Application of caspase8 gene in creating anti-virus offspring of puzhou crucian

Abstract

The application belongs to the technical field of aquatic breeding, and particularly relates to application of Caspase8 in creating anti-virus Pengze crucian sub-offspring. The application finds that Pengze crucian Caspase8 has a negative regulation effect in anti-virus immune response, a gRNA targeting Pengze crucian Caspase8 gene is designed by using CRISPR-Cas9 technology to knock out the Pengze crucian Caspase8 gene, and F0 generation chimeras are obtained. It is found that the anti-virus gene expression of the F0 generation chimeras Pengze crucian in vivo is significantly up-regulated, and the protein level of Caspase8 is significantly reduced. At the same time, the F2 generation homozygous mutant of Caspase8 is further screened by Pengze crucian gynogenesis. Under the infection of CyHV2 virus, the survival rate of the Caspase8 mutant is higher than that of the wild type Pengze crucian. The Pengze crucian with Caspase8 gene knocked out prepared by the creation method of the application improves the anti-virus level of Pengze crucian, provides new germplasm for anti-virus breeding of Pengze crucian, and provides an important reference for anti-disease breeding of other economic fish.

Description

Technical Field

[0001] This invention belongs to the field of aquatic breeding technology, specifically involving the application of Caspase8 in the creation of virus-resistant Pengze crucian carp offspring. Background Technology

[0002] Cysteinyl aspartate-specific proteinases (Caspases) primarily function in maintaining cell homeostasis and regulating programmed cell death. Caspase 8, a key member of the Caspase family, plays a central role in regulating FAS-mediated apoptosis. Activation of the FAS receptor activates downstream pathways mediated by Caspase 8, namely tumor necrosis factor-mediated apoptosis. Some studies have suggested that Caspase 8 plays a role in resisting various pathogenic infections, but the specific mechanisms remain unclear.

[0003] Aquaculture contributes to global food supply and food security. Among the various freshwater fish species farmed in China, crucian carp is the most abundant, and it is a key species in Chinese freshwater fish farming. The Pengze crucian carp is (…). Carassius auratus The Pengze crucian carp (var. Pengze) is a high-quality farmed fish bred by the Jiangxi Provincial Fisheries Research Institute and the Jiujiang Municipal Fisheries Research Institute, and is one of the five key freshwater fish species promoted nationwide. However, the Pengze crucian carp also faces the risk of disease invasion. Major diseases affecting the Pengze crucian carp include bacterial septicemia, hematopoietic organ necrosis caused by herpesvirus, and parasitic diseases. Meanwhile, the "wintering syndrome" that has emerged in recent years has also plagued Pengze crucian carp farming, and its cause remains unclear. Therefore, it is necessary to create disease-resistant Pengze crucian carp to improve the farming efficiency and promote industrialization. Summary of the Invention

[0004] The purpose of this invention is to overcome the current problem of lack of disease-resistant Pengze crucian carp germplasm and to propose the application of Caspase8 in the creation of disease-resistant Pengze crucian carp offspring.

[0005] To achieve the above objectives, the technical solution of the present invention is implemented as follows: In one aspect, the present invention discloses the application of the Caspase8 gene of Pengze crucian carp in disease-resistant breeding, wherein the Caspase8 gene of Pengze crucian carp negatively regulates the antiviral immune response, and downregulating the expression of the Caspase8 gene yields F0 generation Pengze crucian carp chimeras.

[0006] In some embodiments, the expression of the Caspase8 gene is downregulated by CRISPR gene knockout; preferably, the downregulation is selected from gene expression reduction or gene function loss.

[0007] In some embodiments, the sgRNA sequence Caspase8-gRNA targeting the Caspase8 gene in the gene knockout is shown in SEQ ID No. 1.

[0008] In some embodiments, the amplification primer sequences for the Caspase8-gRNA are shown in SEQ ID No. 2 and SEQ ID No. 3.

[0009] In one aspect, this invention discloses a breeding method for a disease-resistant variety of Pengze crucian carp, the method comprising: (1) The Caspase8 gene in Pengze crucian carp eggs was knocked out using the gene knockout method; (2) Artificial insemination of the gene-knockout fish eggs and hatching to obtain the F0 generation, and screening of the F0 generation Pengze crucian carp chimeras that successfully knocked out the gene; (3) The eggs produced by the F0 generation Pengze crucian carp chimera were artificially fertilized with Xingguo red carp and hatched through gynogenesis to produce the F1 generation; (4) Caspase8 knockout F1 generation Pengze crucian carp were obtained through target detection. The selected F1 generation Pengze crucian carp were then subjected to gynogenesis to become the Caspase8 homozygous deletion mutant line F2, which is the homozygous Caspase8 gene deletion Pengze crucian carp.

[0010] Preferably, the gene knockout method is the CRISPR-Cas9 gene knockout method.

[0011] Preferably, the sgRNA sequence Caspase8-gRNA targeting the Caspase8 gene in the gene knockout is shown in SEQ ID No. 1.

[0012] Preferably, the primer pairs used for target detection in step (4) are as shown in SEQ ID No. 4 and SEQ ID No. 5. In one aspect, the present invention discloses a breeding kit for disease-resistant varieties of Pengze crucian carp, the kit comprising a reagent for downregulating the expression of the Caspase8 gene in Pengze crucian carp.

[0013] Preferably, the reagent used to downregulate the expression of the Caspase8 gene in Pengze crucian carp is a CRISPR-Cas9 gene knockout reagent.

[0014] This invention discovers that knocking out Caspase8 in creating disease-resistant Pengze crucian carp progeny enhances the antiviral ability of Pengze crucian carp. Overexpression of Pengze crucian carp Caspase8 inhibits the mRNA expression levels of antiviral factors IFN, ISG15, Mx2, IL-8, IL-6, and TNF-α. Overexpression of Pengze crucian carp Caspase8 inhibits the transcriptional activity of disease-resistant factors IFN, ISRE, and NF-κB. Overexpression of Pengze crucian carp Caspase8 enhances GCRV virus replication.

[0015] In this invention, Caspase8 can be knocked out by CRISPR-Cas9 technology to obtain Pengze crucian carp Caspase8 knockout F0 chimera.

[0016] In some embodiments, the specific screening steps for F0 generation chimeras are as follows: juvenile fish individuals whose embryos have grown for one month after fertilization are lysed after the tail fin is cut off to obtain a PCR template. PCR amplification is performed using primers for the Caspase8 target site. The PCR product is verified by electrophoresis to check the size of the target band. If the amplified product is 280bp, sequencing is performed. If the sequencing results show overlapping peaks, it indicates that the Caspase8 gene knockout was successful.

[0017] In this invention, the survival rate of the F2 generation homozygous mutant of Pengze crucian carp was significantly higher than that of the wild-type Pengze crucian carp when challenged with CyHV2 herpesvirus.

[0018] Beneficial effects This invention identifies the negative regulatory role of Caspase8 in the antiviral immune response of crucian carp in Pengze: Caspase8 can inhibit the expression of immune factors such as IFN and NF-κB, thereby negatively regulating the antiviral response. Based on this, this invention utilizes CRISPR-Cas9 technology to design an sgRNA targeting the Caspase8 gene in Pengze crucian carp to knock out the Caspase8 gene. The resulting F0 generation chimeras showed significantly upregulated expression of antiviral genes and a significant reduction in Caspase8 protein levels. Furthermore, homozygous mutants were obtained through F1 and F2 generation selection. Finally, antiviral infection experiments confirmed that the Caspase8 knockout mutant significantly enhances the antiviral ability of Pengze crucian carp. The gene editing creation method of this invention improves the antiviral ability of Pengze crucian carp, providing new germplasm for disease-resistant breeding of Pengze crucian carp. Attached Figure Description

[0019] Figure 1To illustrate the method for inhibiting the mRNA levels of antiviral factors by overexpressing Caspase8 in crucian carp under GCRV virus infection as described in this embodiment of the invention: A represents IFN expression, B represents ISG15 expression, C represents Mx2 expression, D represents IL-8 expression, E represents IL-6 expression, and F represents TNF-α expression. Figure 2 To illustrate the use of GCRV virus infection as described in this embodiment of the invention, gradient overexpression of Pengze crucian carp Caspase8 inhibits the transcriptional activity of antiviral factors: A represents IFN promoter activity, B represents ISRE promoter activity, and C represents NF-κB promoter activity.

[0020] Figure 3 To illustrate the effect of GCRV virus infection on the replication of crucian carp by overexpression of Caspase8, as described in this embodiment of the invention: A shows the pathological effect of GCRV-infected cells observed by crystal violet staining, and B shows the expression level of GCRV virus capsid protein VP5.

[0021] Figure 4 To illustrate the use of CRISPR-Cas9 technology to target and knock out Caspase8 in Pengze crucian carp to obtain Caspase8 knockout F0 chimeras as described in this embodiment of the invention: Figure A is a schematic diagram of the target mutation site of the Caspase8 gene in Pengze crucian carp, and Figure B is a sequencing peak diagram of successful Caspase8 gene knockout in Pengze crucian carp.

[0022] Figure 5 This refers to the expression of Caspase 8 in the tail fin protein of the F0 generation of Pengze crucian carp with Caspase 8 knockout, as described in this embodiment of the invention.

[0023] Figure 6 The expression levels of antiviral factors IFN and ISG15 in the tail fins of the F0 generation of Pengze crucian carp with Caspase8 knockout, as described in this embodiment of the invention.

[0024] Figure 7 This refers to the expression of Caspase 8 in the tail fin protein of the F2 generation of Pengze crucian carp with Caspase 8 knockout, as described in this embodiment of the invention.

[0025] Figure 8 The survival rates of the Pengze crucian carp Caspase8 knockout F2 generation fish and wild-type fish after infection with CyHV2 herpesvirus, as described in this embodiment of the invention. Detailed Implementation

[0026] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. Unless otherwise specified, the equipment and reagents used in the embodiments and experimental examples are commercially available. Unless otherwise stated, all reagents used in this invention are analytical grade reagents. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention.

[0027] Example 1: Caspase 8 inhibits the expression of immune-related factors in Pengze crucian carp after reovirus (GCRV) infection. Utilizing Lipo8000 TM Transfection reagent (Beyotime, C0533) was used to transfect Basic-pcDNA3.1 and Caspase8-pcDNA3.1 plasmids into crucian carp blastocyst cells (CAB) at a ratio of 2:1 (reagent volume: plasmid mass). In the absence of GCRV infection, the expression levels of IFN-I, ISG15, Mx2, IL-6, IL-8, and TNF-α genes were detected by quantitative real-time PCR after Caspase8 overexpression. No significant differences were found between the Caspase8 overexpression group and the Basic control group. However, under GCRV stimulation, the expression levels of IFN-I, ISG15, Mx2, IL-6, IL-8, and TNF-α genes were significantly decreased after Caspase8 overexpression compared to the Basic control group. Figure 1 Therefore, Caspase8 in Pengze crucian carp inhibits the expression of immune-related factors under viral infection, negatively regulating the immune response of Pengze crucian carp.

[0028] Example 2: Gradient overexpression of Caspase 8 in crucian carp of Pengze inhibits promoter activity of immune factors after reovirus (GCRV) infection. Utilizing Lipo8000 TM Transfection reagent (Beyotime, C0533) was used to transfect Basic-pcDNA3.1 (1µg, 2µg) and Caspase8-pcDNA3.1 (1µg, 2µg) plasmids into crucian carp blastocyst cells (CAB) at a transfection reagent volume: plasmid mass ratio of 2:1. Under GCRV infection, using dual-luciferase reporter assay, the ability to inhibit the promoter activity of IFN, ISRE, and NF-κB immune factors increased with increasing Caspase8-pcDNA3.1 plasmid transfection amount. Figure 2 Therefore, this further confirms that Caspase8 in Pengze crucian carp plays a negative regulatory role in the antiviral response.

[0029] Example 3: Overexpression of Caspase 8 in crucian carp enhances GCRV virus replication. Using Lipo8000 TM Transfection reagent (Beyotime, C0533) was used to transfect Basic-pcDNA3.1 and Caspase8-pcDNA3.1 plasmids into crucian carp blastocyst cells (CAB) at a ratio of 2:1 (reagent volume: plasmid mass). Cytopathic effects were analyzed by crystal violet staining after Caspase8 overexpression in both GCRV-infected and uninfected states. The results showed that even without GCRV infection, Caspase8 overexpression caused a small amount of cell death. However, after GCRV infection, compared to the control group, Caspase8 overexpression caused significant cell death, indicating that Caspase8 overexpression enhanced the viral infection process. Figure 3 ).

[0030] Example 4: CRISPR-Cas9 technology to knock out Caspase 8 in Pengze crucian carp First, the complete sequence of the crucian carp Caspase8 gene (Gene ID: XM_026259219.1) was found using NCBI. A gRNA target sequence was designed at position 378 bp of the second exon: GGGTAGAGGAGTACAGGGCT (SEQ ID No. 1). A pair of amplification primers were designed upstream and downstream of the target site for this test. The amplified fragment of Caspase 8 was detected to be 350 bp, and the primer sequence was: Caspase 8-F: GACTGAGATGGAAAAGCT (SEQ ID No. 4). Caspase8-R: CCAATAGGAGGCAGACTT (SEQ ID No.5) The gRNA was amplified by PCR using the upstream primer Caspase8-gRNA-F with a Caspase8 target site: GTAATACGACTCACTATAGGGTAGAGGAGTACAGGGCTGTTTTAGAGCTAGAAATAGC (SEQ ID No. 2) and the conserved downstream primer Caspase8-gRNA-R: AAAAGCACCGACTCGGTGCC (SEQ ID No. 3).

[0031] The amplification system is as follows: ; Take 2 μl of the product for agarose gel electrophoresis to check if it is a single band. Recover the product at a concentration greater than 100 μg / ml using a PCR Cleanup Kit for in vitro transcription. Use an in vitro transcription kit to transcribe the target sequence into RNA. In vitro transcription of gRNA was performed using the MAXIscript T7 Kit. The transcription system is as follows: ; After gently mixing, briefly centrifuge, seal, and incubate in a 37°C water bath for 1 h; add 1 μL DNase I, react at 37°C for 15 min to digest the remaining DNA template; add 1 µL EDTA, incubate at 60°C for 10 min to terminate the reaction; add 30 µL Nuclease-free water and 5 µL Ammonium Acetate, mix well; add 3 times the volume (165 µL) of 100% ethanol; precipitate at -80°C for 4 h; incubate at 4°C, 14000 rpm for 15 min; discard the supernatant, wash with 1 mL of 70% ethanol, incubate at 4°C, 14000 rpm for 15 min; repeat the previous step; discard the supernatant, air dry for 1 min, dissolve in 20 µL Nuclease-free water, take 1 µL to measure the RNA concentration using a NanoDrop 2000 nucleic acid quantification instrument, aliquot, and store at -80°C for later use.

[0032] 2 µL of 300 ng / µL Caspase8-sgRNA (SEQ ID No. 1), 0.5 μL of 10×Cas9 protein, and 2.5 μL of nuclease-free water were mixed. Approximately 1 nL of the mixture was injected into each mature Pengze crucian carp egg using a nitrogen-pressurized quantitative microinjection apparatus, with about 300 eggs injected each time. 20 uninjected eggs served as a control. Sperm from male Xingguo red carp was used for artificial insemination with the injected Pengze crucian carp eggs. The fertilized eggs were transferred to an incubation tank at 22–23℃ to obtain the F0 generation. The F0 generation Pengze crucian carp embryos were incubated at 24℃. Newly hatched fry were fed soybean milk, and after two weeks, they were fed fresh brine shrimp. At two months of age, a small amount of DNA was extracted from the tail fin. Using this DNA as a template, PCR was performed using target detection primers (SEQ ID No. 4, SEQ ID No. 5). The PCR products were detected by gel electrophoresis and sequenced. The results showed overlapping peaks at the designed knockout target site (e.g., Figure 4 As shown in the image, this indicates that the knockout was successful.

[0033] Example 5: In vivo efficacy verification of knocking out Caspase 8 in Pengze crucian carp The obtained F0 generation caudal fins were homogenized, and protein lysis buffer NP40 (containing protease inhibitors) was added. After vigorous shaking for 30 min, the tissue protein was obtained by centrifugation. Then, the expression of Caspase 8 protein in the F0 generation caudal fins was detected by Western blot. The results showed that the expression level of Caspase 8 protein in the F0 generation caudal fins was significantly lower than that in the wild type. Figure 5 Another portion of the F0 generation tail fins was used to extract tissue RNA, and then the expression of immune factors IFN and ISG15 was detected by real-time PCR. The results showed that knocking out Caspase8 significantly enhanced the expression of IFN and ISG15. Figure 6 ).

[0034] Eggs from the successfully knocked-out F0 generation chimeras were artificially fertilized with Xingguo red carp and hatched via gynogenesis to produce the F1 generation. At two months of age, a small amount of caudal fin DNA was extracted. Using this DNA as a template, PCR was performed using target detection primers (SEQ ID No. 4, SEQ ID No. 5). The PCR product was TA cloned, and positive strains were obtained through blue-white screening. Sequencing confirmed the mutation type, resulting in the Caspase8 knockout F1 generation Pengze crucian carp. The selected F1 generation Pengze crucian carp underwent gynogenesis to obtain the Caspase8 homozygous deletion mutant line F2. The final homozygous Caspase8 gene-deleted Pengze crucian carp was obtained. Caudal fins of the F2 generation Pengze crucian carp were excised, homogenized, and subjected to vigorous shaking with NP40 protein lysis buffer (containing protease inhibitors). After 30 min of vigorous shaking, the tissue protein was obtained by centrifugation. Western blot analysis of Caspase8 protein expression in the F2 generation caudal fins showed that Caspase8 protein was not expressed in the F2 generation caudal fins, indicating successful screening of the homozygous mutant. Figure 7 ).

[0035] Example 6: Caspase 8 knockout enhances the anti-herpesvirus CyHV2 ability of Pengze crucian carp. First, wild-type Pengze crucian carp and F2 generation Caspase 8 knockout Pengze crucian carp, each approximately 10 g in size, were used for testing. The fish were kept in tanks at 24℃, 30 fish per tank, for one week to observe for any abnormalities. The wild-type Pengze crucian carp and F2 generation Caspase 8 knockout Pengze crucian carp were then divided into CyHV2-infected and non-infected groups. The infected group received an intraperitoneal injection of 10 μL CyHV2 per fish, while the non-infected group received an equal volume of physiological saline. Mortality was then observed for 14 days, with the number of dead individuals recorded daily. Dead individuals were promptly removed to maintain water cleanliness, and the survival rate of the Pengze crucian carp was statistically analyzed. The results showed that the wild-type and F2 generation Caspase 8 knockout fish in the non-Caspase 2-infected group... mutOne crucian carp from Pengze was killed in each knockout group, resulting in a survival rate of 96.7%. In the CyHV2 virus-infected group, the wild-type survival rate was 13.5%, while the survival rate of the Caspase8 knockout Pengze crucian carp was 63%, indicating that the Caspase8 knockout Pengze crucian carp possesses significant resistance to CyHV2 virus. Figure 8 ).

[0036] The above description, in conjunction with specific embodiments, provides a further detailed explanation of the present invention. It should not be construed that the specific implementation of the present invention is limited to these descriptions. For those skilled in the art, several simple deductions or substitutions can be made without departing from the concept of the present invention, and all such deductions or substitutions should be considered to fall within the scope of protection defined by the claims submitted herein.

Claims

1. An application of the Caspase8 gene in disease-resistant breeding of Pengze crucian carp, characterized in that, The Caspase8 gene in Pengze crucian carp negatively regulates the antiviral immune response, and downregulating the expression of the Caspase8 gene yields F0 generation Pengze crucian carp chimeras.

2. The application according to claim 1, characterized in that, The expression of the Caspase8 gene is downregulated by CRISPR gene knockout; preferably, the downregulation is selected from gene expression reduction or gene function loss.

3. The application according to claim 1, characterized in that, The sgRNA sequence Caspase8-gRNA targeting the Caspase8 gene in the gene knockout is shown in SEQ ID No.

1.

4. The application according to claim 3, characterized in that, The amplification primer sequences for the Caspase8-gRNA are shown in SEQ ID No. 2 and SEQ ID No.

3.

5. A breeding method for a disease-resistant variety of Pengze crucian carp, characterized in that, The method includes: (1) The Caspase8 gene in Pengze crucian carp eggs was knocked out using the gene knockout method; (2) Artificial insemination of the gene-knockout fish eggs and hatching to obtain the F0 generation, and screening of the F0 generation Pengze crucian carp chimeras that successfully knocked out the gene; (3) The eggs produced by the F0 generation Pengze crucian carp chimera were artificially fertilized with Xingguo red carp and hatched through gynogenesis to produce the F1 generation; (4) Caspase8 knockout F1 generation Pengze crucian carp were obtained through target detection. The selected F1 generation Pengze crucian carp were then subjected to gynogenesis to become the Caspase8 homozygous deletion mutant line F2, which is the homozygous Caspase8 gene deletion Pengze crucian carp.

6. The breeding method for a disease-resistant variety of Pengze crucian carp according to claim 5, characterized in that, The gene knockout method is the CRISPR-Cas9 gene knockout method.

7. The breeding method for a disease-resistant variety of Pengze crucian carp according to claim 5, characterized in that, The sgRNA sequence of Caspase8-gRNA targeting the Caspase8 gene in the gene knockout of crucian carp in Pengze is shown in SEQ ID No.

1.

8. The breeding method for a disease-resistant variety of Pengze crucian carp according to claim 5, characterized in that, The primer pairs used for target detection in step (4) are shown in SEQ ID No. 4 and SEQ ID No.

5.

9. A breeding kit for a disease-resistant variety of Pengze crucian carp, characterized in that, The kit includes a reagent that downregulates the expression of the Caspase8 gene in crucian carp from Pengze; preferably, the anti-disease activity is against herpesvirus infection.

10. The breeding kit for disease-resistant varieties of Pengze crucian carp according to claim 9, characterized in that, The reagent used to downregulate the expression of the Caspase8 gene in Pengze crucian carp is a CRISPR-Cas9 gene knockout reagent.

Images