A SNP marker related to the muscle texture chewiness of monopterus albus and application thereof

Abstract

The application discloses a SNP marker related to the muscle texture chewiness of Monopterus albus and application thereof, and belongs to the technical field of aquatic molecular breeding. The SNP marker is located at the 18163947th base of chromosome 8 of Monopterus albus, the mutation type is A / G, named as Chr8:18163947 A>G, and the preferred genotype is GG; the muscle texture chewiness of Monopterus albus individuals carrying the genotype is significantly higher than that of AG and AA genotype individuals. The application further provides a primer pair (nucleotide sequences are shown as SEQ ID NOs:2-3) for amplifying and detecting the SNP marker and a kit containing the primer pair, and simultaneously discloses a detection method and application. The SNP marker is closely related to the muscle texture chewiness of Monopterus albus, and can be applied to the breeding of Monopterus albus, so that precise breeding is realized.

Description

Technical Field

[0001] This invention belongs to the field of aquatic molecular breeding technology, specifically relating to the identification of a SNP marker related to the chewiness of the muscle texture of the yellow eel and its application. Background Technology

[0002] Yellow eel ( Monopterus albus The yellow eel (Sinocyclocheilus spp.) is a freshwater bony fish that inhabits rice paddies, swamps, and mudflats, and is widely distributed in East Asia, South Asia, and Southeast Asia. Yellow eels have delicious and nutritious flesh, making them highly valuable economically and popular with consumers. They are one of my country's most commercially valuable "specialty freshwater fish." Although in recent years, more and more feed additives have been proven to promote efficient yellow eel farming and increase market supply, the juvenile and even adult yellow eels currently used for farming still mainly come from wild catches.

[0003] Traditionally, the selection of superior phenotypic traits has primarily been achieved through population selection or artificial intervention in the aquaculture environment. This process is not only time-consuming but also makes it difficult to guarantee the uniformity of traits across the entire population. Rapidly developing genomic resources and technologies have revealed the molecular mechanisms behind economic and productive traits, while genetically modified individuals obtained through gene editing offer convenience for targeted breeding to meet the needs of aquaculture. Genome-wide association studies (GWAS) are considered an effective strategy for analyzing and identifying marker genes associated with complex target phenotypic traits.

[0004] Therefore, it is necessary to research and develop more precise and effective breeding methods for swamp eels based on genomic resources. Summary of the Invention

[0005] The technical problem to be solved by this invention is to fill the gap in the research on the economic trait of muscle texture chewiness of swamp eel, and to provide an SNP marker related to muscle texture chewiness of swamp eel and its application, which can be applied to the breeding of swamp eel to achieve precision breeding.

[0006] To achieve the above objectives, the present invention adopts the following technical solution.

[0007] The first aspect of the present invention is to provide an SNP marker related to the chewability of the muscle texture of the yellow eel, wherein the SNP marker is located at the 18,163,947th base of chromosome 8, the mutation type is A / G, and it is named Chr8:18163947A>G; specifically, the SNP site is located at the 118 bp site of the sequence shown in SEQ ID NO:1, and its preferred genotype is GG.

[0008] A second aspect of the present invention is to provide a primer pair for amplifying or detecting the above-mentioned SNP marker, wherein the nucleotide sequences of the primer pair are shown in SEQ ID NO:2 and SEQ ID NO:23; Forward primer: SEQ ID NO:2 (5'-3')ATTTCCACCTTCTAGGTTTG Reverse primer: SEQ ID NO:3 (5'-3') TACAGGACCTCTGCTATGCT.

[0009] A third aspect of the present invention is to provide a kit for amplifying or detecting the chewiness of the muscle texture of the yellow eel, wherein the kit comprises the primer pairs shown above as SEQ ID NO:2 and SEQ ID NO:23; and reagents for PCR amplification.

[0010] A fourth aspect of the present invention is to provide the application of the above-mentioned SNPs related to the chewiness of eel muscle texture, the above-mentioned primer pairs as shown in SEQ ID NO:2 and SEQ ID NO:23, and the above-mentioned kit for amplifying or detecting the chewiness of eel muscle texture, for detecting the chewiness shape of eel muscle texture; specifically, the application includes the following steps: (1) Take muscle tissue from the tail of the eel to be tested for the extraction of genomic DNA; (2) Using the genomic DNA of the yellow eel as a template, PCR amplification was performed using the primer pairs shown in SEQ ID NO:2 and SEQ ID NO:23 to obtain the amplification product; (3) Sanger sequencing was performed on the amplified products to determine the genotype of the individual eel Chr8:18163947 A>G; The preferred genotype is GG, and individuals carrying this genotype have significantly higher muscle texture and chewiness than individuals carrying the AG and AA genotypes.

[0011] The fifth aspect of the present invention provides the application of the above-mentioned SNPs related to the chewiness of the muscle texture of the swamp eel in the breeding of swamp eels.

[0012] A sixth aspect of the present invention provides a method for detecting the chewiness of the muscle texture of a yellow eel, the method comprising the following steps: (1) Take muscle tissue from the tail of the eel to be tested for the extraction of genomic DNA; (2) Using the genomic DNA of the yellow eel as a template, PCR amplification was performed using the primer pairs shown in SEQ ID NO:2 and SEQ ID NO:23 to obtain the amplification product; (3) Sanger sequencing was performed on the amplified products to determine the genotype of the individual eel Chr8:18163947 A>G; The preferred genotype is GG, and individuals carrying this genotype have significantly higher muscle texture and chewiness than individuals carrying the AG and AA genotypes.

[0013] Advantages and innovations of the present invention: This invention provides a SNP marker for identifying the chewing properties of swamp eel muscle texture and its application. Using the primers provided in this invention, PCR amplification of swamp eel genomic DNA allows for rapid identification of whether an individual swamp eel with the Chr8:18163947 A>G genotype contains the SNP marker based on the amplified fragment. The SNP marker provided by this invention can be applied to the artificial breeding of swamp eels to obtain the muscle texture trait of the strain, ultimately achieving precision breeding of swamp eels. Attached Figure Description

[0014] Figure 1 This is a Manhattan plot from the GWAS analysis of the chewing properties of the muscle texture of the yellow eel in Example 1 of this application.

[0015] Figure 2 This is a statistical result diagram of the chewiness of muscle texture in individuals with different genotypes of yellow eel, Chr8:18163947 A>G, in Example 1 of this application.

[0016] Figure 3 The size of the genomic DNA of the yellow eel containing the target SNP was amplified using the nucleotide sequence shown in SEQ ID NO:2-3 in Example 2 of this application.

[0017] Figure 4 This is a graph showing the statistical results of the chewiness of muscle texture in individuals with different genotypes of yellow eel, Chr8:18163947 A>G, in Example 2 of this application. Detailed Implementation

[0018] The following examples are merely illustrative of the invention and should not be construed as limiting it. Any modifications or substitutions made to the methods, steps, or conditions of the invention without departing from its spirit and essence are within the scope of the invention. Experimental methods not specifically described in the examples, and reagents and materials not specified in the examples, are performed according to conventional conditions in the art, and all reagents used are commercially available.

[0019] Example 1: Screening of SNP markers related to the chewing trait of muscle texture in individual swamp eels 1.1 Sample Collection The population used was a biomimetic breeding population from the Zhuangxing Comprehensive Experimental Station of the Shanghai Academy of Agricultural Sciences. Mixed families of swamp eels were constructed and cultured together in the same pond. After 10 months of culture, 200 experimental fish were randomly captured. After wiping the body surface of the eels with 75% ethanol, muscle samples were collected using dissecting scissors for muscle texture analysis. Muscle texture profile analysis (TPA) was performed using a TA.XTPlus texture analyzer (Godalming, UK). The dorsal muscle above the lateral line was cut into 1.0 cm × 1.0 cm × 0.5 cm cubes. The testing conditions were as follows: a 25 mm × 25 mm flat-bottomed cylindrical probe was used, with a descent speed of 2 mm / s, a testing speed of 1 mm / s, a testing interval of 5 s, and a compression rate of 30%. TPA testing was conducted at room temperature. The chewiness data of the muscle texture of each fish were measured and recorded. Simultaneously, tail muscle tissue of the experimental fish was collected for genomic DNA extraction.

[0020] 1.2 Genomic DNA Extraction Genomic DNA was extracted from muscle using the Dneasy Blood & Tissue Kit (brand: QIAGEN, catalog number: 69504) according to the manufacturer's instructions. DNA quality and concentration were determined by 0.8% agarose gel electrophoresis and a Qubit 4.0 bioanalyzer.

[0021] 1.3 Genome resequencing and SNP variant detection Library construction was conducted at Shanghai Paiseno Biotechnology Co., Ltd. Genomic DNA was first extracted and randomly fragmented using ultrasound, with inserts approximately 400 bp in length. End repair was then performed, adding an A-tail to the 3' end and a sequencing adapter to the 5' end. The assembled DNA was purified and amplified using polymerase chain reaction (PCR) to prepare a 400 bp library. Paired-end sequencing of the genomic DNA was performed using an Illumina NovaSeq 6000 with the PE150 strategy. After data quality control and filtering, the raw sequencing data were mapped to a reference genome using the BWA-MEM algorithm for sequence alignment, and SNPs were filtered using GATK software.

[0022] 1.4 Genome-wide association analysis of growth rate trait GWAS analysis was performed using the efficient mixed model association analysis software EMMAX. Manhattan plots of the GWAS results were generated using R software. The threshold P-values ​​for genome-wide significance were calculated using Bonferroni correction, and the final thresholds for significance (log10(0.05 / N)) were set at 7.9, and for suggestiveness (log10(1 / N)) at 6.6.

[0023] 1.5 Test Results Based on the Illumina NovaSeq 6000 sequencing platform, resequencing of 200 samples yielded 887.23 GB of raw reads. After removing adapters and low-quality reads from the sequencing data, 842.16 GB of clean reads were obtained. From 3,269,024 SNPs, a SNP locus significantly associated with the chewing trait of muscle texture in the yellow eel was found on chromosome Chr8 (e.g., ...). Figure 1 As shown), named Chr8:18163947 A>G, this SNP site is located at the 118 bp position of the sequence shown in SEQ ID NO:1 (shown in bold underline). Figure 2 As shown, at the Chr8:18163947 A>G site, the average chewiness of the GG genotype eel was significantly higher than that of the AG and AA genotypes. In addition, there were also significant differences in the chewiness data of muscle texture between the AG and AA genotypes.

[0024] Based on the above results, this embodiment screened out one SNP marker related to the chewiness of the muscle texture of the yellow eel, located at the 18,163,947th base of chromosome 8, with a mutation type of A / G, named Chr8:18163947 A>G. The GG genotype is the preferred genotype, which has better muscle texture chewiness.

[0025] SEQ ID NO:1 (5'-3'): ATTTCCACCTTCTAGGTTTGTATTGTCCTGGATGGGACGTCAGTGATCTGAAACACTAGTCATCGTAAAGGTGATTATTATATTATTATCGCCAGATATTATAGGCTGAAAAAAGGA N CTCATGCAAAGAAGAGTGAAACCTTAAAATGATATATTTTGTCCCAGGGTAAAGTTAAGAATATACAAGCAAACAAAAAAACTAAAACTTGAACTAAGATATTTTTGTCTTAAAATGGCAGATCTTAAAATACGCGTCAGAGCATAGCAGAGGTCCTGTA The 118th N It can be either A or G.

[0026] Example 2: Sequencing Validation and Application of SNP Markers Related to Muscle Texture Chewing in Individual Eels 2.1 DNA collection from the loach samples to be validated Using the mixed eel family from Example 1 above, 150 fish were randomly selected again, and the genomic DNA of each individual was obtained according to the DNA extraction method described in Example 1.

[0027] 2.2 Amplifying nucleotide fragments containing the target SNP site To verify whether Chr8:18163947 A>G is associated with the chewing trait of muscle texture in individual swamp eels, a pair of primers for amplifying this SNP was designed using Priemer 5.0 software. The sequences are shown in Table 1, SEQ ID NO:2-3. Genomic DNA was then amplified using these primers. The primer pair was synthesized by Shanghai Sangon Biotech Co., Ltd.

[0028] Prepare the following 10 μl reaction mixture using a dye-added premixed PCR kit (brand: TaKaRa, catalog number: RR903A): 5 μl Premix Taq, 0.5 μl 10 μM forward primer, 0.5 μl 10 μM reverse primer, 1 μl template DNA, and add ddH2O to a total volume of 10 μl.

[0029] The PCR amplification program was as follows: 98℃ pre-denaturation for 10 min, 98℃ denaturation for 10 s, 60℃ annealing for 30 s, 72℃ extension for 1 min, for a total of 35 cycles, and a final extension at 72℃ for 5 min.

[0030] Table 1. Primer nucleotide sequences used for specific amplification of Chr8:18163947 A>G.

[0031] Prepare a 1% agarose gel, add the PCR amplification products described above, and perform electrophoresis using a 1 kb DNA ladder as a label. Use a gel imaging system to capture images of the bands to preliminarily verify the amplified fragment size of each sample. The electrophoresis results of samples with correct fragment sizes are shown below. Figure 3 As shown.

[0032] 2.3 Sanger sequencing to identify SNP loci genotypes Qualified PCR amplification products were sent to Shanghai Ouyi Biomedical Technology Co., Ltd. for Sanger sequencing using reverse primers to determine the genotype of each sample at Chr8:18163947 A>G. After successful genotyping, the muscle texture and chewing properties data of each genotype were compared and analyzed. The results are as follows: Figure 4 As shown, the muscle texture chewiness of the GG genotype is significantly higher than that of the AG and AA genotypes.

[0033] The above results indicate that the Chr8:18163947 A>G SNP marker obtained in Example 1 is significantly correlated with the muscle texture chewiness trait of individual swamp eels, and this correlation is stable and reliable, as verified by Sanger sequencing of 150 swamp eel samples in Example 2. Among them, the GG genotype is the preferred genotype for muscle texture chewiness in swamp eels, and the average muscle texture chewiness data of swamp eels carrying this genotype is significantly higher than that of individuals with the AG and AA genotypes.

[0034] Therefore, the Chr8:18163947 A>G SNP marker and primer pair provided by this invention can be effectively applied to molecular marker-assisted breeding of the muscle texture chewing trait of swamp eels. It can quickly screen out swamp eel individuals with excellent muscle texture chewing traits, shorten the breeding cycle, improve breeding efficiency, and at the same time provide a reliable molecular tool for the accurate evaluation and improvement of swamp eel germplasm resources.

Claims

1. A SNP marker associated with the chewiness of the muscle texture of the yellow eel, characterized in that, The SNP marker is located at the 18,163,947th base on chromosome 8 of the yellow eel, with a mutation type of A / G, named Chr8:18163947 A>G. This SNP site is located at position 118 of the sequence shown in SEQ ID NO:1, and its preferred genotype is GG.

2. A primer pair for amplifying or detecting the SNP marker of claim 1, characterized in that, The primer pairs are nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:

3.

3. A kit for detecting the chewing properties of muscle texture in eels, characterized in that, The kit contains the primer pair as described in claim 2.

4. The application of the SNP marker as described in claim 1 in predicting the chewiness of the muscle texture of swamp eels or in the breeding of swamp eels.

5. The application of the primer pair according to claim 2 in predicting the chewiness of the muscle texture of swamp eels or in the breeding of swamp eels.

6. The application of the kit according to claim 3 in predicting the chewiness of the muscle texture of swamp eels or in the breeding of swamp eels.

7. The application according to claim 4, wherein SNP markers associated with the chewiness of swamp muscle texture are used to detect the chewiness shape of swamp muscle texture, comprising the following steps: (1) Take muscle tissue from the tail of the eel to be tested and extract the genomic DNA of the eel; (2) Using the genomic DNA of the yellow eel as a template, PCR amplification was performed using the primer pair described in claim 2 to obtain the amplification product; (3) Perform Sanger sequencing on the amplified products to determine the genotype of the individual eel with the SNP marker Chr8:18163947 A>G as described in claim 1; The preferred genotype is GG, and individuals carrying this genotype have significantly higher muscle texture and chewiness than individuals carrying the AG and AA genotypes.

8. The application according to claim 5, wherein the primer pair is used to detect the chewing texture of the muscle of the yellow eel, comprising the following steps: (1) Take muscle tissue from the tail of the eel to be tested and extract the genomic DNA of the eel; (2) Using the genomic DNA of the yellow eel as a template, PCR amplification was performed using the primer pair described in claim 2 to obtain the amplification product; (3) Perform Sanger sequencing on the amplified products to determine the genotype of the individual eel with the SNP marker Chr8:18163947 A>G as described in claim 1; The preferred genotype is GG, and individuals carrying this genotype have significantly higher muscle texture and chewiness than individuals carrying the AG and AA genotypes.

9. A method for detecting the chewiness of the muscle texture of a yellow eel, the method comprising the following steps: (1) Take muscle tissue from the tail of the eel to be tested for the extraction of genomic DNA; (2) Using the genomic DNA of the yellow eel as a template, PCR amplification was performed using the primer pair described in claim 2 to obtain the amplification product; (3) Perform Sanger sequencing on the amplification products to determine the genotype of the individual eel with the SNP marker Chr8:18163947 A>G as described in claim 1; The preferred genotype is GG, and individuals carrying this genotype have significantly higher muscle texture and chewiness than individuals carrying the AG and AA genotypes.

Images