A perfluorooctanoic acid detection kit, method and application based on CRISPR-Cas12a and aptamer

Abstract

The application discloses a perfluorooctanoic acid detection kit and method based on CRISPR-Cas12a and aptamer, and application thereof, and belongs to the field of analytical chemistry. Biotin-labeled single-stranded complementary DNA is first combined with streptavidin-coated magnetic beads for fixation; aptamer-activated double-stranded DNA is then paired with comDNA by complementation, and is indirectly anchored on the magnetic beads to form a dsDNA biosensor containing a Cas12a cleavage site. After adding an analyte, the analyte is highly combined with the aptamer and induces the formation of a secondary structure, so that the aptamer is dissociated from the comDNA, and the aptamer-dsDNA combined with the analyte falls off from the magnetic beads into supernatant. After magnetic separation, free aptamer-dsDNA in the supernatant is collected, and a Cas12a reporting system is added: crRNA-Cas12a recognizes and cuts the dsDNA, activates the trans-cleavage activity of Cas12a, and further cuts a fluorescent reporting probe, so that the fluorescent group is separated from a quencher to generate fluorescence; on the contrary, without the dsDNA, the fluorescent group cannot be excited, that is, no light is emitted. The application can be used for high-specificity and high-sensitivity detection of perfluorooctanoic acid, and the detection speed is fast.

Description

Technical Field

[0001] This invention belongs to the field of analytical chemistry, specifically relating to a method for preparing a magnetic bead-complementary strand DNA@aptamer-activated double-stranded DNA biosensor and its application. This framework is suitable for the detection of perfluorooctanoic acid (PFOA). Background Technology

[0002] Perfluorooctanoic acid (PFOA) is a synthetic organic compound containing C–F bonds. Due to the high energy of the C–F bond and its strong chemical stability, it exhibits high persistence and is difficult to degrade in the environment and in organisms. It is widely used in various applications, including industrial, consumer, and fire-fighting foam (AFFF), and is therefore considered an important category of "permanent chemicals." Studies have shown that PFOA is associated with various adverse health conditions, including impaired immune function (e.g., decreased vaccine response), liver and kidney effects, endocrine disruption, metabolic abnormalities, reproductive / developmental toxicity, and increased risk of certain cancers. Kurwadkar et al. compiled monitoring data from 25 countries and found that the average concentration of PFOA in surface water can reach 130 ng / L, and the concentration of PFOA in the effluent of some wastewater treatment plants even exceeds 500 ng / L. [1] In addition, Pelch et al. (2023) used the 70-analyte LC–MS / MS method issued by the EPA (Environmental Protection Agency) to detect more than 45 PFAS in tap water samples from 12 states in the United States, including the novel alternatives ADONA and HFPO-DA. PFOA and PFOS were still the main contributors, with the highest total concentration reaching 120 ng / L. [2] The results show that a large number of "hidden" PFAS still exist outside the current EPA target list. Jiao et al. conducted extractable organic fluoride (EOF) mass balance analysis on tap water in Shanghai, China, and found that conventional LC-MS / MS can only explain 12-30% of the total organic fluoride sources, and the remaining "unknown fluoride" may come from unidentified precursors or polymeric PFAS. [3]

[0003] However, current PFOA detection primarily relies on instrumental analysis methods such as liquid chromatography-mass spectrometry (LC-MS). While these methods offer high sensitivity and accurate quantification, they often depend on complex sample preparation and large instrument platforms, typically involving steps such as solid-phase extraction, enrichment and purification, elution, concentration, and volume adjustment. This results in long detection cycles, demanding operational requirements, and poor on-site applicability. Particularly in environmental water samples, food packaging extracts, and complex biological samples, the presence of coexisting organic matter, surfactants, and salt ions significantly interferes with the identification and quantification of target analytes. In contrast, novel rapid detection technologies that avoid cumbersome sample preparation and offer both specific identification and signal amplification are becoming an important development direction for trace PFOA detection. [4]

[0004] In recent years, aptamers have attracted widespread attention in the detection of small molecule pollutants due to their advantages such as being obtainable through in vitro screening, easy to chemically modify, good stability, and low cost. Park et al. first successfully screened ssDNA aptamers that can recognize PFOA and constructed a fluorescent aptamer sensor with a dissociation constant for PFOA of approximately 5.5 μM and a detection limit of 0.17 μM. Subsequently, a ratiometric fluorescent aptamer sensor further advanced the PFOA detection limit to 27 nM, demonstrating the feasibility and application potential of the aptamer approach in PFOA recognition. [5]

[0005] Nevertheless, fluorescence or colorimetric sensing systems built solely based on aptamers may still be limited by factors such as insufficient signal amplification, limited dynamic range, and weak anti-interference ability in complex matrices. Niu et al. discovered by constructing an aptamer-Cas12a platform that can complete small molecule detection in about 20–25 minutes, with a simple system, strong versatility, and the potential to be expanded into plate-based reading, portable fluorescence readout, and even on-site visualization platforms. [6] Building on this, the introduction of CRISPR / Cas12a provides a new solution to the aforementioned problems.

[0006] Upon activation of specific nucleic acids, Cas12a exhibits non-specific cleavage activity against single-stranded DNA reporter probes, resulting in significant secondary signal amplification. Meanwhile, the aptamer transforms recognition events of non-nucleic acid small molecules like PFOA into nucleic acid signals responsive to Cas12a. The combination of these two technologies retains the aptamer's specific recognition ability for small molecule targets while leveraging Cas12a's trans-cleavage capability for rapid amplification. Therefore, it significantly surpasses traditional chromatography-mass spectrometry methods in terms of detection speed, sensitivity, portability, and potential for field applications, and is also superior to many single-aptamer sensing strategies that do not involve signal amplification.

[0007] However, from the perspective of existing technologies, aptamers and the CRISPR / Cas12a system belong to two completely different types of molecular recognition and signal amplification modules. Aptamers are essentially single-stranded nucleic acid molecules obtained through SELEX screening. Their core function is to achieve high-affinity and high-specificity "molecular recognition" of targets such as small molecules, proteins, and even cells. Their action is limited to target binding and conformational change induction, and they do not possess signal amplification or enzymatic catalysis capabilities. In contrast, the CRISPR / Cas12a system is a crRNA-guided endonuclease system. Its core function is to recognize and activate specific double-stranded DNA, further triggering a non-specific signal amplification effect of "collateral ssDNA trans-cleavage," achieving exponential amplification and detectable output of nucleic acid signals. Therefore, at the functional level, they correspond to "upstream recognition units" and "downstream signal amplification units," respectively, and there is no direct coupling relationship in traditional systems.

[0008] References

[0009] [1]Sudarshan Kurwadkar, Jason Dane, Sushil R. Kanel, Mallikarjuna N.Nadagouda, Ryan W. Cawdrey, Balram Ambade, Garrett C. Struckhoff, RichardWilkin, Per- and polyfluoroalkyl substances in water and wastewater: Acritical review of their global occurrence and distribution, Science of TheTotal Environment, Volume 809,2022,151003, ISSN 0048-9697, https: / / doi.org / 10.1016 / j.scitotenv.2021.151003.

[0010] [2]Katherine E. Pelch, Taryn McKnight, Anna Reade,70 analyte PFAStest method highlights need for expanded testing of PFAS in drinking water,Science of The Total Environment, Volume 876,2023,162978, ISSN 0048-9697,https: / / doi.org / 10.1016 / j.scitotenv.2023.162978.

[0011] [3]Enmiao Jiao, Pontus Larsson, Qi Wang, Zhiliang Zhu, Daqiang Yin,Anna Kärrman, Patrick van Hees, Patrik Karlsson, Yanling Qiu, and Leo W. Y.Yeung. Environmental Science & Technology 2023 57 (38), 14330-14339.DOI:10.1021 / acs.est.3c02718.

[0012] [4]Junyoung Park, Donghyun Kim, Dongyun Kim, Jihyeun Jung, Kyung-DukZoh, Changha Lee, Yongju Choi, and Jong Kwon Choe. Environmental Science &Technology 2025 59 (32), 17247-17257.DOI: 10.1021 / acs.est.5c04730.

[0013] [5]Junyoung Park, Kyung-Ae Yang, Yongju Choi, Jong Kwon Choe, NovelssDNA aptamer-based fluorescence sensor for perfluorooctanoic acid detection in water, Environment International, Volume 158,2022,107000, ISSN 0160-4120, https: / / doi.org / 10.1016 / j.envint.2021.107000.

[0014] [6]Chenqi Niu, Chuyi Wang, Fan Li, Xiang Zheng, Xinhui Xing, ChongZhang, Aptamer assisted CRISPR-Cas12a strategy for small moleculediagnostics, Biosensors and Bioelectronics, Volume 183,2021,113196, ISSN0956-5663, https: / / doi.org / 10.1016 / j.bios.2021.113196. Summary of the Invention

[0015] The purpose of this invention is to provide a CRISPR-Cas12a-aptamer detection method with specificity and sensitivity for perfluorooctanoic acid (PFOA), overcoming the shortcomings of traditional methods such as high cost, long time consumption, and cumbersome operation steps in the PFOA detection process, and filling the gap in rapid PFOA detection methods.

[0016] To achieve the above objectives, the present invention adopts the following technical solution:

[0017] A magnetic bead-complementary DNA@aptamer-activated double-stranded DNA biosensor includes activated double-stranded DNA (aptamer-dsDNA) hybridized with aptamer sequences, biotin-labeled single-stranded complementary DNA (comDNA), and streptavidin magnetic beads. The biotin-labeled single-stranded complementary DNA (comDNA) is bound and immobilized by streptavidin-coated magnetic beads. The activated double-stranded DNA (aptamer-dsDNA) is then indirectly anchored to the magnetic beads through complementary pairing with the comDNA, forming a biosensor containing dsDNA with a Cas12a cleavage site.

[0018] Streptavidin magnetic beads serve as immobilization carriers for nucleic acid loading, comDNA is a competitive complementary sequence, activating double-stranded DNA is used to activate Cas12a activity, and aptamers are recognition components used to capture target analytes.

[0019] Different target analytes can be detected by designing different aptamers.

[0020] The design of complementary DNA (comDNA) preferably follows these principles: GC content of 40%–60%, annealing temperature of approximately 35–45°C, complementary site length of 8–16 bp, and the complementary region should avoid forming stable secondary structures with the aptamer as much as possible.

[0021] The activated double-stranded DNA hybridized with the aptamer sequence is obtained by adding the aptamer, the forward primer dsDNA-F of the Cas12a activator dsDNA, and the reverse primer dsDNA-R to a buffer solution in a certain proportion, mixing them evenly, heat denaturing, and cooling to allow the nucleic acid molecules to fully anneal and pair.

[0022] This invention uses perfluorooctanoic acid (PFOA) as the analyte, and its aptamer (PFOA aptamer-F) sequence is as follows:

[0023] TACTCGGCGTGGGGGTGGTAGGCTGTAAAGGGGGTCTATTTTTTATTCCGACCTCATTAAGCAGC (SEQ.NO.1);

[0024] The dsDNA-F sequence is

[0025] TGAGCCATGTATCCAGGTCATTTGTCCCTATCAGTGATAGAGAAGCTCTGACAGTTCCA (SEQ.NO.2)

[0026] The dsDNA-R sequence is

[0027] TGGAACTGTCAGAGCTTCTCTATCACTGATAGGGACAATGACCTGGATACATGGCTCAGCTGCTTAATGAGGTCGGAAT (SEQ.NO.3)

[0028] comDNA can be any one of comDNA1 to comDNA6;

[0029] Preferably, the comDNA is comDNA1: TAGACCCCCTTTTTTTTTTTTTT (SEQ.NO.6).

[0030] The preparation method of the magnetic bead-complementary strand DNA@aptamer-activated double-stranded DNA biosensor includes the following steps:

[0031] S1. Add pre-concentrated biotin-modified complementary DNA to the magnetic beads, vortex mix, and incubate the reaction system on a rotary mixer for 0.5–1 h to allow the biotin-modified complementary DNA to fully bind to the streptavidin on the surface of the magnetic beads. After incubation, perform magnetic separation, discard the supernatant to remove unbound excess complementary DNA. Then add an appropriate amount of 1×PBST buffer for washing, and repeat the washing operation 3–5 times to obtain a magnetic bead complex with complementary DNA coupled to its surface.

[0032] S2. Add the aptamer-activated double-stranded DNA complex to the magnetic bead complex with complementary DNA coupled to its surface. Vortex mix and incubate the reaction system on a rotary mixer for 1–2 hours to allow the aptamer-activated double-stranded DNA complex to fully hybridize with the complementary DNA. After incubation, perform magnetic separation and discard the supernatant to remove unbound excess aptamer-activated double-stranded DNA complex. Then wash the obtained complex with 1×PBST buffer, repeating the washing 3–5 times. After washing, resuspend in 1×PBST buffer to obtain the magnetic bead-complementary DNA@aptamer-activated double-stranded DNA biosensor for subsequent detection.

[0033] In the preparation method described above: the concentration of streptavidin magnetic beads is 10–20 μL, the concentration of complementary strand DNA is 1–10 μM, and the concentration of aptamer-activated double-stranded DNA complex is 1–5 μM.

[0034] The activating double-stranded DNA (aptamer-dsDNA) hybridized with the aptamer sequence is obtained by adding the aptamer (PFOA aptamer-F) and the forward and reverse primers (dsDNA-F, dsDNA-R) of the Cas12a activator dsDNA in a molar ratio of 1:1:1 and mixing them evenly in an annealing buffer with a final concentration of 1×. The mixture is then heat-denatured at 95°C for 5 minutes and cooled to room temperature.

[0035] A perfluorooctanoic acid (PFOA) detection kit based on CRISPR-Cas12a and aptamers includes: a magnetic bead-complementary DNA@aptamer-activated double-stranded DNA biosensor composed of streptavidin magnetic beads, a biotin-modified single-stranded complementary DNA sequence, an activated double-stranded DNA (aptamer-dsDNA) hybridized with the aptamer sequence, and a CRISPR-Cas12a reporter system.

[0036] The CRISPR-Cas12a reporter system consists of Cas12a, crRNA, FQ probe, buffer, and ddH2O.

[0037] The crRNA sequence is AAUUUCUACUGUUGUAGAUUCCCUAUCAGUGAUAGAG (SEQ.NO.4).

[0038] FQ probe: GATTAGCGTACGCACGTTAC (SEQ.NO.5).

[0039] The fluorescent reporter probe (FQ probe) is labeled with a fluorescent group that generates a detectable signal at one end and a quencher at the other end.

[0040] The fluorescent group is any one of 6-FAM, ROX, and Texas Red.

[0041] The quenching agent is any one of BHQ1, BHQ2, and BHQ3.

[0042] The buffer solution is 10×NEBuffer 4.

[0043] In the magnetic bead-complementary DNA@aptamer-activated double-stranded DNA biosensor, the biotin-modified single-stranded complementary DNA sequence is complementary to the aptamer sequence; the biotin-modified single-stranded complementary DNA sequence is directly anchored to the magnetic beads by incubation with the magnetic beads, and then the magnetic bead-comDNA complex is indirectly anchored to the magnetic beads by incubation with aptamer-dsDNA.

[0044] The final concentration of the aptamer-activated double-stranded DNA complex is 34 nM to 800 nM, preferably in the range of 34 to 68 nM.

[0045] In the CRISPR-Cas12a reporter system, the FQ probe dosage is 1-10 µL with a concentration of 1-10 μM, the Cas12a concentration is 1-20 µM, and the Cas12a / crRNA ratio is 1-4.

[0046] More preferably, the amount of FQ probe used is 7 µL, the concentration of Cas12a is 4 µM, and the Cas12a / crRNA ratio is 2.

[0047] In the aforementioned detection kit, streptavidin magnetic beads serve as the immobilization carrier for nucleic acid loading; complementary strand DNA provides a competing complementary sequence; activated double-stranded DNA is used to activate Cas12a activity; aptamers are recognition components used to capture target analytes; Cas12a protein cleaves the reporter probe; crRNA assists in activating Cas12a activity and serves as a signal amplification component; an FQ probe generates a fluorescent detection signal and serves as a signal reporting component; and enzyme-free sterile water and NEBuffer 4 are used to maintain reaction conditions.

[0048] Concentration and dosage range of each substance in the reagent kit of this invention:

[0049] Streptavidin magnetic beads 10–20 μL, complementary strand DNA 1–10 μM, aptamer 1–5 μM, activated double-stranded DNA 1–5 μM, Cas12a protein 1–20 μM, crRNA 1–10 μM, FQ probe 1–10 μM, enzyme-free sterile water 5–15 μL, NEBuffer 4 10×.

[0050] Application of the kit in the detection of perfluorooctanoic acid.

[0051] A CRISPR-Cas12a-aptamer detection method with specificity and sensitivity for perfluorooctanoic acid (PFOA) involves incubating a magnetic bead-complementary DNA@aptamer-activated double-stranded DNA biosensor with the analyte, followed by magnetic separation, and then transferring the supernatant into a CRISPR-Cas12a reporter system for fluorescence signal detection.

[0052] The preparation method includes directly anchoring single-stranded DNA complementary to the aptamer sequence onto magnetic beads by incubating with magnetic beads, and then indirectly anchoring the magnetic bead-comDNA complex onto magnetic beads by incubating with aptamer-dsDNA.

[0053] The magnetic bead-complementary strand DNA@aptamer-activated double-stranded DNA biosensor described above can specifically detect the target analyte PFOA from a variety of interfering substances that are structurally similar to, structurally similar to, or structurally completely different from PFOA, as well as common salts in food.

[0054] The linear range for PFOA detection is 1.00 × 10⁻⁶. -21 ~1.00×10 -12 M, the detection limit reaches 6.23 × 10⁻⁶. -16 M. The linear range for the detection of PFOA spiked in tap water is 1.00 × 10⁻⁶. -21 M~1.00×10 -12 M, with recoveries ranging from 86% to 108%. The linear range for the detection of PFOA in milk spiked with PFOA was 1.00 × 10⁻⁶. -20M~1.00×10 -10 M, with a recovery rate of 87% to 92%.

[0055] This invention introduces activated double-stranded DNA (aptamer-dsDNA) hybridized with aptamer sequences, biotin-labeled single-stranded complementary DNA (comDNA), and streptavidin magnetic beads. The activated double-stranded DNA hybridized with aptamer sequences can bind to the analyte with high specificity and high affinity due to the aptamer sequence portion, and the activated double-stranded DNA sequence portion contains the Cas12a cleavage site.

[0056] The specific principle is as follows: Biotin-labeled single-stranded complementary DNA (comDNA) is first immobilized by binding to streptavidin-coated magnetic beads; aptamer-activated double-stranded DNA (aptamer-dsDNA) then indirectly anchors to the magnetic beads through complementary pairing with comDNA, forming a biosensor containing dsDNA with a Cas12a cleavage site. Upon addition of analyte, the analyte binds with high affinity to the aptamer and induces the formation of a secondary structure, causing the aptamer to dissociate from the comDNA. The aptamer-dsDNA, now bound to the analyte, detaches from the magnetic beads and enters the supernatant. After magnetic separation, the free aptamer-dsDNA in the supernatant is collected, and the Cas12a reporter system (crRNA-Cas12a (mononuclease effector complex)) is added. This system recognizes and cleaves the dsDNA, activating the trans-cleavage activity of Cas12a, which further cleaves the fluorescent reporter probe (FQ probe), causing its fluorescent group to separate from the quencher and produce green fluorescence; conversely, without dsDNA, the fluorescent group will not be excited and will not emit light. This converts the dsDNA signal into a fluorescent signal. This invention can be used for the highly specific and sensitive detection of perfluorooctanoic acid (PFOA) with rapid detection speed.

[0057] The combination of the aptamer with the CRISPR / Cas12a system in this invention is not a simple splicing, but rather faces the following multiple key technical challenges:

[0058] 1) In terms of signal transduction mechanism, the Cas12a system naturally relies on dsDNA target activation, while the objects recognized by aptamers are mostly non-nucleic acid targets (such as proteins or small molecules). There is no direct molecular interface between the two, so it is necessary to design "bridging nucleic acid structures" (such as aptamer-dsDNA chimeras or comDNA structures) to achieve information conversion.

[0059] 2) The conformational changes of aptamers and the PAM recognition and crRNA matching mechanisms required for Cas12a activation belong to different physicochemical systems and have spatial structural incompatibility issues. If the design is not appropriate, it may lead to Cas12a failing to recognize effectively or excessively high background signals.

[0060] 3) In the construction of the system, it is necessary to ensure that the high affinity folding structure of the aptamer is not destroyed by dsDNA hybridization, while ensuring that the Cas12a recognition sequence is exposed and the enzyme activity is maintained. This places high demands on sequence design, GC content regulation and interstrand competitive binding.

[0061] 4) The system also needs to address issues such as non-specific release, background cutting, and system stability, so that the signal-to-noise ratio after coupling the two can reach the detection-grade application standard.

[0062] Overcoming the aforementioned technical obstacles, this invention employs a cascaded conversion mechanism of "aptamer recognition—conformation release—Cas12a activation—signal amplification," enabling two originally independent biological modules to function synergistically. Specifically, this combined system exhibits a significant synergistic gain effect: the aptamer module provides high specificity and broad-spectrum recognition capabilities, ensuring selective binding to target molecules; the Cas12a module provides high-sensitivity signal amplification capabilities, allowing trace amounts of target molecules to be converted into detectable fluorescent signals. The combination of these two modules forms a two-layer architecture where "the recognition layer determines specificity, and the enzyme digestion layer determines sensitivity," thereby achieving an exponential improvement in detection performance.

[0063] Therefore, for the rapid detection of PFOA, constructing an analytical strategy that uses PFOA aptamers as recognition elements and CRISPR / Cas12a as the signal amplification core has significant methodological advantages: on the one hand, it avoids the time-consuming enrichment and purification and reliance on large equipment in traditional instrumental analysis; on the other hand, it can achieve a highly sensitive response to trace amounts of PFOA through "aptamer recognition + Cas12a amplification," and is expected to be applicable to the rapid screening of complex matrices such as environmental water samples and food contact material migration liquids. This strategy is expected to provide a new technical approach for on-site PFOA monitoring that combines specificity, sensitivity, and ease of operation.

[0064] This invention uses perfluorooctanoic acid (PFOA) structural analogs such as perfluorooctane sulfonic acid, perfluorovalerate, and perfluorohexanoic acid, as well as structural analogs such as perfluoro-1-butanesulfonic acid and perfluorobutanol, along with structurally different compounds like flonicamid and common food salts such as sodium chloride, potassium chloride, magnesium chloride, and calcium chloride, as interfering substances. A magnetic bead-complementary DNA@aptamer-activated double-stranded DNA biosensor is incubated with these substances. After magnetic separation, the supernatant is fed into a CRISPR-Cas12a reporter system for fluorescence signal detection. The concentration of the interfering substances is 100 times that of PFOA. Results show that the constructed magnetic bead-complementary DNA@aptamer-activated double-stranded DNA biosensor emits a distinct bright green fluorescence only in the presence of PFOA alone and in the mixed standard containing PFOA. Other interfering substances show no significant difference compared to the blank control group.

[0065] This invention uses laboratory tap water and milk as actual samples. The anti-matrix interference ability of the constructed biosensor is evaluated by adding PFOA standard solution to the actual samples and conducting a spiked recovery experiment. The spiked concentration added to the tap water is low (1.00 × 10⁻⁶). -20 M), medium (1.00×10 -16 M), height (1.00×10 -12 M) concentration, milk spiked concentration was low (1.00×10 -20 M), medium (1.00×10 -16 M), height (1.00×10 -10 M) concentration. Results showed that in the tap water spiked experiment, the recovery rate of PFOA detected by the biosensor was 86%–108%, and in the milk spiked experiment, the recovery rate was 87%–92%, which is consistent with EURL's "Guidance Document on Analytical Parameters for the Determination of PFAS in Food and Feed." The apparent recovery rate of QC samples in PFAS analysis should be 65%–135% for monitoring purposes.

[0066] Compared with existing technologies, the PFOA detection kit and detection method based on CRISPR-Cas12a-aptamer of the present invention have the following advantages:

[0067] (1) It has high sensitivity. It can detect PFOA quickly and sensitively, with a linear range of 1.00 × 10⁻⁶ for PFOA detection. -21 ~1.00×10 -12 M, the detection limit reaches 6.23 × 10⁻⁶. -16 M. Compared with previously reported detection techniques for PFOA, the detection method of this invention has a wider detection linearity range and a more sensitive detection limit.

[0068] (2) It has good specificity and can specifically identify PFOA among many structural similarities and analogues.

[0069] (3) It has good resistance to matrix interference.

[0070] (4) The detection results are consistent with those obtained by the classical instrumental detection method (HPLC-HRMS). In this study, a low concentration (1.00 × 10⁻⁶) of [unclear text] was added to the milk sample. -10 M), medium concentration (1.00×10 -8 M, 5.00×10 -8 M), high concentration (5.00×10-7 The PFOA spike recovery experiments were conducted, and the recovery rates of PFOA spiked in milk using the sensor ranged from 87% to 110%, while the recovery rates using HPLC-HRMS ranged from 79% to 112%. Both of these rates are within the recovery range for detection purposes specified in the EURL standard, which further demonstrates the reliability of the constructed sensor for detecting PFOA in milk samples. Attached Figure Description

[0071] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments, and the advantages of the present invention in the above and / or other aspects will become clearer.

[0072] Figure 1 A schematic diagram illustrating the working principle of this invention.

[0073] Figure 2 SDS-PAGE analysis diagram of FnCas12a in Embodiment 1 of the present invention.

[0074] Figure 3 Agarose gel electrophoresis image of dsDNA in Example 2 of this invention.

[0075] Figure 4 Optimization diagram of the CRISPR-Cas12a reaction system in Example 3 of this invention.

[0076] Figure 5 The feasibility verification diagram of applying the magnetic bead-complementary strand DNA@aptamer-activated double-stranded DNA biosensor in Example 4 of this invention to PFOA detection.

[0077] Figure 6 An optimized diagram of the magnetic bead-complementary DNA@aptamer-activated double-stranded DNA biosensor in Example 5 of this invention.

[0078] Figure 7 The specificity evaluation diagram of the magnetic bead-complementary strand DNA@aptamer-activated double-stranded DNA biosensor in Example 6 of this invention applied to PFOA detection.

[0079] Figure 8 The magnetic bead-complementary DNA@aptamer-activated double-stranded DNA biosensor in Example 7 of this invention is used to detect PFOA in actual samples. Detailed Implementation

[0080] The present invention can be better understood from the following embodiments. However, those skilled in the art will readily understand that the descriptions in the embodiments are for illustrative purposes only and should not, and will not, limit the invention as detailed in the claims.

[0081] Unless otherwise specified, the experimental methods described in the following examples are conventional methods; the reagents and materials described are commercially available unless otherwise specified.

[0082] Unless otherwise specified, all concentrations mentioned in this invention refer to mass concentrations.

[0083] This invention enhances the detection sensitivity of analytes by amplifying the trans-cleavage activity of CRISPR-Cas12a through a hybrid suitable ligand and an activated dsDNA sequence. The invention provides a magnetic bead-complementary DNA@aptamer-activated double-stranded DNA biosensor for analyte detection. The framework comprises a single-stranded complementary DNA (comDNA) anchored to streptavidin magnetic beads (MB), an activated double-stranded DNA sequence (aptamer-dsDNA) linked to an aptamer sequence, and a CRISPR-Cas12a reporter system (i.e., Cas12a protein, crRNA, reaction buffer, and a fluorescent reporter probe F-Q probe). The aptamer-dsDNA is indirectly anchored to the streptavidin magnetic beads through complementary pairing with the comDNA; the activated double-stranded DNA contains a Cas12a cleavage site, which can be recognized and cleaved by the CRISPR-Cas12a system; one end of the fluorescent reporter probe F-Q probe is labeled with a fluorescent group that generates a detectable signal, and the other end is labeled with a quencher.

[0084] Compared to comDNA, aptamers bind to analytes with higher affinity and more specificity. When an analyte is added to a solution containing a magnetic bead-complementary strand DNA@aptamer-activated double-stranded DNA biosensor, the activated double-stranded DNA, hybridized with the aptamer sequence, binds to the analyte and dissociates from the comDNA. The aptamer-dsDNA, after binding to the analyte, detaches from the magnetic bead and enters the supernatant. This supernatant is then added to a CRISPR-Cas12a reporter system to activate the trans-cleavage activity of the CRISPR-Cas12a protein on the fluorescent reporter probe FQ probe. The FQ probe is cleaved and generates a detectable signal. By measuring the generated signal, the presence or content of the analyte can be detected.

[0085] Example 1: Expression, purification and identification of FnCas12a protein

[0086] In this embodiment, the Cas12a protein (FnCas12a) derived from the genus *Francisella tularensis* bacterium, with its nucleic acid sequence located in GenBank (CP000439.1), was prepared using a prokaryotic expression system. The recombinant expression plasmid pET28a-FnCas12a was transformed into *E. coli* BL21 competent cells. After screening for positive transformants, single colonies were picked and inoculated into Luria-Bertani (LB) liquid medium and cultured overnight at 37°C with shaking at 160–180 rpm to obtain an activated bacterial culture. Subsequently, the activated bacterial culture was inoculated into fresh LB liquid medium at a standard ratio and cultured at 37°C with shaking until the bacterial culture reached the logarithmic growth phase. Isopropyl-β-D-thiogalactoside (IPTG) was added to the culture system to induce FnCas12a protein expression; the final concentration of IPTG was 50–500 mM. After induction, the bacterial culture was cultured at 16–21°C and 140–180 rpm for 16–20 h with shaking. After culture, the bacterial pellet was collected by centrifugation at 4°C and 10000×g for 20 min. The bacterial pellet was resuspended in a non-denaturing lysis buffer containing 50 mM Tris-HCl, 200 mM NaCl, 2 mM DTT, and 5% glycerol at pH 7.4. Lysozyme was added to the resuspended pellet to a final concentration of 1 mg / mL, and the mixture was incubated on ice for 30–75 min, followed by sonication on ice. After lysis, the mixture was centrifuged at 4°C and 10000×g for 20–30 min, and the supernatant was collected to obtain a crude soluble protein extract.

[0087] The crude soluble protein extract was loaded into a HisTrap nickel affinity chromatography column to ensure thorough binding of the His-tagged FnCas12a protein to the column. The column was then washed with a wash buffer containing a low concentration of imidazole to remove non-specifically bound proteins; followed by elution with an elution buffer containing a high concentration of imidazole, and the eluent containing the target protein was collected. Preferably, the imidazole concentration in the wash buffer was 20–50 mM, and the imidazole concentration in the elution buffer was 50–300 mM. The eluted protein solution was dialyzed to remove imidazole and small molecule impurities, yielding purified FnCas12a protein. The concentration of the purified protein was determined using the Bradford method. The purified FnCas12a protein was stored in a stock solution containing 50% glycerol at −20°C for later use. The purified FnCas12a protein was analyzed by SDS-PAGE electrophoresis. The results showed a clear and single target protein band at approximately 150 kDa, indicating successful expression and purification of the FnCas12a protein. Related results are as follows... Figure 2 As shown.

[0088] In this embodiment, *Escherichia coli* BL21 was used as the expression host, and pET28a-FnCas12a was used as the expression vector. The FnCas12a protein was obtained through IPTG induction, ultrasonic disruption, and nickel affinity chromatography purification. The obtained protein had high purity, meeting the requirements for subsequent nucleic acid detection system construction and related applications.

[0089] Example 2: Annealing preparation and identification of dsDNA, an activator of the CRISPR-Cas12a system

[0090] This embodiment is used to illustrate the preparation method and identification results of the CRISPR-Cas12a system activator double-stranded DNA (dsDNA) in this invention, but is not intended to limit the scope of protection of this invention.

[0091] (1) Annealing preparation of activator dsDNA. The modified aptamer (PFOA aptamer-F) and the forward and reverse primers (dsDNA-F, dsDNA-R) used to construct the Cas12a activator double-stranded DNA were added to the annealing system in a predetermined ratio.

[0092] PFOA aptamer-F:

[0093] TACTCGGCGTGGGGGTGGTAGGCTGTAAAGGGGGTCTATTTTTTATTCCGACCTCATTAAGCAGC (SEQ.NO.1);

[0094] dsDNA-F:

[0095] TGAGCCATGTATCCAGGTCATTTGTCCCTATCAGTGATAGAGAAGCTCTGACAGTTCCA (SEQ.NO.2)

[0096] dsDNA-R:

[0097] TGGAACTGTCAGAGCTTCTCTATCACTGATAGGGACAATGACCTGGATACATGGCTCAGCTGCTTAATGAGGTCGGAAT (SEQ.NO.3)

[0098] Preferably, the molar ratio of the modified aptamer, forward primer, and reverse primer is 1:1:1. Annealing buffer with a final concentration of 1× is added to the system, mixed thoroughly, and then heated at 95°C for 5 min for thermal denaturation. The system is then allowed to cool naturally to room temperature to allow the nucleic acid molecules to fully anneal and pair, thereby obtaining CRISPR-Cas12a system activator double-stranded DNA. In some embodiments, the annealing buffer can be a conventional nucleic acid annealing buffer, the components of which can maintain stable pairing between nucleic acid strands to promote the formation of double-stranded DNA.

[0099] (2) Identification of the activator dsDNA. The annealing products were analyzed by agarose gel electrophoresis to verify the formation of double-stranded DNA. The results are as follows: Figure 3 As shown:

[0100] Lane 1 served as a blank control, and no obvious bands were observed.

[0101] Lane 2 served as negative control 1, with only dsDNA forward primers added. A blurred band with high migration rate appeared at approximately 59 bp of the corresponding single-stranded forward primer.

[0102] Lane 3 served as negative control 2, with only dsDNA reverse primer added, resulting in a blurred band.

[0103] Lane 4 was the experimental group, where both the forward and reverse primers for dsDNA were added. A clear and bright target band appeared at approximately 80 bp.

[0104] The above results indicate that the forward and reverse primers of dsDNA successfully formed double-stranded DNA of the expected length after annealing, which can be used as an activator for the CRISPR-Cas12a system.

[0105] In this embodiment, double-stranded DNA molecules capable of activating the CRISPR-Cas12a system were successfully prepared by annealing the forward and reverse primers. Agarose gel electrophoresis results showed that the experimental group formed double-stranded DNA bands of the expected size, while the negative control groups did not form the same characteristic bands, indicating that the annealing method can effectively obtain the target activator dsDNA.

[0106] Example 3: Optimization of the CRISPR-Cas12a reaction system

[0107] This embodiment is used to illustrate the optimization process of key parameters of the CRISPR-Cas12a reaction system in this invention to obtain better fluorescence signal output, signal-to-noise ratio and detection performance, but it is not intended to limit the scope of protection of this invention.

[0108] (1) Optimization of the amount of fluorescent reporter probe. The amount of fluorescent reporter probe added directly affects the fluorescence signal intensity and signal-to-noise ratio of the system. When the amount of reporter probe is too low, the fluorescence signal generated by the system is weak; while when the amount is too high, it may lead to an increase in the background signal of the system, the reaction tends to saturate, and adversely affect the detection kinetics and linear range.

[0109] Therefore, this embodiment sets up different gradients of fluorescent reporter probe addition for optimization experiments. Preferably, multiple gradients within the range of 1–9 μL are selected for comparison. The results are as follows: Figure 4 As shown in Figure A, when the amount of fluorescent reporter probe is in the range of 1–7 μL, the fluorescence signal generated by the CRISPR-Cas12a reporter system increases significantly with the increase of probe amount; however, when the probe amount is increased to 9 μL, the fluorescence signal decreases instead. Considering both fluorescence response intensity and reagent consumption cost, 7 μL was selected as the optimal amount of fluorescent reporter probe for subsequent experiments.

[0110] (2) Optimization of Cas12a protein concentration. Cas12a protein concentration is an important factor affecting the trans-cleavage rate, detection response speed, and sensitivity of the system. When the Cas12a protein concentration is too low, the system activation efficiency is insufficient, resulting in a weak fluorescence signal; while when the concentration is too high, it may cause enhanced non-specific cleavage or decreased system specificity, which is not conducive to improving detection performance.

[0111] This embodiment further optimizes the Cas12a protein concentration. Preferably, different concentration gradients within the range of 1–20 μM are selected for the experiment. The results are as follows: Figure 4As shown in Figure A, when the Cas12a protein concentration is in the range of 1–4 μM, the fluorescence signal of the system increases significantly with increasing Cas12a concentration; however, when the Cas12a protein concentration continues to increase to 8–20 μM, the fluorescence signal shows a decreasing trend. Therefore, 4 μM was selected as the optimal Cas12a protein concentration for subsequent experiments.

[0112] (3) Optimization of the molar ratio of Cas12a to crRNA. The molar ratio of Cas12a to crRNA directly affects the formation efficiency and stability of the active ribonucleoprotein (RNP) complex. If the ratio is inappropriate, some crRNA may fail to bind to Cas12a protein effectively, or some Cas12a protein may remain in a free state, thus affecting the activation rate and detection specificity of the system.

[0113] This embodiment optimizes the molar ratio of Cas12a to crRNA. Preferably, a Cas12a:crRNA molar ratio of 1 to 4 is selected for comparison. The results are as follows: Figure 4 As shown in Figure A, when the Cas12a:crRNA molar ratio was between 1 and 2, the fluorescence signal did not show significant changes; however, when the molar ratio exceeded 2, the fluorescence signal showed a significant decreasing trend. Therefore, a Cas12a:crRNA molar ratio of 2 was selected as the optimal ratio for subsequent experiments.

[0114] (4) Optimization of activator dsDNA concentration. The concentration of the activated double-stranded DNA (i.e., target dsDNA) has a significant impact on the response threshold, linear range, and detection limit of the CRISPR-Cas12a system. To evaluate the effect of the activator dsDNA and its hybridization with the aptamer on the activation effect of the system, the concentrations of dsDNA and dsDNA-aptamer were optimized in this example.

[0115] Preferably, different concentration gradients within the range of 10 nM to 500 nM were selected for the experiment. The results are as follows: Figure 4 As shown in Figure B, within the range of 10 nM to 100 nM, regardless of whether dsDNA or dsDNA-aptamer was used as the activator, the fluorescence signal of the system significantly increased with increasing activator concentration; however, when the activator concentration was further increased, the fluorescence signal showed a decreasing trend. These results indicate that hybrid ligation of dsDNA with the aptamer does not significantly affect the activation effect of Cas12a's non-specific trans-cleavage activity.

[0116] By systematically optimizing key parameters such as the amount of fluorescent reporter probe, Cas12a protein concentration, the molar ratio of Cas12a to crRNA, and the concentration of dsDNA activator, optimal CRISPR-Cas12a reaction conditions were determined. These optimized conditions effectively improved the fluorescence response intensity and signal-to-noise ratio of the system, providing a foundation for the subsequent construction and performance evaluation of target analyte detection systems.

[0117] Example 4: Construction and feasibility verification of a magnetic bead-complementary strand DNA@aptamer-activated double-stranded DNA biosensor for PFOA detection.

[0118] This embodiment illustrates a method for constructing a magnetic bead-complementary DNA@aptamer-activated double-stranded DNA biosensor for the detection of perfluorooctanoic acid (PFOA) and its feasibility verification. Biotin-modified single-stranded complementary DNA (comDNA) is immobilized on the surface of streptavidin magnetic beads, and then hybridized and assembled with an aptamer-activated double-stranded DNA complex to construct the magnetic bead-complementary DNA@aptamer-activated double-stranded DNA biosensor. When PFOA is present in the sample, PFOA specifically binds to the aptamer, causing the aptamer-activated double-stranded DNA complex to dissociate from the magnetic bead surface and be released into the supernatant. The released activated double-stranded DNA can further activate the CRISPR-Cas12a detection system, thereby achieving the detection of PFOA.

[0119] (1) Construction of a magnetic bead-complementary strand DNA@aptamer-activated double-stranded DNA biosensor. Take streptavidin magnetic beads stored at 4°C and vortex thoroughly before use. Pipette 10–20 μL of the streptavidin magnetic beads into an enzyme-free 1.5 mL centrifuge tube and place it on a magnetic rack for magnetic separation for 2–4 min. After the magnetic beads have fully separated from the storage solution, discard the supernatant. Add an appropriate amount of 1×PBST buffer to the magnetic beads, vortex thoroughly, and perform magnetic separation again, discarding the supernatant. Repeat the above washing operation 3–5 times to thoroughly remove the NaN3 preservative from the magnetic bead storage solution.

[0120] After washing, pre-concentrated biotin-modified complementary DNA was added to the magnetic beads, and 1×PBST buffer was added to bring the total volume to 600 μL. After vortexing, the reaction mixture was incubated on a rotary mixer for 0.5–1 h to allow the biotin-modified complementary DNA to fully bind to the streptavidin on the surface of the magnetic beads. After incubation, the centrifuge tubes were magnetically separated on a magnetic rack, and the supernatant was discarded to remove any unbound excess complementary DNA. Then, an appropriate amount of 1×PBST buffer was added for washing, and this washing process was repeated 3–5 times to obtain the magnetic bead complex with complementary DNA coupled to its surface.

[0121] Further, an aptamer-activated double-stranded DNA complex was added to the magnetic bead complex with complementary DNA conjugated to its surface, and the volume was adjusted to 600 μL with 1×PBST buffer. After vortexing, the reaction system was incubated on a rotary mixer for 1–2 h to allow the aptamer-activated double-stranded DNA complex to fully hybridize with the complementary DNA. After incubation, magnetic separation was performed using a magnetic rack, and the supernatant was discarded to remove unbound excess aptamer-activated double-stranded DNA complex. The resulting complex was then washed with 600 μL of 1×PBST buffer, repeated three times. After washing, the mixture was resuspended in 900 μL of 1×PBST buffer to obtain a magnetic bead-complementary DNA@aptamer-activated double-stranded DNA biosensor for subsequent detection.

[0122] (2) Feasibility verification of the magnetic bead-complementary strand DNA@aptamer-activated double-stranded DNA biosensor for PFOA detection. A PFOA standard stock solution was prepared, and PFOA standard solutions of different concentrations were prepared using a serial dilution method. PFOA samples of different concentrations were added to the above magnetic bead-complementary strand DNA@aptamer-activated double-stranded DNA biosensor solutions, mixed, and incubated at room temperature for 1–2 h. During incubation, if PFOA is present in the sample, PFOA specifically binds to the aptamer, causing a conformational change in the aptamer, which causes the activated double-stranded DNA linked to it to dissociate from the magnetic bead surface and release into the supernatant. After incubation, the reaction system was placed on a magnetic rack for magnetic separation for 2–4 min, and the supernatant was transferred to a new enzyme-free 0.2 mL centrifuge tube for subsequent CRISPR-Cas12a reporter system detection. The biosensor (kit) formulations used are shown in Table 1.

[0123] Table 1

[0124] Immobilized carrier Streptomycin magnetic beads 10–20 μL Nucleic acid load 4℃ Signal conversion components complementary strand DNA 1~10 μM Competitive complementary sequences -20～4℃ Identification Components aptamers 1~5 μM Capture target analytes -20～4℃ Signal conversion components Activate double-stranded DNA 1~5 μM Activation of Cas12a activity -20～4℃ Signal amplification components Cas12a protein 1~20 μM Cutting report probe -20℃ Signal amplification components crRNA 1~10 μM Assist in activating Cas12a activity -20℃ Signal reporting components FQ probe 1~10 μM Generate fluorescence detection signal -20℃ reaction auxiliary components Enzyme-free sterile water 5–15 μL Maintain reaction conditions 4℃ reaction auxiliary components NEBuffer 4 10× Maintain reaction conditions -20～4℃

[0125] The CRISPR-Cas12a reaction system was prepared as follows: 8.5 μL of enzyme-free sterile water, 4.3 μL of 10×NEBuffer, 1.5 μL of crRNA, 4 μL of Cas12a protein, 7 μL of fluorescent reporter probe FQ probe, and 6 μL of the above supernatant sample, with a total reaction volume of 30 μL.

[0126] The obtained supernatant sample was added to the CRISPR-Cas12a reaction system, mixed well, and then placed in a qPCR instrument for fluorescence detection. Fluorescence signals were collected every 45 seconds. If the supernatant contained activated double-stranded DNA released induced by PFOA, it could activate the trans-cleavage activity of the Cas12a / crRNA complex, thereby cleaving the fluorescent reporter probe and generating an enhanced fluorescence signal; if the supernatant did not contain the activated double-stranded DNA, the system would only show low background fluorescence.

[0127] The results are as follows Figure 5 As shown. Figure 5 Figure A shows the fluorescence kinetics curve for the feasibility verification of the biosensor constructed in this embodiment. As can be seen from the figure, in the absence of PFOA, after magnetic separation of the magnetic bead-complementary strand DNA@aptamer-activated double-stranded DNA biosensor, the supernatant added to the CRISPR-Cas12a reporter system showed a fluorescence signal that was essentially consistent with the background control group containing only the fluorescent reporter probe and the negative control group containing the fluorescent reporter probe, Cas12a protein, and crRNA. This indicates that the system does not undergo significant activation in the absence of the analyte. However, in the presence of PFOA, after incubating the biosensor with the PFOA standard solution, the supernatant obtained after magnetic separation was added to the CRISPR-Cas12a reporter system, and a significantly enhanced fluorescence signal was detected. This indicates that PFOA can induce the release of the aptamer-activated double-stranded DNA complex from the magnetic bead surface and successfully activate the CRISPR-Cas12a detection system.

[0128] Figure 5 Figure B shows the corresponding blue light visualization results. As can be seen from the figure, after 30 minutes of reaction, the supernatant obtained from magnetic separation of the PFOA-containing sample group showed obvious green fluorescence after being added to the CRISPR-Cas12a reporter system. However, in the absence of PFOA, the fluorescence of the supernatant was basically consistent with that of the background control group containing only the fluorescent reporter probe and the negative control group containing the fluorescent reporter probe, Cas12a protein, and crRNA, all showing weak, pale green fluorescence. At the reaction endpoint, the visualization results for each group were basically consistent with the observations at 30 minutes of reaction.

[0129] The above results demonstrate that the magnetic bead-complementary strand DNA@aptamer-activated double-stranded DNA biosensor constructed in this embodiment can respond to PFOA and trigger a significant fluorescence signal in the CRISPR-Cas12a reporter system by releasing activated double-stranded DNA, proving that the biosensor is feasible for PFOA detection.

[0130] Example 5: Optimization of a magnetic bead-complementary DNA@aptamer-activated double-stranded DNA biosensor for PFOA detection

[0131] This embodiment illustrates the optimization process of a magnetic bead-complementary DNA@aptamer-activated double-stranded DNA biosensor for perfluorooctanoic acid (PFOA) detection. By screening and optimizing the aptamer switch structure and the amount of aptamer-activated double-stranded DNA complex, the signal-to-noise ratio, stability, and detection sensitivity of the constructed biosensor are improved. However, this embodiment is not intended to limit the scope of protection of this invention.

[0132] To achieve highly sensitive and rapid detection of PFOA, this invention employs a PFOA biosensor constructed by assembling magnetic beads (MB) coated with streptavidin, biotin-modified complementary DNA (comDNA), and activating double-stranded DNA (aptamer-dsDNA) containing aptamer sequences. The PFOA aptamer is a 64 nt single-stranded nucleotide sequence that specifically binds to PFOA with an affinity constant of 7.4 μM. The biotin-modified complementary DNA can anchor to the magnetic bead surface via streptavidin-biotin interaction and bind to the aptamer region via base pairing. The activating double-stranded DNA contains the target sequence required for Cas12a recognition and activation, and can be used to activate the trans-cleavage activity of the Cas12a / crRNA complex. The aptamer-activated double-stranded DNA complex formed by the annealing step can be further indirectly immobilized on the surface of magnetic beads by base pairing between the aptamer and the complementary DNA strand, thereby forming a magnetic bead-complementary DNA@aptamer-activated double-stranded DNA biosensor.

[0133] In the construction and application of the biosensor, it is preferable to have a high signal-to-noise ratio, that is, to maximize the amount of aptamer-activated double-stranded DNA released in the presence of the analyte relative to the non-specific release in the absence of the analyte. A higher signal-to-noise ratio helps to reduce background noise, enhance the response signal, and further improve the stability and detection sensitivity of the sensor.

[0134] (1) Screening and optimization of aptamer switches. In the magnetic bead-complementary DNA@aptamer-activated double-stranded DNA biosensor, the base sequence of the biotin-modified complementary DNA, especially its complementary binding site with the aptamer, is an important factor affecting the signal-to-noise ratio of the sensor. To this end, the aptamer sequence PFOAaptamer-F was designed and modified based on the PFOA aptamer sequence, and eight comDNA sequences partially complementary to the PFOA aptamer-F were further designed to screen for aptamer switch structures with better performance. The sequences are shown in Table 2. Among them, the PFOA aptamer-F introduces additional base sequences at both ends of the original PFOA aptamer to facilitate the screening of aptamer switch structures; at the same time, a polyT sequence is introduced to reduce the interference of the activated double-stranded DNA on the conformational transition of the aptamer. The design of the comDNA preferably follows these principles: GC content of 40%–60%, annealing temperature of approximately 35–45°C, complementary site length of 8–16 bp, and the complementary region should avoid forming stable secondary structures with the aptamer as much as possible. The above eight comDNA strands were immobilized on the surface of magnetic beads to form corresponding magnetic bead-comDNA complexes; then, they were incubated with aptamer-activating double-stranded DNA complexes to indirectly anchor them to the magnetic bead surface through base complementation, thereby constructing eight sets of magnetic bead-complementary strand DNA@aptamer-activating double-stranded DNA complexes. Subsequently, the release of aptamer-activating double-stranded DNA from the magnetic bead surface was compared under PFOA-added and non-added conditions to evaluate the signal-to-noise ratio corresponding to different aptamer switching structures. The results are as follows: Figure 6 As shown in Figure A, among the screened comDNAs, the aptamer-switching structure formed by comDNA1 and PFOA aptamer-F exhibited the best signal-to-noise ratio (SNR), reaching 11.5. This result indicates that the combination of comDNA1 and PFOA aptamer-F is more advantageous in improving the PFOA-induced target release efficiency while ensuring low background release. Therefore, this combination is preferred as the aptamer-switching scheme for constructing PFOA biosensors in subsequent experiments.

[0135] (2) Optimization of Aptamer-Activated Double-Stranded DNA Complex Concentration. After completing the aptamer switch screening, the concentration of the aptamer-activated double-stranded DNA complex also has a significant impact on the detection performance of the biosensor. The aptamer-activated double-stranded DNA not only serves as a signal transduction element released after the analyte response but also as a direct trigger factor for activating the CRISPR-Cas12a reporter system. Therefore, its dosage directly affects the background signal, response intensity, and overall signal-to-noise ratio. Therefore, this embodiment optimizes the final concentration of the aptamer-activated double-stranded DNA complex. Preferably, aptamer-activated double-stranded DNA with final concentrations of 34 nM, 68 nM, 135 nM, 270 nM, 540 nM, 660 nM, and 800 nM are selected and incubated with magnetic bead-comDNA complexes to indirectly immobilize them on the surface of the magnetic beads, thus constructing the corresponding biosensors. Subsequently, each group of biosensors was incubated with PFOA standard solution. After magnetic separation, the supernatant was collected and added to a CRISPR-Cas12a reporter system for fluorescence detection to compare the changes in the signal-to-noise ratio of the sensors under different concentration conditions. The results are as follows: Figure 6 As shown in Figure B, when the final concentration of the aptamer-activating double-stranded DNA is in the range of 34–68 nM, the signal-to-noise ratio (SNR) of the system increases with increasing concentration; however, when the final concentration is further increased to the range of 68–800 nM, the SNR gradually decreases with increasing concentration. Within the investigated concentration range, the SNR reaches its maximum value of 16.5 when the final concentration of the aptamer-activating double-stranded DNA is 68 nM. These results indicate that when the concentration of the aptamer-activating double-stranded DNA complex is too low, the number of signal molecules released to activate the CRISPR-Cas12a system is insufficient, which is detrimental to obtaining a strong detection signal; while when the concentration is too high, it may increase the background release level of the system, thereby reducing the overall SNR. Therefore, 68 nM is preferably selected as the suitable final concentration of the aptamer-activating double-stranded DNA complex for subsequent experiments, where the final concentration is the concentration dissolved in the buffer solution.

[0136] By systematically optimizing the aptamer switch structure and the concentration of the aptamer-activating double-stranded DNA complex, optimal construction conditions for a magnetic bead-complementary strand DNA@aptamer-activating double-stranded DNA biosensor for PFOA detection were determined. Specifically, comDNA1 and PFOA aptamer-F were preferably used to construct the aptamer switch, and the final concentration of the aptamer-activating double-stranded DNA complex was preferably controlled at 68 nM. Under these conditions, the constructed biosensor achieved a high signal-to-noise ratio and good detection performance, providing a foundation for the subsequent establishment of a PFOA quantitative detection method and the conduct of methodological evaluation.

[0137] Table 2

[0138] dsDNA-R TGGAACTGTCAGAGCTTCTCTATCACTGATAGGGACAATGACCTGGATACATGGCTCAGCTGCTTAATGAGGTCGGAAT PFOA aptamer-F TACTCGGCGTGGGGGTGGTAGGCTGTAAAGGGGGTCTATTTTTTATTCCGACCTCATTAAGCAGC crRNA AAUUUCUACUGUUGUAGAUUCCCUAUCAGUGAUAGAG FQ probe GATTAGCGTACGCACGTTAC comDNA1 TAGACCCCCTTTTTTTTTTTTTT comDNA2 ACAGCCTACCATTTTTTTTTTTTT comDNA3 GAGTATTTTTTTTTTTT comDNA4 ACCCCCTTTACTTTTTTTTTTTT comDNA5 ACGCCGAGTATTTTTTTTTTTT comDNA6 TAGACCTTTTTTTTTTTT comDNA7 CCCTTTACAGCTTTTTTTTTTTT comDNA8 AGCCTATTTTTTTTTTTT

[0139] Example 6: Specificity evaluation of a magnetic bead-complementary strand DNA@aptamer-activated double-stranded DNA biosensor for PFOA detection.

[0140] This embodiment illustrates the specificity of the constructed magnetic bead-complementary strand DNA@aptamer-activated double-stranded DNA biosensor in PFOA detection. Comparative experiments were conducted using various interfering substances that are structurally similar to, have similar structures to, or may coexist with PFOA in actual samples to evaluate the biosensor's specific recognition ability for PFOA.

[0141] To evaluate the detection specificity of the biosensor, the following substances were selected as interfering agents: perfluorinated compounds structurally similar to PFOA, including perfluorooctane sulfonic acid, perfluorovalerate, and perfluorohexanoic acid; compounds with some structural similarity to PFOA, including perfluoro-1-butanesulfonic acid and perfluorobutanol; in addition, flonicamid, whose structure is completely different from the target analyte, and common food salts such as sodium chloride, potassium chloride, magnesium chloride, and calcium chloride were selected as potential interfering agents. Solutions of the above interfering agents were prepared and added at concentrations 100 times the PFOA detection concentration.

[0142] Each interfering substance was incubated with a magnetic bead-complementary strand DNA@aptamer-activated double-stranded DNA biosensor at 25°C on a rotary mixer for 1-2 hours. After the reaction was completed under the same conditions, the mixture was magnetically separated using a magnetic rack. The supernatant was collected and added to a CRISPR-Cas12a reporter system for fluorescence signal detection. The CRISPR-Cas12a reaction system was prepared as follows: 8.5 μL of enzyme-free sterile water, 4.3 μL of 10×NEBuffer, 1.5 μL of crRNA, 4 μL of Cas12a protein, 7 μL of the fluorescent reporter probe FQ probe, and 6 μL of the supernatant sample, for a total reaction volume of 30 μL. Simultaneously, the experimental group with PFOA was used as a positive control, and the experimental group without analytes was used as a negative control. The differences in fluorescence response among the groups were compared. The results are as follows: Figure 7As shown, the constructed magnetic bead-complementary DNA@aptamer-activated double-stranded DNA biosensor only produced a significantly enhanced fluorescence signal in the presence of PFOA. However, with the addition of the aforementioned interfering substances, the fluorescence values ​​detected by the CRISPR-Cas12a reporter system showed no significant difference compared to the negative control group without analytes, remaining at a low background level. These results demonstrate that the magnetic bead-complementary DNA@aptamer-activated double-stranded DNA biosensor constructed in this invention possesses excellent specificity for PFOA. Even at interfering substance concentrations 100 times higher than the PFOA concentration, the biosensor did not exhibit significant non-specific responses, indicating that the detection system has strong anti-interference capabilities and high detection specificity, ensuring accurate detection of PFOA in complex samples.

[0143] Example 7: Performance Evaluation of PFOA Detection in Real Samples Using Magnetic Bead-Complementary Strand DNA@aptamer-Activated Double-Stranded DNA Biosensor

[0144] This embodiment illustrates the applicability and detection performance of the constructed magnetic bead-complementary strand DNA@aptamer-activated double-stranded DNA biosensor in detecting PFOA in real samples. By selecting tap water and milk as representative real samples, spiked recovery experiments were conducted to evaluate the linear detection capability and recovery rate of the biosensor in complex sample matrices, thereby verifying its application potential in real sample analysis.

[0145] (1) Performance evaluation of PFOA spiked detection in tap water samples. To further evaluate the detection performance of the constructed biosensor in actual water samples, laboratory tap water was selected as the actual sample. First, the tap water sample was filtered using a 0.22 μm nylon filter membrane to remove suspended particles and impurities. Then, PFOA-spiked actual samples were prepared by adding different concentrations of PFOA standard solution to the treated tap water samples. The above-mentioned tap water samples mixed with PFOA standard solution were incubated with a magnetic bead-complementary strand DNA@aptamer-activated double-stranded DNA biosensor. After the reaction was complete, magnetic separation was performed using a magnetic rack, and the supernatant was collected and added to a CRISPR-Cas12a reporter system for fluorescence signal detection. The PFOA spiked concentration in the tap water samples was set to three levels: low, medium, and high, with each level being 1.00 × 10⁻⁶. -20 M, 1.00×10 -16 M and 1.00×10 -12 M. The result is as follows Figure 8 As shown in Figure A, the constructed biosensor exhibits a linear detection range of 1.00 × 10⁻⁶ for PFOA in actual tap water samples. -21 M~ 1.00×10-12 M. The recovery rate results are shown in Table 3 of the specification. In the tap water spiked experiment, the recovery rate of PFOA was 86%–108%. These results indicate that the constructed biosensor has good quantitative detection capability and high detection accuracy in actual tap water samples. The obtained recovery rate is within the PFAS analysis quality control requirements proposed in EURL's "Guidance Document on Analytical Parameters for the Determination of PFAS in Food and Feed," that is, under monitoring purposes, the apparent recovery rate of QC samples should be 65%–135%. Therefore, the biosensor constructed in this invention is suitable for the detection and analysis of PFOA in actual water samples.

[0146] (2) Performance evaluation of PFOA spiked detection in milk samples. To further evaluate the detection performance of the constructed biosensor in complex food matrices, milk was selected as the actual sample, and a spiked recovery experiment was conducted after pretreatment. Specifically, acetonitrile was used as the extraction solvent, and 200 μL of PFOA standard solutions of different concentrations were added to 2 mL of milk sample. After mixing, the sample was sonicated for 20 min to promote the extraction of PFOA from the sample. Subsequently, the sample was centrifuged at 12000 rpm for 20 min at 4°C, and the supernatant was collected and diluted 1000 times. The diluted supernatant was incubated with a magnetic bead-complementary strand DNA@aptamer-activated double-stranded DNA biosensor. After the reaction, the supernatant was collected by magnetic separation and added to a CRISPR-Cas12a reporter system for fluorescence signal detection. The PFOA spiked concentration in the milk sample was also set to three levels: low, medium, and high, with a concentration of 1.00 × 10⁻⁶. -20 M, 1.00×10 -16 M and 1.00×10 -10 M.

[0147] The results are as follows Figure 8 As shown in Figure B, the constructed biosensor exhibits a linear detection range of 1.00 × 10⁻⁶ for PFOA in actual milk samples. -20 M~1.00×10 -10The recovery results are shown in Table 3. In the milk spiked experiment, the recovery rate of PFOA was 87%–92%. These results indicate that the constructed biosensor can maintain good detection performance and accuracy in complex matrices such as milk samples. The obtained recovery rates also meet the quality control requirements for PFAS analysis in EURL's "Guidance Document on Analytical Parameters for the Determination of PFAS in Food and Feed," namely, an apparent recovery rate of 65%–135% for QC samples used for monitoring purposes. This demonstrates that the biosensor constructed in this invention has good matrix tolerance and practical sample application potential, and can be used for the detection of PFOA in food samples.

[0148] The spiked detection results of two types of actual samples, tap water and milk, show that the constructed magnetic bead-complementary strand DNA@aptamer-activated double-stranded DNA biosensor exhibits good linear detection capability and high recovery rate in different types of actual samples. Especially in samples with significant matrix differences, such as tap water and milk, detection results meeting quality control requirements can be obtained, indicating that the biosensor not only possesses high sensitivity and accuracy but also good resistance to matrix interference and promising practical applications. Therefore, this embodiment further demonstrates that the magnetic bead-complementary strand DNA@aptamer-activated double-stranded DNA biosensor constructed in this invention can be effectively applied to the detection of PFOA in actual samples.

[0149] Table 3

[0150] tap water <![CDATA[1×10 -20 ]]> <![CDATA[1.09×10 -20 ]]> 108.88 11.27 tap water <![CDATA[1×10 -16 ]]> <![CDATA[0.98×10 -16 ]]> 97.73 5.35 tap water <![CDATA[1×10 -12 ]]> <![CDATA[0.87×10 -12 ]]> 86.87 3.18 milk <![CDATA[1×10 -20 ]]> <![CDATA[0.89×10 -20 ]]> 88.71 5.94 milk <![CDATA[1×10 -16 ]]> <![CDATA[0.92×10 -16 ]]> 92.14 3.29 milk <![CDATA[1×10 -10 ]]> <![CDATA[0.88×10 -10 ]]> 87.59 2.13

[0151] Example 8: Consistency evaluation of the detection method of the present invention and HPLC-HRMS for the spiked detection of PFOA in actual milk samples.

[0152] This embodiment illustrates the consistency between the CRISPR-Cas12a-aptamer detection method established in this invention and high-performance liquid chromatography-high-resolution mass spectrometry (HPLC-HRMS) in detecting PFOA in actual milk samples. By conducting PFOA spiked recovery experiments on milk samples at different concentration levels and comparing the results of this invention with those of HPLC-HRMS, the accuracy and reliability of the constructed biosensor's detection results are verified.

[0153] To evaluate the consistency between the detection method of this invention and the HPLC-HRMS method, milk was selected as the actual sample, and spiking recovery experiments were conducted by adding PFOA standard solutions of different concentrations. The spiking levels included a low concentration of 1.00 × 10⁻⁶. -10M, medium concentration 1.00×10 -8 M and 5.00×10 -8 M, and a high concentration of 5.00×10 -7  Following the aforementioned milk sample pretreatment and detection steps, the magnetic bead-complementary strand DNA@aptamer-activated double-stranded DNA biosensor constructed in this invention was used to detect PFOA in spiked milk samples. Simultaneously, parallel detection of the same spiked samples was performed using HPLC-HRMS, and the recovery rates of the two methods were compared. The results are shown in Table 4. When using the biosensor of this invention to detect PFOA in milk samples, the recovery rate was 87%–110%; when using the HPLC-HRMS method, the recovery rate was 79%–112%. Both recovery rates were within the allowable range of relevant standards and met the recovery rate requirements for detection purposes in the EURL standard. These results demonstrate that the CRISPR-Cas12a-aptamer detection method and the HPLC-HRMS method established in this invention exhibit good consistency in detecting PFOA in actual milk samples. Compared with traditional instrumental analysis methods, the biosensor constructed in this invention not only ensures the reliability of detection results but also has the advantages of simple operation, rapid detection, and high sensitivity, indicating that it has high application reliability and practical promotion value in detecting PFOA in complex food samples such as milk.

[0154] Table 4

[0155]

[0156] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to specific embodiments, those skilled in the art should understand that various equivalent substitutions, modifications, and improvements can be made to the technical solutions of the present invention without departing from the spirit and essence of the present invention, and all such substitutions, modifications, and improvements should fall within the scope of protection of the present invention. The scope of protection of the present invention should be determined by the scope defined in the appended claims.

Claims

1. A magnetic bead-complementary strand DNA@aptamer-activated double-stranded DNA biosensor, characterized in that, include: Streptavidin magnetic beads, biotin-labeled single-stranded complementary DNA, and activated double-stranded DNA hybridized with aptamer sequences are used. The biotin-labeled single-stranded complementary DNA binds to and is immobilized by the streptavidin magnetic beads. The activated double-stranded DNA is indirectly anchored to the magnetic beads by complementary pairing with the biotin-labeled single-stranded complementary DNA, forming a biosensor containing dsDNA with a Cas12a cleavage site.

2. The magnetic bead-complementary strand DNA@aptamer-activated double-stranded DNA biosensor according to claim 1, characterized in that, The activated double-stranded DNA hybridized with the aptamer sequence is obtained by adding the aptamer, the forward primer dsDNA-F of the Cas12a activator dsDNA, and the reverse primer dsDNA-R to a buffer solution in a certain proportion, mixing them evenly, heat denaturing, and cooling to allow the nucleic acid molecules to fully anneal and pair.

3. The magnetic bead-complementary strand DNA@aptamer-activated double-stranded DNA biosensor according to claim 2, characterized in that, Perfluorooctanoic acid (PFOA) was used as the analyte, and its aptamer sequence is shown in SEQ. NO. 1; the forward primer dsDNA-F sequence is shown in SEQ. NO. 2, and the reverse primer dsDNA-R sequence is shown in SEQ. NO.

3.

4. The magnetic bead-complementary strand DNA@aptamer-activated double-stranded DNA biosensor according to claim 3, characterized in that, The biotin-labeled single-stranded complementary DNA sequence is shown in SEQ.NO.

6.

5. A perfluorooctanoic acid (PFOA) detection kit based on CRISPR-Cas12a and aptamers, characterized in that, include: The magnetic bead-complementary DNA@aptamer-activated double-stranded DNA biosensor and CRISPR-Cas12a reporter system according to any one of claims 1 to 4.

6. A perfluorooctanoic acid (PFOA) detection kit based on CRISPR-Cas12a and aptamers according to claim 5, characterized in that, The CRISPR-Cas12a reporter system includes Cas12a, crRNA, FQ probe, buffer, and ddH2O.

7. A perfluorooctanoic acid (PFOA) detection kit based on CRISPR-Cas12a and aptamers according to claim 6, characterized in that, The crRNA sequence is shown in SEQ. NO. 4, and the FQ probe sequence is shown in SEQ. NO.

5.

8. A perfluorooctanoic acid (PFOA) detection kit based on CRISPR-Cas12a and aptamers according to claim 6, characterized in that, The CRISPR-Cas12a reporter system uses 1-9 µL of FQ probe, 1-20 µM of Cas12a, and 1-4 Cas12a / crRNA.

9. The application of the perfluorooctanoic acid (PFOA) detection kit based on CRISPR-Cas12a and aptamers according to any one of claims 5 to 8 in the detection of PFOA.

10. The application according to claim 9, characterized in that, The magnetic bead-complementary DNA@aptamer-activated double-stranded DNA biosensor was incubated with the analyte, and the supernatant was magnetically separated and then introduced into a CRISPR-Cas12a reporter system for fluorescence signal detection.

Images