Figure 2 As shown, Δ CpMK1 The phenotype of the -Com (complementary strain) partially restored the pathogenicity defects of the gene knockout mutant, further verifying that the transformant was a functional complementary strain. Strains that passed both single-spore isolation and molecular and phenotypic identification tests are considered homozygous complementary strains and can be used for subsequent gene function experiments.

[0038] After re-preparing the homozygous complement strain according to the method described above, its preservation stability was tested. The homozygous complement strain was inoculated into PDA medium and incubated at 25°C. On April 2, 2026 (…),… Figure 3 (a) and June 5, 2026 ( Figure 3 (b) Phenotypic observation and photographic recording were conducted. Qualitative observation results showed that, under conventional storage conditions (4℃ slant culture), after 2 months, the phenotypic indicators of the homozygous supplementary strain, such as colony morphology, mycelial color, growth rate, and sporulation characteristics, did not change significantly and remained consistent with the initial phenotype 2 months prior. Figure 3 (a) and Figure 3 (b) Comparison shows that the homozygous complement strains screened by this method have good phenotypic stability under normal storage conditions.

[0039] Obviously, those skilled in the art can make various modifications and variations to this application without departing from the spirit and scope of this application. Therefore, if such modifications and variations fall within the scope of the claims of this application and their equivalents, this application also intends to include such modifications and variations.

Claims

1. A method for screening strains of *Evodia rutaecarpa* with homozygous gene complementation, characterized in that, Includes the following steps: (1) Constructing the target gene knockout mutant strain; (2) Using the knockout mutant as the recipient, construct the complementation vector, transform the complementation vector, and obtain the complementation transformants by screening; (3) Perform at least two rounds of single-spore isolation culture on the complemented transformants. After each round of single-spore isolation, verify the results by PCR molecular detection and / or phenotypic determination to screen homozygous complemented strains.

2. The method according to claim 1, characterized in that, The construction of the knockout mutant in step (1) includes: constructing a knockout expression cassette containing an upstream homologous arm, a hygromycin B resistance marker, and a downstream homologous arm by SOE-PCR, transforming it into protoplasts, and obtaining it by hygromycin B screening and PCR identification.

3. The method according to claim 1, characterized in that, The process of constructing the complement vector in step (2) is as follows: amplify the complement fragment containing the endogenous promoter region and the complete target gene, clone it into the linearized pKNTG vector, and obtain the recombinant plasmid, i.e., the complement vector.

4. The method according to claim 1, characterized in that, In step (2), the screening of the reintroduced transformants used the G418 resistance marker. The final concentration of G418 in the regeneration medium was 160 μg / mL, and the final concentration of G418 in the screening medium was 300 μg / mL.

5. The method according to claim 1, characterized in that, The single-spore isolation culture described in step (3) includes: collecting spores of the reintroduced transformants, preparing a spore suspension, serially diluting it and spreading it on a resistance plate, picking a single colony for culture, wherein the resistance plate is a resistance plate containing G418.

6. The method according to claim 2, characterized in that, spore suspension serially diluted to 10 -1 ~10 -3 The coating culture time was 48 hours, and the culture temperature was 25℃.

Images