A method for constructing a caenorhabditis elegans somatic tumor model

Abstract

The application discloses a method for constructing a Caenorhabditis elegans somatic tumor model, and belongs to the technical field of tumor model construction. The method comprises the following steps: establishing a cell cycle regulation gene overexpression system in a wild-type Caenorhabditis elegans, wherein the system comprises a cell cycle regulation gene driven by a body cavity cell-specific promoter; based on overexpression of the cell cycle regulation gene, the body cavity cells are prompted to break dormancy, enter the cell cycle and clonally proliferate, so that a Caenorhabditis elegans model carrying a body cavity cell tumor mass is obtained. The application also integrates a specific single-color fluorescent marker and a double-color cell lineage tracing system based on a recombinase. The model of the application effectively overcomes the observation limitations of the existing Caenorhabditis elegans reproductive system tumor model, can be widely applied to high-throughput screening of antitumor drugs, identification of tumor regulation genes and evaluation of cancer-promoting environmental factors, and provides a low-cost and visually observable in-vivo experimental tool for tumor research.

Description

Technical Field

[0001] This invention belongs to the field of tumor model construction technology, specifically relating to a method for constructing a somatic tumor model of Caenorhabditis elegans. Background Technology

[0002] Cancer is a major disease that seriously threatens human health. Animal models of tumors play a crucial role in studying tumor biology, host anti-tumor mechanisms, evaluating drug efficacy, and developing treatments. However, existing animal models of tumors still have many shortcomings: while mammalian tumor models can better simulate the clinical symptoms and pathological features of tumor patients, they are unsuitable for large-scale gene and drug screening due to their long reproductive cycle, limited offspring numbers, difficulty in genetic manipulation, high maintenance costs, and ethical concerns. To overcome the limitations of mammalian tumor models, researchers hope to use non-mammalian model organisms such as *Drosophila melanogaster* and *Caenorhabditis elegans* to construct tumor models, thereby achieving large-scale gene and drug screening at a lower cost. Unfortunately, although *C. elegans* is significantly superior to *Drosophila melanogaster* in terms of the convenience of genetic editing, cryopreservation, and live observation, the contribution of nematode models to the field of tumor research has remained very limited to date.

[0003] Caenorhabditis elegans (C. elegans for short), as a lower multicellular model organism, has been used to explore various life processes related to tumorigenesis and development, such as disordered cell proliferation, migration, and invasion. However, researchers in the field of Caenorhabditis elegans have not yet established a pathological model that is widely accepted in the oncology community, which greatly limits its further application and expansion in the field of tumor research. To date, pathological models based on Caenorhabditis elegans that conform to the definition of tumor biology are limited to germ cell tumor models. The Caenorhabditis elegans germ cell tumor model mainly utilizes mutations in genes related to the Notch signaling pathway to cause abnormal regulation of the transition from mitosis to meiosis in Caenorhabditis elegans germ cells, leading to large-scale proliferation of germ cells. The massively proliferating germ cells quickly break through the tunica vaginalis of the gonads, filling the body cavity and causing the nematodes to die as soon as they reach adulthood. Therefore, although this model reproduces the host death caused by excessive cell proliferation and tumor cell accumulation, it cannot simulate key steps in tumor progression such as clonal proliferation of tumor cells, basement membrane invasion, metastasis, and tumor microenvironment remodeling, and the observation time for tumor development is also very limited.

[0004] In addition, most human tumors are induced by gene mutations in a small number of local somatic cells. However, the existing nematode elegans tumor model is a germline mutation-induced germ cell tumor, which is very rare in clinical practice, limiting the generalizability of related research findings.

[0005] Given the many limitations of existing tumor models, there is an urgent need to develop a more universal and suitable somatic tumor model of *C. elegans* for large-scale screening, providing a powerful in vivo research tool for oncology research. Summary of the Invention

[0006] To address the shortcomings of existing technologies, the present invention aims to provide a method for constructing a somatic tumor model of *C. elegans*, thus solving the problems in the prior art.

[0007] The objective of this invention can be achieved through the following technical solutions: A method for constructing a somatic tumor model of *C. elegans* includes the following steps: A cell cycle regulation gene overexpression system was established in wild-type Caenorhabditis elegans, the overexpression system containing cell cycle regulation genes driven by coelomic cell-specific promoters; Overexpression of the cell cycle regulatory genes induces the coelomic cells to enter the cell cycle and undergo clonal proliferation, resulting in a Caenorhabditis elegans somatic cell tumor model carrying coelomic cell tumor masses.

[0008] Furthermore, the steps for establishing the overexpression system include: Will include cdk-4 Gene coding sequence linking cup-4 The first expression plasmid of the promoter, and containing... cyd-1 Gene coding sequence linking cup-4 The second expression plasmid of the promoter was introduced into wild-type Caenorhabditis elegans.

[0009] Furthermore, the construction method further includes: including a sequence linked to the green fluorescent protein coding sequence. cup-4 The promoter labeling vector was introduced into the *C. elegans* to specifically fluorescently label the coelomic tumor mass.

[0010] Furthermore, the construction method also includes: introducing an FLP / FRT cell lineage tracking system, which is used to specifically fluorescently label the nuclei of daughter cells generated by the proliferation of the coelomic cells.

[0011] Furthermore, the steps of introducing the FLP / FRT cell lineage tracing system include: A recombinant expression cassette containing a global expression promoter was introduced into Caenorhabditis elegans. The recombinant expression cassette contained, in sequence, an FRT sequence, a first fluorescent protein sequence, a first histone sequence, an FRT sequence, a second fluorescent protein sequence, and a second histone sequence. Will contain the FLP recombinase coding sequence linked cup-4The promoter recombinase vector was introduced into *C. elegans*. Through hybridization and self-crossing screening, a double-gene homozygous nematode strain carrying the overexpression system, the recombinant expression cassette, and the recombinase vector was obtained.

[0012] A somatic tumor model of *C. elegans* was constructed using the method described above.

[0013] A method for identifying tumor regulatory genes includes the following steps: The above-mentioned Caenorhabditis elegans somatic cell tumor model was divided into an experimental group and a control group; The target genes in the experimental group were subjected to loss-of-function manipulation, while the control group was not subjected to loss-of-function manipulation. Obtain and compare the volume difference data of the coelomic tumor masses in the experimental group and the control group; Based on the volume difference data, the target gene to be tested is determined to be a tumor suppressor gene or a tumor promoter gene.

[0014] Further, the step of determining whether the target gene to be tested is a tumor suppressor gene or a tumor promoter gene includes: if the tumor volume of the experimental group is significantly larger than that of the control group, then the target gene to be tested is determined to be a tumor suppressor gene; wherein, the loss-of-function operation is implemented using RNA interference technology.

[0015] A method for assessing the influence of environmental or metabolic factors on tumor growth includes the following steps: The above-mentioned Caenorhabditis elegans somatic cell tumor model was divided into an experimental group and a control group; The experimental group was placed under preset test environment conditions or test diet conditions, while the control group was placed under standard culture conditions; Acquire and compare the amplification data of coelomic tumor masses in the experimental group and the control group; Based on the comparison results of the amplified data, the promoting or inhibiting effects of the corresponding test environment or metabolic factors on the growth of the body cavity cell tumor mass are quantitatively evaluated.

[0016] The aforementioned Caenorhabditis elegans somatic cell tumor model has been applied in identifying tumor regulatory genes and assessing the effects of environmental or metabolic factors on tumor growth.

[0017] The beneficial effects of this invention are: 1. Existing nematode tumor models mostly rely on germline mutations in genes related to the Notch signaling pathway, leading to germ cell tumors. This differs from human tumors, which are primarily induced by localized somatic cell mutations. This invention selects a constant number and fixed location of somatic cells—coelomic cells (CCs)—and uses the specific promoter P... cup-4Drivers of cell cycle genes cdk-4 and cyd-1 Overexpression. Single-cell RNA sequencing results in the examples ( Figure 7 The results showed that the expression of several classic human tumor marker genes (such as MTA1, NOTCH4, ECT2 and other homologous genes) was significantly upregulated in proliferating CC cells. This model is closer to common human somatic tumors in terms of origin and molecular characteristics, overcomes the limitations of existing germ cell tumor models in terms of cell source, and enhances the universality and translational value of the model in the study of general tumor patterns.

[0018] 2. Existing nematode germ cell tumors grow rapidly and quickly break through the gonadal sheath, leading to premature nematode death. This limits the observation time for tumor development and evolution and makes them unsuitable for research on invasion and metastasis. To address this, this invention places the tumor origin within the nematode's body cavity, which has sufficient three-dimensional physical space. Confocal imaging recording ( Figure 4 , Figure 5 The results showed that the CC cell clusters exhibited a clear trend of gradual expansion with the age of the nematodes, rather than an instantaneous lethal burst; the survival curve ( Figure 8 This also demonstrates that nematodes carrying tumors can maintain a relatively long survival period. More importantly, in late-stage, older nematodes on day 19 ( Figure 6 This study observed the diffusion of CC-derived cells from the main mass to the periphery. This effectively addresses the problems of excessively rapid lethality and short observation windows in existing models, providing a reliable system for long-term dynamic tracking of tumor growth dynamics, and also laying the foundation for studying the migration behavior of tumor cells in a living three-dimensional environment.

[0019] 3. In vivo imaging of mammals often faces difficulties such as insufficient penetration depth or limited resolution, while traditional nematode gonadal tumor imaging often relies on complex methods such as immunostaining. To address this, this invention utilizes the transparent biological characteristics of nematodes to construct a CC-specific GFP monochromatic marker and a two-color cell lineage tracking system based on FLP / FRT recombinase, eliminating the cumbersome processing of slicing and fixation, allowing researchers to perform non-destructive in vivo tumor detection under a fluorescence microscope. Figure 2 Display P cup-4 The driven GFP reporter system can specifically label the entire CC cell. Furthermore, CC-specific GFP monochromatic labeling can clearly reveal the growth and distribution of CC tumors in living nematodes under a standard fluorescence stereomicroscope, greatly facilitating subsequent screening of tumor-regulating genes, drugs, and environmental factors. Fluorescence imaging results from the dual-color cell lineage tracing system (…) Figure 3This clearly demonstrates that the nuclei of CC cells and their progeny proliferating cells are specifically labeled green, while the nuclei of other normal tissue cells not derived from CC are labeled red. This system facilitates precise quantification of tumor cell counts and analysis of internal tumor structures.

[0020] 4. Mammal models are costly and difficult to manipulate genetically, making them unsuitable for large-scale gene and drug screening. Therefore, this invention uses *C. elegans*, a nematode with a short reproductive cycle, as a vector to establish pathological entities. In the examples, different interventions were applied to nematodes carrying CC tumors: quantitative analysis ( Figure 9 , Figure 10 This indicates that both high-temperature culture and a high-sugar diet can promote the increase in CC tumor size; while RNAi technology can activate evolutionarily conserved classical tumor suppressor genes ( cep-1 / TP53、 lin-35 After / RbL1) loses function ( Figure 12 CC tumors also showed significant enlargement. These phenotypic changes are consistent with tumor pathological responses observed in higher animals or humans. Taking advantage of the ease of large-scale cultivation of nematodes, this invention provides an in vivo research tool that enables low-cost screening of antitumor drugs, assessment of carcinogenic environmental factors, and identification of novel tumor-promoting / tumor-suppressing genes. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, for those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0022] Figure 1 This is a schematic diagram illustrating the principle of somatic tumor induction mechanism and model construction of Caenorhabditis elegans in this invention; Figure 2 This is the specific overexpression in Example 3 of the present invention. cdk-4 and cyd-1 In vivo imaging of GFP monochromatic labeling that leads to the proliferation of CC cells and the formation of tumor-like masses; Figure 3 This is a two-color cell lineage tracking imaging image based on the FLP / FRT system to specifically distinguish CC progeny cells from other cells in Example 4 of the present invention; Figure 4 This is an observational diagram showing the progressive expansion trend of the normal control group and CC tumor masses under GFP monochromatic labeling as the nematodes aged in Example 3 of the present invention. Figure 5 This is an observational image of the gradual expansion trend of the normal control group and CC tumor masses with the age of nematodes under the two-color system labeling in Example 4 of the present invention. Figure 6 This is an observational diagram of the diffusion and migration of CC-derived tumor cells from the main mass to the periphery in late-stage aged adult worms in Example 3 of the present invention; Figure 7 This is a graph showing the analysis results of the relative upregulation of the expression of classic human tumor marker homologous genes in CC proliferating cells during single-cell RNA sequencing in Example 3 of the present invention; Figure 8 This is a curve comparing the survival rates of individual nematodes carrying CC tumors and the normal control group in Example 3 of the present invention. Figure 9 This is a fluorescence imaging and quantitative analysis diagram of the high-temperature culture conditions promoting the proliferation of nematode CC tumor cells in Example 3 of the present invention; Figure 10 This is a fluorescence imaging and quantitative analysis diagram showing how a high-sugar diet treatment promotes the proliferation of nematode CC tumor cells in Example 3 of the present invention. Figure 11 This is a fluorescence imaging and quantitative analysis diagram showing that the life-extending treatment conditions in Example 3 of the present invention significantly inhibited the growth of nematode CC tumors; Figure 12 This is a fluorescence imaging and quantitative analysis diagram of the significant enlargement of CC tumors caused by the loss of function of classic tumor suppressor genes in Example 3 of the present invention. Detailed Implementation

[0023] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0024] This invention successfully constructed a spontaneously generated Coelomocyte (CC) tumor model in *C. elegans* through gene editing. The reasons for choosing CC cells to construct the tumor model are mainly twofold: 1) Normal nematodes contain only six CC cells in a fixed location, greatly facilitating researchers' monitoring and evaluation of tumor cell proliferation; 2) These CC cells are located within the nematode's body cavity, and their unique anatomical position provides ample physical space for tumor cell proliferation and a unique platform for simulating the migration and invasion behavior of tumor cells in a three-dimensional in vivo environment. This model utilizes the specific overexpression of cell cycle regulatory genes in CC cells. cdk-4 and cyd-1 This causes CC cells to enter the cell cycle, resulting in abnormal proliferation (e.g., Figure 1As shown in the figure, and based on this, CC-specific GFP markers and FLP / FRT cell lineage tracking systems are introduced to achieve in vivo tracking of tumor cells.

[0025] The technical solution of the present invention will be described below through the following embodiments. In the embodiments, the source information of the relevant raw materials and genes is as follows: Plasmid pBN154: from Addgene public plasmid library (catalog number #86718); Plasmid pBN258: from Addgene public plasmid library (catalog number #86721); Report plasmid: pRF4 - rol-6 (su1006) , pCFJ90 - P myo-2 ::mCherry (Addgene, item number #19327), pCFJ350 - Cb- unc-119 (+) (Addgene product number #34866); cep-1 RNAi: Purchased from the MRC library, targeting... cep-1 RNAi cloning primers F (SEQ ID NO.1): AAAAATTCTAGGCCAGTCTGGAG; R (SEQ ID NO.2): TTGTGAAAACAAATTAGGCGATT; lin-35 RNAi: Purchased from the MRC library, targeting... lin-35 RNAi cloning primers: F (SEQ ID NO.3): CTGGAAGACGTTTCCGTGAT; R (SEQ ID NO.4): GGTCTTCCAAGTTCGTCTCG; Wild-type Caenorhabditis elegans chassis worm strain: Bristol N2 strain, available from the Nematode Genetic Center (CGC); pPD95.75 vector: provided by Addgene (catalog number #1494); cdk-4 Amplification was performed using primers F (SEQ ID NO.5): ATCCAAAATGTGCGAGAATCTTT; R (SEQ ID NO.6): TCACTTGTTGAAGTTGATTTGCTTG. cdk-4 The genome sequence; cyd-1 Amplification was performed using primers F (SEQ ID NO.7): ATGGACTTTGAGTCGTCGTCGG; R (SEQ ID NO.8): TCATAAAGTCTTGAAGATCTTCGGC. cyd-1The genome sequence; cup-4 Promoter (Pcup-4): Amplification primer F (SEQ ID NO.9): TTCTGCAACTGATCACATTGTACCT; R (SEQ ID NO.10): TTCACTGATACCTTTACTTTTTCTAAAAAA; eft-3 Promoter: Amplification primer F (SEQ ID NO.11): GCACCTTTGGTCTTTTATTGTCAA; R (SEQ ID NO.12): GTGTTTCCCAACTGAAAAAAAAACA; Green fluorescent protein (GFP): cloned from pBN154 (Addgene #86718) plasmid; mCherry: cloned from pBN154 (Addgene #86718) plasmid; FRT recombination identification site (SEQ ID NO.14): gaagttcctattctctagaaagtataggaacttc; his-58 Gene: Gene ID: 186251.

[0026] Example 1 In this embodiment, a CC cell-specific promoter is constructed to drive cell cycle genes. cdk-4 and cyd-1 Overexpressed transgenic insect strains, such as Figure 1 As shown, it includes the following steps: 1) The length is 2334 bp cup-4 promoter and complete cdk-4 The coding sequence was inserted into the pPD95.75 vector to complete the construction of the Pcup-4::cdk-4 plasmid.

[0027] 2) The length is 2334 bp cup-4 promoter and complete cyd-1 The coding sequence was inserted into the pPD95.75 vector to complete the construction of the Pcup-4::cyd-1 plasmid.

[0028] 3) Using microinjection technology, Pcup-4::cdk-4 and Pcup-4::cyd-1 plasmids, both at a concentration of 20 ng / μL, along with the reporter plasmid, were injected into the gonads of wild-type young adult nematodes. Stable free-type transgenic worms were then isolated from their offspring. Finally, stable integrated transgenic worms were obtained using ultraviolet irradiation.

[0029] Figure 1 This diagram illustrates the mechanism and model construction principle of somatic tumor induction in *C. elegans*, showcasing the molecular regulatory processes within the coelomic cells (CC) of *C. elegans* after genetic engineering. Specific promoter P... cup-4 Activated only in the coelomic cells (CC) of nematodes, precisely driving downstream... cdk-4 and cyd-1 Gene transcription and translation. Figure 1 The right-hand magnified nuclear module shows that the CDK-4 and CYD-1 protein complex activates the transcription factor E2F, inducing gene expression during the DNA synthesis phase (S phase), thereby prompting the cell to enter the cell cycle and begin mitosis. This approach overcomes the proliferation limitations of CC cells, providing a theoretical basis for their subsequent disordered clonal proliferation (i.e., tumor formation).

[0030] The following Examples 2 and 3 respectively constructed P cup-4 ::GFP monochromatic labeling model, and P-based eft- 3 and P cup-4 The FLP / FRT two-color cell lineage tracing model with promoter combinations will serve as a validation tool for subsequent evaluation.

[0031] Example 2 In this embodiment, the construction of a transgenic insect strain driven by the CC-specific promoter Pcup-4 to express green fluorescent protein (GFP) specifically includes the following steps: 1) The length is 2334 bp cup-4 The promoter and GFP coding sequence were inserted into the pPD95.75 vector to complete the construction of the Pcup-4::GFP plasmid.

[0032] 2) The Pcup-4::GFP plasmid was injected into the gonads of wild-type young adult nematodes at a concentration of 10 ng / μL using microinjection technology. Stable free transgenic nematode strains were then isolated from their offspring. Finally, stable integrated transgenic nematode strains were obtained by ultraviolet irradiation.

[0033] Example 3 In this embodiment, the FLP / FRT cell lineage tracing system is constructed to mark transgenic insect strains from CC-derived cells, specifically including the following steps: 1) The pBN154[Phsp16.41::FRT::mCherry::his-58::FRT::gfp::his-58] hsp- 16.41 The heat-stimulated promoter was replaced with one that is widely expressed throughout the body. eft-3 Promoter (600 bp).

[0034] 2) Using the classic MosSCI technique, a transgenic insect strain with site-directed integration of Peft-3::FRT::mCherry::his-58::FRT::gfp::his-58 was constructed. 3) P of pBN258[Punc-119::FLP D5] unc-119 The promoter was replaced with the CC-specific promoter Pcup-4 (2334 bp).

[0035] 4) Using microinjection, 50 ng / μL Pcup-4::FLP D5 plasmid, along with a reporter plasmid, was injected into the gonads of wild-type young adult nematodes. Stable free-type transgenic nematode strains were then isolated from their offspring. Finally, stable integrated transgenic nematode strains were obtained using ultraviolet irradiation.

[0036] 5) Peft-3::FRT::mCherry::his-58::FRT::gfp::his-58 Transgenic insect strains and Pcup- 4:: FLP D5 Transgenic nematode strains were hybridized, and the offspring were selected through self-pollination to obtain homozygous nematode strains with two genes.

[0037] Example 4 In this embodiment, the transgenic insect strains prepared in Examples 1-3 were subjected to hybridization screening to construct fluorescently labeled CC tumor model insect strains; specifically, the following two schemes were included: 1) Pcup-4:: cdk-4; Pcup-4:: cyd-1 Nematode strains and Pcup-4::gfp Nematode strains were hybridized, and the offspring were selected through self-pollination to obtain stable genetic strains with excessive CC cell proliferation and marked with green fluorescent protein (GFP).

[0038] 2) Pcup-4:: cdk-4; Pcup-4:: cyd-1 Nematode strains and Peft-3::FRT::mCherry:: his-58::FRT::gfp::his-58; Pcup-4::FLP D5 Nematode strains were hybridized, and the offspring were selected through self-pollination to obtain stable genetic strains with excessive proliferation of CC cells. All daughter cell nuclei produced by CC cell proliferation were marked in green, while nuclei from other non-CC sources were marked in red.

[0039] Example 5 To verify whether the above model successfully simulates the pathological characteristics of solid tumors, the following experiments were conducted in this embodiment: 1. Confirmation of tumor morphology and lineage origin; Figure 2 This is a single-color in vivo imaging image of GFP-labeled tumor cells that specifically overexpress and cause CC cell proliferation to form tumor-like masses; among them, the GFP single-color labeled tumor model cultivated in Example 3 and the wild-type control group model were selected for in vivo imaging observation. Figure 2 It can be seen from the data that: in the control group ( Figure 2 In the two images above, normal nematode CC cells are discrete single-celled (indicated by the arrows) and their number is constant. In the CC tumor group ( Figure 2 (The two sub-images below) are over-expressed cdk-4 and cyd- 1 This resulted in an abnormal increase in green-labeled CC cells, forming a dense, tumor-like mass structure (indicated by the arrow). Conclusion: This demonstrates the successful induction of massive abnormal proliferation of CC cells in vivo.

[0040] Figure 3This is a two-color cell lineage tracing imaging image based on the FLP / FRT system to distinguish CC progeny cells. The two-color tracing tumor model from Example 4 was used for imaging, with different fluorescence channels used to distinguish cell nuclei of different origins. It can be seen that the green channel (GFP::HIS-58) specifically labels CC and its progeny cell nuclei, while the red channel (mCherry::HIS-58) labels nuclei of other tissue cells not originating from CC. Combined channel analysis shows that in the tumor group, the numerous aggregated cell nuclei are all green, while the nuclei of peripheral tissue cells are red. This demonstrates that the two-color tracing results exclude interference from surrounding normal tissue cells, accurately confirming that the abnormally proliferating, tightly packed clusters are entirely derived from primary CC cells, belonging to clonal proliferation.

[0041] 2. Assessment of tumor growth kinetics and malignant biological characteristics Figure 4 This is a plot showing the progressive amplification trend of tumors under GFP monochrome labeling. Figure 5 This diagram illustrates the observation of the progressive growth trend of tumors using a two-color system. The single-color model (recording days 3, 5, and 10) and the two-color model (recording days 1, 4, and 7) were used to continuously track the dynamic changes of CC cells in nematodes with age. The diagram shows that in the control group, the number of CC cells remained constant and showed no proliferation at any time point; while in both CC tumor models, the luminescent cell clusters exhibited a clear progressive growth trend with increasing culture days. This demonstrates that the CC tumor model of this invention highly reproduces the progressive growth kinetics of mammalian somatic solid tumors.

[0042] Figure 6 This image shows the diffusion and migration of CC tumor cells within late-stage adult nematodes, including microscopic fluorescence detection of CC-tumored nematodes that entered old age on day 19. The image reveals that the late-stage CC tumor mass is enormous, occupying approximately one-third of the nematode's body space. Simultaneously, outside the dashed box (indicated by the arrow), green fluorescent CC-derived cells were observed detaching from the main mass and dispersing to other areas of the nematode. This indicates that, thanks to the physical space provided by the body cavity, these proliferating cells possess a certain migratory potential, providing a platform for subsequent research on invasion and metastasis.

[0043] 3. Tumor molecular characteristics and pathogenicity assessment Figure 7 This figure shows the analysis results of the relative upregulation of homologous genes of classic human tumor markers in CC proliferating cells through single-cell RNA sequencing; the results show that: Single-cell RNA sequencing was performed on extracted cells, and the expression levels of homologous genes were compared; it can be seen that: lin-40, lin-12, ect-2The relative expression levels of classic human tumor marker homologous genes were significantly upregulated in the tumor group, indicating that the cell clusters that induce proliferation also possess real tumor characteristics at the molecular level.

[0044] Figure 8 This graph compares the survival rates of nematodes carrying CC tumors with those of the normal control group. The survival status of nematodes in both groups was recorded from day 0 to 15, and survival rate curves were plotted. The graph shows that the survival rate of nematodes in the CC tumor group (red line) was significantly lower than that in the control group (black line) over time. This demonstrates that the CC tumors generated by this model pose a substantial threat to the organism's survival, accelerate individual death, and successfully simulate the pathogenicity and malignant pathological characteristics of tumors.

[0045] 4. Feasibility verification of high-throughput environment, metabolism, and gene screening Figure 9 This image shows the fluorescence imaging and quantitative results of the effect of high-temperature culture conditions (25℃) on tumor growth. Figure 10 This diagram illustrates the effect of a high-glucose diet (adding 4% glucose to NGM and OP50 diets) on tumor growth. The diagram shows the tumor area (µm²) of a CC tumor model exposed to both high-temperature culture and high-glucose diet conditions, compared using stereofluorescence microscopy with that under standard conditions (20℃, standard NGM medium). 2 Compare them.

[0046] Two pictures ( Figure 9 and Figure 10 The right-hand bar charts for quantitative analysis all showed that the size of green fluorescently labeled tumors significantly increased compared to the control group after high-temperature or high-glucose treatment. This indicates that this model has similar sensitivity to environmental and metabolic risk factors as mammalian tumors, and possesses the potential for assessing external conditions that promote cancer.

[0047] Figure 11 Fluorescence imaging and quantitative analysis of nematode CC tumor growth significantly inhibited by life-extending treatment conditions; among which, the following was introduced daf-2 Gene loss of function was used to construct a genetic physiological state that prolongs host lifespan, and its impact on tumor area was assessed. It can be seen that tumor size was significantly suppressed in the lifespan extension group, with a much smaller area than the control group. This verifies that changes in the host's physiological metabolic state can significantly regulate tumor development in the model.

[0048] Figure 12 This image shows fluorescence imaging and quantitative analysis of the impact of classic tumor suppressor gene dysfunction on tumor growth; specifically, RNAi technology was used to knock down evolutionarily conserved classic tumor suppressor genes in a CC tumor model. cep-1 (Corresponding to human TP53) and lin-35 (Corresponding to human RBL1), and quantifying changes in tumor size. The figure shows that compared to the control group, cep-1 RNAi group and lin-35 The tumor cross-sectional area in the RNAi group showed a significant increase. This indicates that the model of this invention possesses high species conservation in gene molecular regulatory mechanisms and can serve as a stable and reliable positive indicator identification tool, which can be directly applied to large-scale forward or reverse screening of oncogenes / tumor suppressor genes and corresponding targeted anti-tumor drugs.

[0049] In the description of this specification, references to terms such as "an embodiment," "example," "specific example," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the invention. In this specification, illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples.

[0050] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the claimed invention.

Claims

1. A method for constructing a somatic tumor model of *C. elegans*, characterized in that, Includes the following steps: A cell cycle regulation gene overexpression system was established in wild-type Caenorhabditis elegans, the overexpression system containing cell cycle regulation genes driven by coelomic cell-specific promoters; Overexpression of the cell cycle regulatory genes induces the coelomic cells to enter the cell cycle and undergo clonal proliferation, resulting in a Caenorhabditis elegans somatic cell tumor model carrying coelomic cell tumor masses.

2. The method for constructing a somatic tumor model of *C. elegans* according to claim 1, characterized in that, The steps for establishing the overexpression system include: Will include cdk-4 Gene coding sequence linking cup-4 The first expression plasmid of the promoter, and containing... cyd-1 Gene coding sequence linking cup-4 The second expression plasmid of the promoter was introduced into wild-type Caenorhabditis elegans.

3. A method for constructing a Caenorhabditis elegans somatic cell tumor model according to claim 1 or 2, characterized in that, The construction method further includes: linking the green fluorescent protein coding sequence to... cup-4 The promoter labeling vector was introduced into the *C. elegans* to specifically fluorescently label the coelomic tumor mass.

4. A method for constructing a Caenorhabditis elegans somatic cell tumor model according to claim 1 or 2, characterized in that, The construction method further includes: introducing an FLP / FRT cell lineage tracking system, which is used to specifically fluorescently label the nuclei of daughter cells generated by the proliferation of the coelomic cells.

5. The method for constructing a Caenorhabditis elegans somatic cell tumor model according to claim 4, characterized in that, The steps for introducing the FLP / FRT cell lineage tracing system include: A recombinant expression cassette containing a global expression promoter was introduced into Caenorhabditis elegans. The recombinant expression cassette contained, in sequence, an FRT sequence, a first fluorescent protein sequence, a first group protein sequence, an FRT sequence, a second fluorescent protein sequence, and a second group protein sequence. Will contain the FLP recombinase coding sequence linked cup-4 The promoter recombinase vector was introduced into *C. elegans*. Through hybridization and self-crossing screening, a double-gene homozygous nematode strain carrying the overexpression system, the recombinant expression cassette, and the recombinase vector was obtained.

6. A somatic tumor model of *C. elegans*, characterized in that, It is constructed using the construction method described in any one of claims 1-5.

7. A method for identifying tumor regulatory genes, characterized in that, Includes the following steps: The Caenorhabditis elegans somatic cell tumor model described in claim 6 was divided into an experimental group and a control group; The target genes in the experimental group were subjected to loss-of-function manipulation, while the control group was not subjected to loss-of-function manipulation. Obtain and compare the volume difference data of the coelomic tumor masses in the experimental group and the control group; Based on the volume difference data, the target gene to be tested is determined to be a tumor suppressor gene or a tumor promoter gene.

8. The method for identifying tumor regulatory genes according to claim 7, characterized in that, The step of determining whether the target gene to be tested is a tumor suppressor gene or a tumor promoter gene includes: if the tumor volume of the experimental group is significantly larger than that of the control group, then the target gene to be tested is determined to be a tumor suppressor gene; wherein, the loss-of-function operation is implemented using RNA interference technology.

9. A method for assessing the influence of environmental or metabolic factors on tumor growth, characterized in that, Includes the following steps: The Caenorhabditis elegans somatic cell tumor model described in claim 6 was divided into an experimental group and a control group; The experimental group was placed under preset test environment conditions or test diet conditions, while the control group was placed under standard culture conditions; Acquire and compare the amplification data of coelomic tumor masses in the experimental group and the control group; Based on the comparison results of the amplified data, the promoting or inhibiting effects of the corresponding test environment or metabolic factors on the growth of the body cavity cell tumor mass are quantitatively evaluated.

10. The application of the Caenorhabditis elegans somatic tumor model of claim 6 in identifying tumor regulatory genes and assessing the effects of environmental or metabolic factors on tumor growth.

Images