A spontaneous mouse model of pancreatic adenosquamous carcinoma and construction method and application thereof

Abstract

The application belongs to the technical field of animal model construction, and particularly relates to a spontaneous pancreatic adenosquamous carcinoma mouse model and a construction method and application thereof. The construction method of the spontaneous pancreatic adenosquamous carcinoma mouse model provided by the application simultaneously applies two characteristics of Tgfbr2 gene knockout and Kras gene mutation to the same mouse individual, and constructs a mouse model capable of spontaneously forming pancreatic adenosquamous carcinoma, thereby providing a research tool for pancreatic adenosquamous carcinoma and being conducive to accelerating the research progress of pancreatic adenosquamous carcinoma.

Description

Technical Field

[0001] This invention belongs to the field of animal model construction technology, specifically relating to a spontaneous pancreatic adenosquamous carcinoma mouse model, its construction method, and its application. Background Technology

[0002] Pancreatic cancer is one of the most malignant tumors, with an increasing incidence and poor prognosis. Most patients are already out of the surgical option at diagnosis. Furthermore, due to its unique tumor microenvironment, pancreatic cancer responds poorly to chemotherapy and immunotherapy. Therefore, exploring the formation mechanism of the pancreatic cancer microenvironment and identifying new therapeutic targets are urgent problems to be solved in the diagnosis and treatment of pancreatic cancer. Pancreatic adenosquamous carcinoma (PASC) is a rare but highly aggressive subtype of pancreatic cancer, with a malignancy far exceeding that of the common pancreatic ductal adenocarcinoma (PDAC), making its research of great clinical significance.

[0003] In recent years, research on pancreatic cancer has revealed the synergistic role of decreased TGFBR2 expression, TGF-β pathway dysregulation, and KRAS mutations in the development and progression of pancreatic cancer. These molecular events not only drive the malignant phenotype of tumor cells but also reshape the immunosuppressive microenvironment, becoming a key mechanism for treatment resistance.

[0004] KRAS mutation is the most common driving event in pancreatic cancer (including pancreatic adenosquamous carcinoma) (>90%), and mutant KRAS (such as KRAS) G12D It continuously activates downstream MAPK and PI3K / AKT pathways, promoting cell proliferation, metabolic reprogramming, and treatment resistance.

[0005] TGFBR2 is a core receptor in the TGF-β signaling pathway. It transmits growth-inhibiting signals by activating SMAD proteins (SMAD2 / 3 / 4 complex), thereby inhibiting cell proliferation and inducing apoptosis. In pancreatic cancer, approximately 8% of cases have TGFBR2 gene mutations or epigenetic silencing (such as promoter methylation), leading to TGF-β signaling inactivation, relieving its inhibitory effect on the PI3K / AKT pathway, and promoting tumor cell survival and invasion.

[0006] However, single Kras mutant mouse models and Tgfbr2 gene knockout mouse models still have relatively long survival rates, resulting in long cycles from modeling to experimentation and high time costs for research. Furthermore, there are currently no reported mouse models of pancreatic adenosquamous carcinoma. Therefore, there is an urgent need to find a method to construct mice with pancreatic adenosquamous carcinoma to explore and identify new therapeutic targets, thereby accelerating research progress in pancreatic adenosquamous carcinoma. Summary of the Invention

[0007] The purpose of this invention is to provide a spontaneous pancreatic adenosquamous carcinoma mouse model, its construction method, and its application, which involves knocking out the pancreatic-specific Tgfbr2 gene in combination with KRAS gene mutant mice (LSL-Tgfbr2).fl / fl The Pdx1-Cre and Kras-LSL-G12D series provide research tools for pancreatic adenosquamous carcinoma, saving research time and costs.

[0008] This invention provides a method for constructing a spontaneous pancreatic adenosquamous carcinoma mouse model, comprising: hybridizing pancreatic-specific Tgfbr2 knockout mice with Kras mutant mice, and the F1 generation being the spontaneous pancreatic carcinoma mouse model.

[0009] The method for constructing pancreatic-specific Tgfbr2 knockout mice includes: crossing Tgfbr2-CKO heterozygous positive mice with pancreatic-specific targeted Pdx1-Cre tool mice, and the F1 generation being pancreatic-specific Tgfbr2 knockout mice.

[0010] The method for constructing the Tgfbr2-CKO heterozygous positive mouse includes: crossing the conditional Tgfbr2 gene knockout mouse Tgfbr2-CKO with the C57BL / 6 strain mouse to obtain the Tgfbr2-CKO heterozygous positive mouse.

[0011] The method for constructing Kras-mutant transgenic mice includes: obtaining Cas9 mRNA and gRNA through in vitro transcription; constructing a homologous recombination vector (donor vector) containing a 2.5kb 5' homologous arm, a KI fragment, and a 4.2kb 3' homologous arm using in-fusion cloning; and microinjecting Cas9 mRNA, gRNA, and the donor vector into fertilized eggs of C57BL / 6J mice to obtain Kras G12D mutant mice.

[0012] This invention also provides the application of the spontaneous pancreatic adenosquamous carcinoma mouse model constructed by the above construction method in pancreatic adenosquamous carcinoma drug screening, drug development and / or research on the pathogenesis mechanism of pancreatic adenosquamous carcinoma.

[0013] Beneficial Effects: The method for constructing a spontaneous pancreatic adenosquamous carcinoma mouse model provided by this invention, based on the Kras G12D mutation with the addition of Tgfbr2 deletion, has been experimentally demonstrated to successfully construct a pancreatic adenosquamous carcinoma model. This provides a research tool for pancreatic adenosquamous carcinoma, accelerates research progress for researchers, and saves time and costs. The spontaneous pancreatic adenosquamous carcinoma mouse model provided by this invention has high reproducibility and good controllability, serving as an important bridge to promote the research progress of pancreatic adenosquamous carcinoma and its eventual clinical translation. Attached Figure Description

[0014] Figure 1Design strategy for C57BL / 6J-Tgfbr2-CKO conditional knockout mice; Wildtype allele; 5' homology arm; 3' homology arm; Targeting vector; Targeted allele; exon; knockout allele; Cre recombination; homology arm; CKO region; loxP site; gRNA region; legends; exonofmouse Tgfbr2;

[0015] Figure 2 Schematic diagram of the in vitro transcription vector for C57BL / 6J-Tgfbr2-CKO conditional knockout mice; Tgfbr2-CKOvector Seq: Tgfbr2-CKO vector sequence; 5'arm: 5' long terminal repeat sequence; 3'arm: 3' long terminal repeat sequence; loxP site: loxP insertion site; SacI: SacI restriction endonuclease;

[0016] Figure 3 Design strategy for C57BL / 6J-Kras-LSL-G12D mutant mice;

[0017] Figure 4 This is a schematic diagram of the in vitro transcription vector for C57BL / 6J-Kras-LSL-G12D mutant mice; Kras-LSL-G12D vector Seq: Kras-LSL-G12D vector sequence; Kb: kilobases; Amp: ampicillin resistance region; 5'arm: 5' long terminal repeat sequence; 3'arm: 3' long terminal repeat sequence; PGK / EM7 / CAG promoter: PGK / EM7 / CAG promoter region; Neo: neomycin resistance region; MC1-hsvTK-polyA: polyomavirus enhancer fused with herpes simplex virus thymidine kinase promoter fused with polyadenylate tail; SV40pA: simian vacuolar virus polyadenylate tail;

[0018] Figures 5-6 This is a schematic diagram of the Tgfbr2 gene identification results in the tails of F2 generation mice in Example 1; mice with only 532 bands are wild-type mice, mice with two bands (one above the other) are Tgfbr2 heterozygous positive mice, and mice with only 590 bands are Tgfbr2 homozygous positive mice.

[0019] Figures 7-8 This is a schematic diagram of the Pdx1-cre identification results of F2 generation juvenile mice in Example 1; mice with only the bottom band are wild-type mice, and mice with both the top and bottom bands are Pdx1-cre positive mice;

[0020] Figures 9-10 This is a schematic diagram of the results of the identification of the Kras-LSL-G12D gene in the tail of F2 generation mice in Example 2; mice with only the upper band are wild-type mice, and mice with both upper and lower bands are heterozygous mice with Kras-LSL-G12D gene mutation.

[0021] Figures 11-13 This is a schematic diagram of the tail gene identification results of F2 generation juvenile mice in Example 3; Figure 11 The results of Tgfbr2 gene identification; Figure 12 The results of Pdx1-cre gene identification; Figure 13 The results of Kras-LSL-G12D gene identification;

[0022] Figure 14 This is a schematic diagram of spontaneous pancreatic adenosquamous carcinoma tissue generated in a mouse model of spontaneous pancreatic adenosquamous carcinoma.

[0023] Figure 15 A schematic diagram of HE staining of tumor tissue;

[0024] Figure 16 This is a schematic diagram of IHC staining for P63 (10*, 20*), a marker for squamous cell carcinoma in tumor tissue.

[0025] Figure 17 A schematic diagram of IHC staining for P40 (10*, 20*) markers in squamous cell carcinoma tumor tissue.

[0026] Figure 18 This is a schematic diagram of IHC staining for CK19 (10*, 20*), a biomarker for adenocarcinoma in tumor tissue. Detailed Implementation

[0027] This invention provides a method for constructing a spontaneous pancreatic adenosquamous carcinoma mouse model, comprising: crossing a mouse with a pancreatic-specific Kras mutation with a mouse with a pancreatic-specific Tgfbr2 knockout, and using the F1 generation as the spontaneous pancreatic adenosquamous carcinoma mouse model.

[0028] The preferred method for constructing pancreas-specific Tgfbr2 knockout mice according to the present invention includes: crossing Tgfbr2-CKO gene knockout mice with pancreas-specific targeted Pdx1-Cre tool mice, with the F1 generation being pancreas-specific Tgfbr2 knockout mice; the preferred method for constructing Tgfbr2-CKO gene mice includes: crossing conditional Tgfbr2 gene knockout transgenic mice (Tgfbr2-CKO) with C57BL / 6 strain mice to obtain Tgfbr2-CKO heterozygous positive mice; the preferred method for constructing Tgfbr2-CKO transgenic mice includes: using the principle of homologous recombination, employing homologous recombination of fertilized eggs to modify the Tgfbr2 gene with flux. The construction method includes: site-specific knock-in of flux modification at the Tgfbr2 site on chromosome 9 of C57BL / 6J mice to obtain conditional Tgfbr2 knockout transgenic mice (Tgfbr2-CKO).

[0029] This invention does not have any special limitations on the source of C57BL / 6J-Tgfbr2-CKO conditional knockout mice, pancreas-specific targeted Pdx1-Cre tool mice, and C57BL / 6 strain mice; they can be obtained through conventional purchase. In the embodiments of this invention, C57BL / 6J-Tgfbr2-CKO conditional knockout mice purchased from Nanmo Biotechnology Co., Ltd., pancreas-specific targeted Pdx1-Cre tool mice with strain code 014647 purchased from The Jackson Laboratory China Branch, and C57BL / 6 strain mice with catalog number NM-CKO-210184 purchased from Shanghai Southern Model Biotechnology Co., Ltd. are used as examples, but they should not be considered as the entire scope of protection of this invention.

[0030] Before constructing the spontaneous pancreatic adenosquamous carcinoma mouse model as described in this invention, the method for constructing the Kras-mutant transgenic mice includes: using CRISPR / Cas9 technology, through homologous recombination, inserting Loxp-long Stop-Loxp into intron 1 of the Kras gene, and introducing a G12D point mutation in exon 2. The simplified process is as follows: Cas9 mRNA and gRNA are obtained through in vitro transcription; a homologous recombination vector (donorvector) is constructed using in-fusion cloning, containing a 2.5kb 5' homologous arm, a KI fragment, and a 4.2kb 3' homologous arm. The Cas9 mRNA, gRNA, and donorvector are microinjected into the fertilized eggs of C57BL / 6J mice to obtain F0 generation mice.

[0031] The present invention performs gene identification on the obtained spontaneous pancreatic adenosquamous carcinoma mouse model. The preferred identification method is to use PCR to identify the tail DNA of the F1 generation obtained by crossing Tgfbr2-CKO heterozygous positive mice with pancreatic-specific targeted Pdx1-Cre positive tool mice.

[0032] The spontaneous pancreatic adenosquamous carcinoma described in this invention preferably includes pancreatic ductal adenocarcinoma combined with adenosquamous carcinoma.

[0033] This invention also provides the application of the spontaneous pancreatic adenosquamous carcinoma mouse model constructed by the above construction method in pancreatic adenosquamous carcinoma drug screening, drug development and / or research on the pathogenesis mechanism of pancreatic adenosquamous carcinoma.

[0034] To further illustrate the present invention, the following detailed description, in conjunction with the accompanying drawings and embodiments, provides a spontaneous pancreatic adenosquamous carcinoma mouse model, its construction method, and its applications. However, these descriptions should not be construed as limiting the scope of protection of the present invention.

[0035] Example 1

[0036] 1. Construction of Tgfbr2 gene knockout mice:

[0037] C57BL / 6J-Tgfbr2-CKO conditional knockout mice (Tgfbr2-CKO) were purchased from Shanghai Southern Model Biotechnology Co., Ltd., and the construction process provided by the company included:

[0038] By reviewing mouse genome information, the Tgfbr2 gene was found to be located on mouse chromosome 3, with the target gene Ensembl number: ENSMUSG00000032440. The transcript targeted by the protocol (Ensembl number): Tgfbr2-202 (ENSMUST00000061101.11). Utilizing the principle of homologous recombination, the Tgfbr2 gene was modified using flux modification (e.g., homologous recombination in fertilized eggs) through homologous recombination. Figure 1(As shown). The process was as follows: Cas9 mRNA and gRNA were obtained through in vitro transcription; a homologous recombination vector (donorvector) was constructed using in-fusion cloning, containing a 3.0kb 5' homologous arm, a 0.9kb flux region, and a 3.0kb 3' homologous arm; the Tgfbr2 gRNA sequence was: AACATCCAGTGCTATTCTGCAGG (SEQ ID NO.1); 200 early embryos were obtained through in vitro fertilization of wild-type C57BL / 6J male and female mice; Cas9 mRNA, gRNA, and the donorvector were microinjected into the embryos, which were then transferred into surrogate wild-type female mice. F0 generation mice were born 3 weeks later, and the genotypes of the pups were identified by PCR and sequencing.

[0039] PCR identification protocol for homologous recombination positive mice:

[0040] PCR identification method for 5' homologous arm recombination positive F0 generation mice:

[0041] Primer information:

[0042] F: 5'-GCCCAGGCAACAAAGAAGGTC-3';

[0043] R: 5'-AGGCTGAGCAACACTGGGAGAACA-3';

[0044] Reaction system:

[0045]

[0046]

[0047] The PCR amplification program was as follows: 94℃ pre-denaturation for 3 min; 98℃ denaturation for 15 s, 61℃ annealing for 15 s, 68℃ extension for 4 min, 35 cycles; 68℃ hold for 5 min, and then stored at 4℃ for testing.

[0048] PCR identification method for 3' homologous arm recombination positive F0 generation mice:

[0049] Primer information:

[0050] F: 5'-AAGGTCCGGAGCCCATTGA-3';

[0051] R: 5'-AGTCTGCCTGTTGCCTACC-3';

[0052] Reaction system:

[0053] ddH2O 13.2 GXLPCRBuffer 2 2.5mMdNTP 2 PrimerIII (10 pmol / μl) 0.5 PrimerIV (10 pmol / μl) 0.5 GXL DNA Polymerase* 0.8 genomicDNA 1 Total 20

[0054] The PCR amplification program was as follows: 94℃ pre-denaturation for 3 min; 98℃ denaturation for 15 s, 61℃ annealing for 15 s, 68℃ extension for 4 min, 35 cycles; 68℃ hold for 5 min, and then stored at 4℃ for testing.

[0055] A 4.4 kb fragment should be amplified from a 5' arm homologous recombination-positive genome, and a 7.4 kb fragment should be amplified from a 3' arm homologous recombination-positive genome; a 4.6 kb fragment should be amplified from a 3' arm homologous recombination-positive genome, and an 8.1 kb fragment should be amplified from a 3' arm homologous recombination-positive genome.

[0056] Tgfbr2-CKO mouse P1 generation PCR identification protocol:

[0057] The PCR amplification system consisted of: 2 μL DNA template, 0.5 μL forward primer F, 0.5 μL reverse primer R, 10 μL Taq enzyme and reaction mixture premix, and ddH2O to a final volume of 20 μL.

[0058] The primers for Tgfbr2-CKO gene identification are as follows:

[0059] F: 5'-CCAAGCTCATTCTCAGGGCA-3';

[0060] R: 5'-CCAGCAACTGCGCTTTTCAA-3';

[0061] The PCR amplification program was as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 sec, 35 cycles; 72℃ hold for 5 min, and then store at 4℃ for later detection.

[0062] Expected results: Wild-type mice showed only one 532bp band; heterozygotes showed two bands, 532bp and 590bp respectively. Based on the above PCR detection, the Tgfbr2 conditional knockout mice (Tgfbr2-CKO) successfully modified with Flox were obtained, matching the expected results.

[0063] 2. Construction of pancreas-specific Tgfbr2 gene knockout mice:

[0064] One Tgfbr2-CKO F1 positive mouse obtained in step 1 was mated with four C57BL / 6 female mice for 3 weeks to obtain 18 pups. Genotyping of the pups by tail analysis revealed that 12 of them were Tgfbr2-CKO positive mice, with a positive rate of 66.67% and a theoretical positive rate of 50.00%.

[0065] Subsequently, one Tgfbr2-CKO positive male mouse prepared above and four pancreas-specifically targeted Pdx1-Cre positive tool mice (purchased from The Jackson Laboratory China) were used. Mice and Services (strain code 014647) were mated together for 3 weeks to obtain 27 F2 generation pups. The pups were then identified by tail identification to obtain their genotypes.

[0066] The method for identifying rat tails is as follows:

[0067] F2 generation mice are numbered and their tails are cut off 14 days after birth. The tails should be 0.5cm in length and can be stored at -20℃ for later use.

[0068] Reagents:

[0069] Rat tail lysis buffer: 10 ml of 1 M Tris HCl (pH = 8.0), 4 ml of 0.5 M EDTA, 400 ml of 1 M NaCl, 100 ml of 10% SDS, and 486 ml of ultrapure water.

[0070] Proteinase K solution (PK): 20 mg / ml, store at -20℃;

[0071] TE buffer: 5 ml of 1 M Tris HCl (pH = 8.0), 1 ml of 0.5 M EDTA, and 494 ml of ultrapure water.

[0072] Experimental procedure:

[0073] 300 μl of lysis buffer and 5 μl of PK were added to each of the 27 rat tail samples, and the samples were digested overnight at 55 °C. After overnight digestion, 600 μl of pre-cooled anhydrous ethanol at -20 °C was added to each of the digested samples, and the mixture was inverted until flocculent precipitate was clearly visible. The inversion was then stopped, and the samples were centrifuged at 12,000 rpm for 5 min.

[0074] After centrifugation, pour out the supernatant and place the centrifuge tube vertically upside down on a flat sheet of paper. After 10 minutes, move the tube to a different position, press it down gently, and wait until it is completely dry. At this point, the precipitate will become transparent, indicating that the extracted DNA is of good quality.

[0075] Add 200 μl of TE buffer to a centrifuge tube and dissolve the DNA thoroughly by shaking up and down to obtain the DNA template; take 3 μl of DNA template and perform PCR in a 25 μl reaction system.

[0076] The Tgfbr2-CKO identification protocol is consistent with the P1 generation PCR identification protocol for Tgfbr2-CKO described above.

[0077] The PCR amplification system for Pdx1-cre was as follows: 2 μL DNA template, 0.5 μL forward primer F2, 0.5 μL reverse primer R2, 0.5 μL forward positive primer F3, 0.5 μL reverse positive primer R3, 10 μL Taq enzyme and reaction mixture premix, and ddH2O to a final volume of 20 μL. The Pdx1-Cre primer sequences are as follows:

[0078] F2: 5'-CCTGGACTACATCTTGAGTTGC-3';

[0079] R2: 5'-AGGCAAATTTTGGTGTACGG-3';

[0080] F3: 5'-CTAGGCCACAGAATTGAAAGATCT-3';

[0081] R3: 5'-GTAGGTGGAAATTCTAGCATCATCC-3';

[0082] Expected results for Pdx1-Cre: Positive control: 324bp band; Target band: 650bp band.

[0083] The PCR amplification program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 30 min, 35 cycles; 72℃ hold for 5 min, and then store at 4℃ for later detection.

[0084] Electrophoresis: Prepare a 2% agarose gel according to the target band. Dissolve 2g of agarose in 100ml of TAE buffer and microwave until the agarose melts. Add 10μl of nucleic acid dye (EB substitute), pour into the electrophoresis template, insert a comb, and allow to cool before use. Add appropriate amounts of DNA to the agarose gel: 10μl for small wells and 20μl for large wells. Select a suitable DNA marker according to the size of the target band and add it to the gel. Run the gel at 120V. After running, observe and photograph using a gel imaging system to obtain the genotyping results report.

[0085] Depend on Figure 5-6 The results show that Tgfbr2 fl / + There were 10 heterozygous mice with single-gene positive results and 14 homozygous mice with single-gene positive results; Figure 7-8 The results showed that 17 mice were heterozygous for the Pdx1-Cre single gene, with a positive rate of 70.83%, compared to a theoretical positive rate of 50.00%. (Combined with...) Figure 5-8 The results of gene identification of 24 F2 mice show that 17 of them are double heterozygous for Tgfbr2-CKO and Pdx1-Cre.

[0086] Example 2

[0087] KrasG12D mutant mice were purchased from Shanghai Southern Model Biotechnology Co., Ltd., whose construction process included:

[0088] The mRNA and gRNA of the Cas9 gene (5'-AGAGCTTACCACAGAGAGTAAGG-3') were obtained through in vitro transcription. A homologous recombination vector containing a 2.5kb 5' homologous arm, a KI fragment, and a 4.2kb 3' homologous arm was constructed using in-fusion cloning. The Cas9 mRNA, gRNA, and the constructed homologous recombination vector were microinjected into fertilized eggs of C57BL / 6J mice to obtain F0 generation mice. The genotypes of the F0 generation mice were identified by PCR and sequencing.

[0089] PCR identification method for 5' homologous arm recombination positive F0 generation mice:

[0090] Primer information:

[0091] F: 5'-ACGGGGCGGCTTTCCTTC-3';

[0092] R: 5'-AGCGCGGCTATCGTGGCT-3';

[0093] Reaction system:

[0094] ddH2O 13.2 GXLPCRBuffer 2 2.5mMdNTP 2 Primer I (10 pmol / μl) 0.5 PrimerII (10 pmol / μl) 0.5 GXL DNA Polymerase* 0.8 genomicDNA 1 Total 20

[0095] The PCR amplification program was as follows: 95℃ pre-denaturation for 3 min; 98℃ denaturation for 15 s, 60℃ annealing for 15 s, 68℃ extension for 2 min, 35 cycles; 68℃ hold for 5 min, and then stored at 4℃ for testing.

[0096] PCR identification method for 3' homologous arm recombination positive F0 generation mice:

[0097] Primer information:

[0098] F: 5'-TTCCGCAAGCTAGCCACCAT-3';

[0099] R: 5'-CCTTCATCCAACAAGCTCAGCCCAAC-3';

[0100] Reaction system:

[0101] ddH2O 13.2 GXLPCRBuffer 2 2.5mMdNTP 2 PrimerIII (10 pmol / μl) 0.5 PrimerIV (10 pmol / μl) 0.5 GXL DNA Polymerase* 0.8 genomicDNA 1 Total 20

[0102] The PCR amplification program was as follows: 95℃ pre-denaturation for 3 min; 98℃ denaturation for 15 s, 60℃ annealing for 15 s, 68℃ extension for 2 min, 35 cycles; 68℃ hold for 5 min, and then stored at 4℃ for testing.

[0103] A 5' arm homologous recombination-positive genome should amplify a 3.9 kb fragment, while a negative genome should produce no product; a 3' arm homologous recombination-positive genome should amplify a 4.8 kb fragment, while a negative genome should produce no product. Heterozygous mice obtained based on the above PCR tests, matching the expected results, are KrasG12D gene mutant mice.

[0104] PCR identification protocol for P1 generation KrasG12D mutant positive mice:

[0105] The PCR amplification system consisted of: 2 μL DNA template, 0.5 μL primer P1, 0.5 μL primer P2, 0.5 μL primer P3, 10 μL Taq enzyme and reaction mixture premix, and ddH2O to a final volume of 20 μL.

[0106] The primers for identifying the KrasG12D mutant gene are as follows:

[0107] P1: 5'-TGTCTTTCCCCAGCACAGT-3';

[0108] P2: 5'-CTGCATAGTACGCTATACCCTGT-3';

[0109] P3: 5'-GCAGGTCGAGGGACCTAATA-3';

[0110] The PCR amplification program was as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 30 sec, 35 cycles; 72℃ hold for 5 min, and then store at 4℃ for later detection.

[0111] Expected results: Wild-type mice showed only one 250bp band; heterozygotes showed two bands, 250bp and 100bp respectively; homozygotes showed 100bp. Mice that yielded the expected results based on the above PCR tests were mice that had successfully undergone the KrasG12D point mutation.

[0112] Implementation process:

[0113] One male Kras-LSL-G12D knock-in mouse obtained in step 2 of Example 1 was selected and mated with four C57BL / 6 female mice for 3 weeks to obtain 24 pups. Tail identification was performed according to the P1 generation method. The genetic identification results of the 24 F2 pups are as follows: Figures 9-10 As shown. By Figures 9-10The results showed that 12 mice were positive for the Kras-LSL-G12D knock-in single gene, with a positive rate of 50.00%.

[0114] Example 3

[0115] Take one Tgfbr2 obtained in Example 1 fl / + After mating the / Pdx1-Cre double-gene heterozygous male rats with three Kras-LSL-G12D positive female rats obtained in Example 2, 24 F1 pups were obtained after 3 weeks. Tail identification was performed according to the method in Example 1, and the results are as follows: Figure 11-13 As shown.

[0116] Depend on Figure 11 The results show that Tgfbr2 fl / + Seven homozygous mice, Tgfbr2 fl / + Ten heterozygous mice were used. Figure 12 The results showed that 6 mice were Pdx1-Cre heterozygous, with a positive rate of 35.3%. Figure 13 The results showed that there were 6 Kras-LSL-G12D heterozygous mice, with a positive rate of 35.3%. (Combined with...) Figures 11-13 Among the 17 young mice, Tgfbr2... fl / + Three mice with the / Pdx1-Cre / Kras-LSL-G12D trigenotype were included, with a positive rate of 17.6%. Among them, Tgfbr2... fl / + The / Kras-LSL-G12D / Pdx1-Cre tri-heterozygous mouse model is the spontaneous pancreatic adenosquamous carcinoma mouse model described in this invention.

[0117] Example 4

[0118] Eighteen additional pancreatic adenosquamous carcinoma mice were constructed using the methods described in Examples 1-3. After accurate genotyping via tail identification, they were routinely housed in an SPF-grade animal facility. Mice were observed weekly for the first two weeks of age, and every two days thereafter. When mice exhibited emaciation, lethargy, or decreased activity, aseptic laparotomy was performed to explore the pancreatic tissue and determine the presence of spontaneous pancreatic adenosquamous carcinoma. If a tumor was found, the mice were euthanized, and gross photographs were taken of the tumor (e.g., ...). Figure 14 (As shown) and preserved in formalin for subsequent paraffin embedding and sectioning for HE staining (e.g. Figure 15 As shown, this is the morphology of pancreatic adenosquamous carcinoma) or immunohistochemical experiments (such as...). Figure 16-18 As shown, P63, P40, and CK19 were all positive.

[0119] Depend on Figure 14 It is known that the mouse model constructed in this invention can spontaneously and rapidly develop pancreatic adenosquamous carcinoma; from Figure 15-18It is evident that the pancreatic adenosquamous carcinoma pathological type formed in the model mice constructed in this invention can represent rare pancreatic cancer patients with adenosquamous carcinoma in clinical practice. These patients typically experience rapid disease progression and poor prognosis, which aligns well with the pathological characteristics of this mouse model. Therefore, this model has a certain degree of clinical representativeness and is suitable for laboratory research. Furthermore, the construction of this model is the first of its kind in the world, and no previous studies have reported on it.

[0120] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A method for constructing a spontaneous mouse model of pancreatic adenosquamous carcinoma, characterized in that, include: Mice with pancreatic-specific Kras mutations were crossed with mice with pancreatic-specific Tgfbr2 knockout, and the F1 generation became the spontaneous pancreatic adenosquamous carcinoma mouse model.

2. The construction method according to claim 1, characterized in that, The method for constructing pancreatic-specific Tgfbr2 knockout mice includes: crossing Tgfbr2-CKO gene knockout mice with pancreatic-specific targeted Pdx1-Cre tool mice, and the F1 generation being pancreatic-specific Tgfbr2 knockout mice.

3. The construction method according to claim 2, characterized in that, The method for constructing the Tgfbr2-CKO gene knockout mouse includes: utilizing the principle of homologous recombination, the Tgfbr2 gene is modified with flux using homologous recombination in fertilized eggs. The construction method involves: site-specific knock-in of flux modification at the Tgfbr2 locus on chromosome 9 of C57BL / 6J mice to obtain the conditional Tgfbr2 knockout gene knockout mouse Tgfbr2-CKO.

4. The construction method according to claim 1, wherein the method for constructing the Kras-mutant transgenic mouse comprises: Using CRISPR / Cas9 technology, a Loxp-long Stop-Loxp gene was inserted into intron 1 of the Kras gene via homologous recombination, and a G12D point mutation was introduced into exon 2. The procedure was briefly as follows: Cas9 mRNA and gRNA were obtained via in vitro transcription; a homologous recombination vector (donor vector) containing a 2.5kb 5' homologous arm, a KI fragment, and a 4.2kb 3' homologous arm was constructed using in-fusion cloning. The Cas9 mRNA, gRNA, and donor vector were microinjected into fertilized eggs of C57BL / 6J mice to obtain F0 generation mice.

5. The application of the spontaneous pancreatic adenosquamous carcinoma mouse model constructed according to any one of claims 1 to 4 in pancreatic adenosquamous carcinoma drug screening, drug development and / or research on the pathogenesis mechanism of pancreatic adenosquamous carcinoma.

Images