Ghf16 gene for simultaneously regulating cotton fiber length, strength and fineness and application thereof

Abstract

The application discloses a Kay-like zone membrane domain protein coding gene for simultaneously regulating cotton fiber length, strength and fineness GhF16 and application thereof, and belongs to the technical field of biotechnology. GhF16 The cDNA sequence of tetraploid Gossypium hirsutum TM-1 is shown as SEQ ID NO. 1. GhF16 The application successfully constructs a gene overexpression vector and creates an overexpression material of the gene by means of transgenic technology. GhF16 It is found through detection on mature cotton fiber quality traits and fiber phenotype that overexpression of the gene can regulate cotton fiber elongation and cell wall development, and thus transgenic cotton with improved mature fiber length, strength and fineness is obtained. GhF16 The application provides a new gene and germplasm resource for cotton fiber quality improvement, and lays a technical foundation for production and application of high-quality cotton fiber.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology applications, specifically relating to plant genetic engineering breeding technology, and particularly to a protein-coding gene of the Casparian band family in cotton. GhF16 Its application in regulating cotton fiber length, strength, and fineness, and its breeding methods. Background Technology

[0002] cotton( Gossypium Cotton (spp.) is an important economic crop, occupying a vital position in the textile industry and international trade system. Cotton fiber is the most important harvested product of cotton and a core raw material for the textile industry. Fiber quality is typically evaluated by a comprehensive assessment of indicators such as length, breaking strength, and micronaire value. Among these, long fibers and high strength are core high-quality traits in the textile industry, directly improving yarn quality and expanding the application scenarios of textiles. A lower micronaire value usually corresponds to finer fibers, moderate maturity, and better softness, and is an important quality indicator for high-end textiles. With the continuous upgrading of the downstream industrial chain, the market is placing more stringent standards on cotton fiber quality, making the improvement of fiber quality in existing cultivated varieties urgent. Therefore, a systematic analysis of the physiological regulatory mechanisms and molecular basis of cotton fiber development can provide theoretical support and breeding resources for cotton quality improvement and molecular design breeding.

[0003] Casparian Strip Membrane Proteins (CASPs) are a class of transmembrane proteins that play important regulatory roles in plant growth and development. In Arabidopsis research, AtCASPs It plays a crucial role in guiding the modification of the cell wall adjacent to its membrane domain, mediating lignin deposition and the formation of the Casparian strip, the root barrier. CASP-like proteins (CASPLs) are homologous to CASPs but have a broader expression range, not limited to Casparian strip-forming cells, exhibiting diverse tissue expression patterns. Arabidopsis expression profiling analysis shows that different... AtCASPL The gene is specifically expressed in various cell types, including the trichome, abscission zone, root cap, and xylem periphery, suggesting its potential involvement in multiple cellular processes beyond Casparian strip formation. Current research indicates that members of the CASPL family are primarily involved in plant stress responses and cell wall-related processes. For example, the watermelon CASPL gene... ClCASPL It can be induced by low-temperature stress, and its function is related to the regulation of plant cold tolerance. In maize... ZmCASPL2B2These genes participate in the formation of leaf epidermal waxes, and changes in their expression can alter the plant's tolerance to drought and salt stress. In contrast, research on the function of the CASPL family genes in cotton remains limited, and their biological functions during cotton fiber development and their regulatory mechanisms on fiber quality formation have not been systematically elucidated. In particular, whether CASPL family genes participate in key developmental processes such as cotton fiber elongation and cell wall formation, and further influence comprehensive quality traits such as fiber length and strength, requires further investigation. Therefore, providing a functional CASPL family gene that can serve as a target for improving the overall quality of cotton fibers is of significant practical importance for cotton molecular breeding. Summary of the Invention

[0004] This invention provides a gene that simultaneously regulates the associations of cotton fiber length, strength, and fineness traits. GhF16 Its application, through regulation GhF16 Gene expression regulates cotton fiber elongation and cell wall development, providing molecular breeding targets for the comprehensive improvement of cotton fiber quality, including length, strength, and fineness.

[0005] One of the objectives of this invention is to provide GhF16 The application of genes in improving cotton fiber quality, the GhF16 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the improvement of cotton fiber quality specifically refers to improving the length, strength and fineness of cotton fibers.

[0006] Another object of the present invention is to provide a product containing GhF16 The application of recombinant gene expression vectors or recombinant bacteria in improving cotton fiber length, strength, and fineness. GhF16 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0007] Another object of the present invention is to provide a method for improving the quality of cotton fibers.

[0008] The method described in this invention is as follows: Overexpression in cotton GhF16 Genes that improve the quality of cotton fibers. The overexpression of [a gene] in cotton fibers. GhF16 The specific method of gene generation is: constructing a gene containing GhF16 Gene recombinant vectors or recombinant bacteria are used to transform these genes into cotton, resulting in... GhF16 Overexpression cotton lines. The fibers of the overexpression cotton lines contain the overexpression... GhF16 The gene sequence is SEQ ID NO.1.

[0009] Furthermore, the construction contains GhF16 The primers used for the gene recombinant vector or recombinant bacteria are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0010] The present invention provides a method for detecting the quality of cotton fibers, by detecting the content of cotton fibers in cotton fibers. GhF16 Gene expression levels; the detection method used is qPCR; the qPCR detection of cotton... GhF16 The primers used to measure gene expression are shown in SEQ ID NO.5 and SEQ ID NO.6.

[0011] Another object of the present invention is to provide a kit for detecting cotton fiber quality, comprising a reagent for detecting... GhF16 qPCR primer pairs for gene expression levels, the nucleotide sequences of which are shown in SEQ ID NO.5 and SEQ ID NO.6.

[0012] Compared with the prior art, the beneficial effects of the present invention are as follows: 1. GhF16 The expression levels of this gene in different tissues and developmental stages of cotton were analyzed by transcriptome sequencing. The gene was predominantly expressed in ovules 3 and 1 days before flowering, and in ovules 1, 3, 5, 10, 20, and 25 days after flowering, as well as in fibers, indicating that this gene is highly likely involved in cotton fiber development and quality formation.

[0013] 2. This invention is first described GhF16 This study investigates the molecular functions of genes involved in regulating the overall quality of cotton fibers, filling a gap in current research on this area. Through overexpression... GhF16 The cotton fibers are longer, stronger, and finer, thus optimizing the fiber textile processing characteristics. The study established a complete technical process from gene cloning, vector construction, genetic transformation to detection methods, which can be directly applied to cotton molecular breeding. The genetic modification method of this gene does not introduce exogenous proteins, but only regulates the expression of endogenous genes, resulting in excellent biosafety.

[0014] 3. This invention utilizes genetic engineering techniques to create... GhF16 Several overexpression materials (such as recombinant expression vectors, host cells, and transgenic plants); experiments confirmed that overexpression in cotton... GhF16 It can effectively improve fiber quality and achieve the breeding goal of synergistic improvement of multiple fiber traits. Attached Figure Description

[0015] Figure 1 As described in the embodiments of the present invention GhF16 Expression analysis diagram in different tissues and developmental stages of cotton; Figure 2 As described in the embodiments of the present invention GhF16 Structural diagram of the transgenic cotton overexpression vector RDL-pBI121; Figure 3As described in the embodiments of the present invention GhF16 Figure showing the relative gene expression levels in overexpressing transgenic cotton lines; Figure 4 As described in the embodiments of the present invention GhF16 Diagrams showing the mature fiber quality traits of overexpressed transgenic cotton; where Figure A represents wild-type cotton. GhF16 Overexpression of mature cotton fiber phenotype, Figure B shows wild-type cotton, GhF16 Overexpression of the upper half fiber length of mature cotton fibers, Figure C represents wild-type cotton, GhF16 Statistical analysis of the breaking ratio strength of mature cotton fibers overexpressed; Figure D represents wild-type cotton. GhF16 Statistics on the micronaire value (fineness) of overexpressed mature cotton fibers; Figure 5 As described in the embodiments of the present invention GhF16 The mature fiber phenotype of transgenic cotton overexpression; where Figure A shows wild-type cotton. GhF16 Overexpression of cotton mature fiber microfibrils in a pictographic table, Figure B shows wild-type cotton, GhF16 Overexpression of the helix number phenotype of mature cotton fibers, Figure C represents wild-type cotton, GhF16 The statistical count of the number of mature fibers per 1 mm in cotton overexpression is shown in Figure D, which represents wild-type cotton. GhF16 Overexpression of mechanical properties of mature cotton fibers was measured. Figure E shows wild-type cotton. GhF16 Overexpression of mature cotton fiber cell wall phenotype, Figure F shows wild-type cotton, GhF16 Statistical analysis of cell wall thickness in mature cotton fibers overexpressed. Detailed Implementation

[0016] The following description, in conjunction with the accompanying drawings and embodiments, provides further details. The examples given are for illustrative purposes only and are not intended to limit the scope of the invention.

[0017] Unless otherwise specified, the methods used in the following embodiments are conventional methods.

[0018] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0019] In the following examples, the cotton variety is upland cotton cultivar WO, and this biological material is available to the public through common means.

[0020] Example 1 GhF16 Analysis of gene expression levels in different tissues and developmental stages of cotton.

[0021] This invention collected RNA samples from different tissues and developmental stages of the cotton TM-1 variety for transcriptome sequencing. Sample materials included cotton seeds, roots, stems, leaves, ovules at -3 and -1 days before flowering, ovules at 1, 3, 5, 10, 20, and 25 days after flowering (day post-anthesis, DPA), and fiber tissues. Transcriptome sequencing was performed using the Illumina HiSeq 2500 platform, with an average sequencing depth of 6 Gb per sample. Gene expression levels were calculated by comparing the sequenced reads with the upland cotton genome, and the calculated expression level was expressed as the number of sequencing fragments per thousand transcripts per million sequenced bases (FPKM). Experimental results are as follows: Figure 1 As shown, the GhF16 The gene was predominantly expressed in ovules 3 and 1 days before flowering, and in ovules 1, 3, 5, 10, 20, and 25 days after flowering, as well as in the fibers, indicating that the gene is highly likely to be involved in the formation of cotton fiber quality traits.

[0022] Example 2 GhF16 Construction of transgenic cotton overexpression vector GhF16 The CDS sequence of the gene in tetraploid upland cotton ( G.hirsutumAs shown in SEQ ID NO.1 in TM-1. SEQ ID NO.1: .

[0023] The overexpression vector is the modified RDL-pBI121 vector, the structure of which is as follows: Figure 2 As shown. The vector overexpresses GhF16 Gene recombination primer: OE- F16 -F: tcactcctgttctagggatccATGGAAAAAAGTGAAAAGGGTAATG (SEQ ID NO.2) and OE- F16 -R: cgatcggggaaattcgagctcTCAACCATGGAAAACAGTAGCTTC (SEQ ID NO. 3), using cDNA from cotton fibers 10 days after flowering during the rapid elongation period as a template for PCR amplification, the PCR reaction system (20 μL) was as follows: DNA template 50 ~ 100 ng, primer OE- F16-F (10 μM) and primer OE- F16 0.3 μL each of -R (10 μM) and DNA polymerase mixture, and 10 μL were added to a final volume of 20 μL with ddH2O.

[0024] The PCR amplification program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 sec, 60℃ annealing for 1 min, 72℃ extension for 15 sec, for 34 cycles; and a final extension at 72℃ for 10 min. The PCR amplification products were sequenced, and the sequences were further compared with cDNA sequences to determine their accuracy.

[0025] Amplified GhF16 The fragment was subjected to homologous recombination with the enzyme-digested RDL-pBI121 vector. The restriction enzyme sites of the vector were selected as follows: BamH 1 and Sac 1. The RDL-pBI121 vector is a plant binary expression vector, modified to contain a fiber-specific promoter. RDL (SEQ ID NO.4) drive expression, NOS terminator, and kanamycin resistance selection marker.

[0026] SEQ ID NO.4: AATTAGTTATGTTTGGTAAATGAATTTGAATACATGCACCACCACTCTCAATGCTCACCCACCTAAGCCCATGACATAAACTGCATTTAAGTGAACCAGTGGCAGTTGGAGCCATTATGTTGGTTGAAAAATATTGTTGGCAGTGTTAT TCAGCAGTACTTGTTCTAAGGCTCCTACTACATTTCTCATTATAAATGTGGAGAAATCTTGTTCTACTTTCCATTCCATGCAACACTAACTTTTAGATTCCCTTTCCATTGCACTGCTCTTTCTTTCTAGAATTAGTCACTCCTGTTCTAG.

[0027] The recombinant product was transformed into E. coli DH5α competent cells, screened, and sequenced. The sequencing results were compared to confirm the successful synthesis. GhF16 The overexpression vector's spectrum is as follows: Figure 2 As shown. The correctly verified overexpression vector was extracted and transformed into Agrobacterium GV3101 via heat shock, and then the Agrobacterium was transformed into upland cotton ( ) via genetic transformation. G.hirsutum W0 was obtained with W0 as the transgenic background. GhF16 Overexpression of cotton lines.

[0028] Example 3 GhF16 Identification of gene expression levels in transgenic cotton Three were obtained through genetic transformation. GhF16 Overexpression cotton lines (OE- F16- 1. OE- F16- 2. OE- F16- 3) Using W0 as the genetic transformation recipient material, design specific primers for qPCR. F16- F: AAGGAGACTCAGCCATCA (SEQ IDNO.5) with qPCR- F16- R: TAGCACCGCATAACAAAT (SEQ ID NO. 6), used to detect W0 and GhF16 Overexpression lines GhF16 The transcriptional level was determined. Total RNA was extracted from W0 and the overexpressing lines and reverse transcribed to synthesize cDNA. RT-qPCR analysis was performed using cDNA as a template via the SYBR Green assay.

[0029] A 20 μL reaction system containing cDNA template, specific primers (SEQ ID NO. 5, SEQ ID NO. 6), and fluorescent dye premix was used for amplification on a real-time quantitative PCR instrument: 95℃ pre-denaturation for 2-5 min; 40 cycles including 95℃ denaturation for 10-15 s, 60℃ annealing, and extension for 30-60 s (with simultaneous fluorescence signal acquisition). After amplification, melting curve analysis was performed, and the Ct value was normalized to the internal reference gene using 2... -ΔΔCt The algorithm calculates the relative expression levels of genes.

[0030] RT-qPCR results are as follows Figure 3 As shown: Compared to the W0 receptor control, the three overexpression lines (OE- F16- 1. OE- F16- 2. OE- F16- 3) GhF16 Transcript levels were significantly elevated ( P < 0.001). This experiment was conducted in three biological replicates, and differences between groups were measured using Student's score. t test analysis, represent P < 0.001. The above results confirm that... GhF16 Overexpression line OE- F16- 1. OE- F16- 2. OE- F16- 3. Successfully built.

[0031] Example 4 GhF16 Determination of fiber quality in mature cotton from overexpression lines Mature cotton bolls from the middle section of overexpressing lines at the same developmental stage were collected and ginned to obtain fiber material, with each sample weighing approximately 15g. Quality testing was performed on the processed fiber samples, with the main indicators including fiber upper half length, breaking strength, and micronaire value. At least three biological replicates were established for each line, and differences between groups were analyzed using Student's score. t Test analysis, represent P < 0.01, represent P < 0.001. See the results below. Figure 4 Compared to the wild type (WT), GhF16 The overexpression strains showed an average increase of 17.33% in the upper half of the fiber length, 12.51% in breaking strength, and 16.26% in micronaire value (fineness).

[0032] Example 5 GhF16 overexpression identification of cotton fiber phenotype Selected genetic transformation to obtain GhF16 Mature fiber phenotypes were identified in overexpressing cotton lines and wild-type (WT) lines, primarily including surface structures such as microfibril arrangement and helical phenotype, and the number of helices was counted. Subsequently, cross-sectional sections of mature fibers were prepared, and cell wall thickness was calculated for each group. Each line was tested in at least three biological replicates, and differences between groups were analyzed using Student's t-test. This means P < 0.01. This indicates that P < 0.001. See the results below. Figure 5 .

[0033] The results of the surface structure of mature fibers show that, GhF16 The surface microfibrils of overexpressed cotton are more orderly arranged than those of wild type, and GhF16 Overexpressing cotton has more spirals than wild-type cotton. Wild-type cotton has an average of approximately 12 spirals per mm of mature fiber. GhF16 The average number of spirals per 1 mm of mature cotton fiber expressed by overexpression is approximately 17. GhF16 The average spiral number of overexpressed cotton increased by 41.67% compared to the wild type. Mechanical property measurements showed that... GhF16 Overexpression of cotton increased the average Young's modulus by 42.88% compared to the wild type, indicating that... GhF16 It can significantly improve the mechanical stiffness and resistance to deformation of cotton fibers, thereby enhancing fiber strength.

[0034] The results of mature fibrous cell wall phenotype observation showed that GhF16 The mature fiber cell walls of cotton overexpressing the gene were thinner than those of wild-type cotton. The average cell wall thickness of mature fibers in wild-type cotton was approximately 3.87 μm. GhF16 The average thickness of mature cotton fiber cell walls after overexpression was approximately 3.23 μm. GhF16 The cell wall thickness of mature cotton fibers overexpressed was 19.81% thinner than that of wild-type fibers, indicating that... GhF16 It can regulate cell wall thickness development, thereby improving fiber fineness.

[0035] Therefore, overexpression in cotton GhF16 It can simultaneously improve fiber length, strength and fineness, which is beneficial to textile processing.

[0036] Obviously, the above embodiments are merely illustrative examples to clearly illustrate the technical solution of the present invention, and are not intended to limit the implementation. Those skilled in the art can derive various other variations or adjustments based on the above disclosure. It is neither possible nor necessary to exhaustively list all embodiments here, but any variations or modifications that are obvious extensions of the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. Overexpression GhF16 The application of genes in improving cotton fiber quality is characterized by, The GhF16 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The improvement of cotton fiber quality specifically refers to increasing the length, strength, and fineness of cotton fibers.

3. A kind containing GhF16 The application of recombinant gene expression vectors or recombinant bacteria in improving cotton fiber length, strength, and fineness is characterized by, The GhF16 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

4. A method for cultivating high-fiber quality cotton, characterized in that, Will contain GhF16 Recombinant gene expression vectors or recombinant bacteria are genetically transformed into cotton. GhF16 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

5. The method according to claim 4, characterized in that, Construct containing GhF16 The primer pair sequences used in the recombinant expression vector or recombinant bacteria are shown in SEQ ID NO.2 and SEQ ID NO.

3.

6. The method according to claim 4, characterized in that, Construct containing GhF16 A recombinant gene expression vector, wherein the vector is modified to contain a fibrous-specific promoter. RDL The expression vector RDL-pBI121, the promoter RDL The sequence is shown in SEQ ID NO.

4.

7. A method for detecting the quality of cotton fibers, characterized in that, qPCR detection of cotton GhF16 Gene expression levels.

8. The method according to claim 7, characterized in that, The cotton being tested GhF16 The primer pairs used to measure gene expression levels are shown in SEQ ID NO.5 and SEQ ID NO.

6.

9. The method according to claim 7, characterized in that, The quality of cotton fibers refers to the length, strength, and fineness of the cotton fibers.

10. A reagent kit for detecting the quality of cotton fibers, characterized in that, Includes detection GhF16 qPCR primer pairs for gene expression levels, the nucleotide sequences of which are shown in SEQ ID NO.5 and SEQ ID NO.6.

Images