A method for detecting SNP molecular marker related to goat PPP2CA gene and growth traits and application thereof

Abstract

The application discloses a SNP molecular marker related to a goat PPP2CA gene and growth traits and application thereof. The SNP marker is at least one of the following: 64,662,058 (A>T), 64,664,905 (T>C) and 64,665,080 (C>G) of the goat chromosome 7, and the application identifies the above-mentioned sites by using whole genome resequencing and selection signal analysis, finds that the sites are significantly genetically differentiated in the north and south goat populations, and provides key genetic resources and technical support for molecular marker assisted breeding of goat growth traits.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a method and application for detecting SNP molecular markers related to the goat PPP2CA gene and growth traits. Background Technology

[0002] goat( Capra hircus Goats are an important component of the livestock industry, playing a vital role in ensuring a supply of high-quality meat, promoting regional agricultural economic development, and increasing farmers' and herders' income. As the livestock industry develops towards higher efficiency and precision, improving the growth rate and meat production performance of goats has become a core objective in goat breeding. Growth traits in goats (such as body size and weight) are key indicators for measuring their meat production performance. At the physiological level, these traits are highly intrinsically correlated with peripheral skeletal muscle development and adipose tissue deposition. Fat deposition (especially subcutaneous and intramuscular fat) not only directly regulates energy metabolism and distribution but also determines meat quality; while skeletal muscle, as the tissue with the highest proportion in the body, directly determines body size structure. Therefore, elucidating the dual molecular mechanisms regulating the development of skeletal muscle and adipose tissue in goats is of great significance for breeding new high-yielding meat goat breeds.

[0003] Traditional goat breeding relies primarily on phenotypic selection and pedigree recording. However, growth, development, and fat deposition are complex, multi-gene regulated quantitative traits with moderate to high heritability, making them susceptible to interference from external factors such as feeding practices and climate. Phenotypic selection alone is not only time-consuming and inefficient but also fails to accurately assess an individual's early genetic potential, resulting in a slow aggregation of superior genes. With the rise of marker-assisted selection (MAS) technology, utilizing high-density genetic markers such as single nucleotide polymorphisms (SNPs) for early molecular selection has become a key approach to overcoming the bottlenecks of traditional breeding methods.

[0004] Depending on their genomic location, SNPs can be distributed in either the coding or non-coding regions of a gene. Among them, SNPs located in the 3' Untranslated Region (3'UTR), while not altering the amino acid sequence of a protein, are often situated in the core region for microRNA (miRNA) binding. Base variations in these SNPs can precisely regulate the expression and translation of target genes at the post-transcriptional level by altering the binding affinity of miRNAs to the 3'UTR of the target gene. These regulatory SNPs with clearly defined functional effects, because they directly participate in the biological regulation of traits, often exhibit higher predictive accuracy and genetic stability than ordinary linkage markers in breeding practice. Summary of the Invention

[0005] In order to overcome the shortcomings and deficiencies of the existing technology, the purpose of this invention is to provide a SNP molecular marker for detecting the relationship between the goat PPP2CA gene and growth traits.

[0006] Another object of the present invention is to provide the application of the above-mentioned SNP molecular markers for detecting the goat PPP2CA gene and its association with growth traits. The objective of this invention is achieved through the following technical solution: A molecular marker for detecting the SNP associated with the goat PPP2CA gene and growth traits, comprising at least one of the following: (a) The nucleotide sequence containing the upstream and downstream sequences of the SNP site is SEQ ID NO.1, and the site is located at position 176 of the goat reference genome at nucleotide position 64662058 on chromosome 7. (b) The nucleotide sequence containing the upstream and downstream sequences of the SNP site is shown in SEQ ID NO.2, and the site is located at position 176 of the goat reference genome chromosome 7. (c) Located at nucleotide position 64665080 on chromosome 7 of the goat reference genome, the base of which is C or G. The nucleotide sequence containing the upstream and downstream sequences of this SNP site is shown in SEQ ID NO.3, and the site is located at position 176 of this sequence.

[0007] A reagent or kit for detecting SNP molecular markers associated with growth traits in goat PPP2CA gene, comprising primers for amplifying the SNP site at 176 bp of the nucleotide sequence in SEQ ID NO. 1–3.

[0008] The primers described can be designed according to primer design principles to detect SNP molecular markers related to growth traits in goats' PPP2CA gene, thereby predicting the growth traits of goats.

[0009] The above-mentioned reagents or kits for detecting SNP molecular markers related to growth traits in goats and / or detecting SNP molecular markers related to growth traits in goats are used in the detection, prediction, or assisted prediction of growth traits in goats.

[0010] The above-mentioned reagents or kits for detecting SNP molecular markers related to growth traits in goat PPP2CA gene and / or goat PPP2CA gene and growth traits are used in goat resource identification, improvement or molecular marker-assisted breeding.

[0011] A molecular marker-assisted selection breeding method for meat goats, comprising at least one of the following: (a) Identify the SNP molecular markers of breeding goats in the core goat population, select individuals with the TT type at the 176bp of the SNP marker shown in SEQ ID NO.1, and eliminate individuals with the AT and AA types, so as to increase the frequency of the T gene at this locus generation by generation, thereby improving the growth traits of offspring goats; (b) Identify the SNP molecular markers of breeding goats in the core goat population, select individuals with the CC type at the 176bp of the SNP marker shown in SEQ ID NO.2, and eliminate individuals with the CT and TT types, so as to increase the frequency of gene C at this locus in each generation, thereby improving the growth traits of offspring goats; (c) Identify the SNP molecular markers of breeding goats in the core goat population, select individuals with the GG type at the 176bp of the SNP marker shown in SEQ ID NO.3, and eliminate individuals with the CG and CC types, so as to increase the frequency of the G gene at this locus generation by generation, thereby improving the growth traits of offspring goats.

[0012] The NCBI database accession number for the goat reference genome is GCF_001704415.2, and the version number is ARS1.2.

[0013] Application of reagents that downregulate PPP2CA gene expression in regulating goat preadipocyte proliferation.

[0014] Application of reagents that downregulate PPP2CA gene expression in increasing body fat percentage in goats.

[0015] The reagents used to downregulate PPP2CA gene expression include the chi-miR-1224 mimic, whose nucleotide sequence is as follows: GUGAGGACUCGGGAGGUGGAGG.

[0016] The reagent for downregulating PPP2CA gene expression also includes a reagent for transferring the chi-miR-1224 mimic into cells; preferably Lipo8000.

[0017] The reagent that downregulates PPP2CA gene expression can enhance the proliferation of goat preadipocytes and improve body fat percentage when applied to meat goat breeding. The present invention has the following advantages and effects compared with the prior art: (1) This invention is the first to utilize sequencing data to select signals in goats PPP2CAThree mutation sites were identified in the 3'UTR region of the gene, specifically located at positions 64662058 (A / T), 64664905 (T / C), and 64665080 (C / G) on chromosome 7 of the goat reference genome ARS1 version. Analysis revealed significant genetic differentiation at these mutation sites in goat populations in both southern and northern my country. Furthermore, association analysis in a large-scale (653 animals) growth phenotype record population showed a high correlation between these mutation sites and growth and body size traits in goats. Specifically, individuals carrying the TT genotype at the g.64662058AT mutation site exhibited significantly higher body height, chest width, chest depth, and rump height compared to individuals with the AA genotype. P <0.05). Individuals carrying the CC genotype (g.64664905TC) had significantly higher body height, chest width, chest depth, and hip height than individuals with the TT genotype. P <0.05; meanwhile, individuals with the CT genotype had significantly higher waist-to-leg width and hip height than individuals with the TT genotype ( P <0.05). Individuals carrying the GG genotype (g.64665080CG) had significantly higher body height, chest width, and chest depth than individuals with the CC genotype. P <0.05; meanwhile, individuals carrying the GC genotype had significantly wider waists and legs than those carrying the CC genotype. P <0.05). This provides a key, significant candidate genetic marker for the accurate assessment of goat growth and body shape traits and for early molecular breeding.

[0018] (2) This application revealed the specific mechanism by which this mutation site regulates growth and fat deposition traits in goats through experiments at the cellular and molecular levels. Dual-luciferase reporter assay, EdU incorporation assay, and gene expression detection showed that the g.64662058A>T mutation is located at chi-miR-1224 and PPP2CA Within the core binding region of the 3'UTR of the gene. The wild-type A allele can be specifically targeted and repressed by chi-miR-1224. PPP2CA This significantly downregulated the mRNA and protein expression levels of key adipogenic marker genes (PPARγ, C / EBPα, and FABP4), thereby significantly inhibiting the proliferation and adipogenic differentiation of proadipocytes. P <0.01); while the mutant T allele effectively blocked the targeted inhibition of chi-miR-1224. This indicates that this mutation site can sensitively respond to the targeted regulation of miRNAs, with the T allele promoting adipogenic differentiation of cells by blocking the inhibitory effect. This site can be used as a target for goat... PPP2CAKey functional molecular markers regulating growth traits and fat development. This invention not only enables precise molecular assessment of goat body size development potential and fat deposition characteristics, but also provides crucial genetic breeding clues for balancing high meat production performance (TT-type body size advantage) with adaptability to hot and humid climates (strong selection characteristics of the T allele in northern regions). It has significant economic and scientific value for the protection of local goat genetic resources in my country, precise marker-assisted selection, and industrial genetic improvement. Attached Figure Description

[0019] Figure 1 Different selection signal methods for southern and northern goats (F ST The selective scanning region on chromosome 7 (θπ ratio and XP-EHH) of the goat, which is located in the goat PPP2CA Intragenic regions.

[0020] Figure 2 This is a phenotypic difference map of the found set of traits associated with the g.64662058AT locus and goat body height.

[0021] Figure 3 This is a phenotypic difference map showing the association between the selected g.64664905TC locus and the body height and hip height of goats.

[0022] Figure 4 This is a phenotypic difference map of the found set of traits associated with the g.64665080CG locus and goat body height.

[0023] Figure 5 This is a phenotypic difference graph of the validation set of the g.64662058AT locus and the association between body height in goats.

[0024] Figure 6 This is a phenotypic difference graph of the validation set of g.64664905TC locus and its association with goat body height and hip height.

[0025] Figure 7 This is a phenotypic difference plot of the validation set of the g.64665080CG locus that was screened and associated with body height in goats.

[0026] Figure 8 yes PPP2CA A schematic diagram of the wild-type and mutant 3'-UTR sequences of a gene; WT represents wild-type (A), and MU represents mutant (T).

[0027] Figure 9 It is a dual-luciferase reporter; P <0.05 (t-test); ns not significant, where MC-WT is the control group wild-type, MC-MUT is the control group mutant, and chi-miR-1224-WT is the control group mutant. PPP2CA Overexpression of chi-miR-1224 wild-type gene, chi-miR-1224-MUT is associated with PPP2CA Gene overexpression of the chi-miR-1224 mutant.

[0028] Figure 10 This is a graph showing the proliferation and differentiation analysis of goat preadipocytes after overexpression of chi-miR-1224;** P <0.01 (t-test).

[0029] Figure 11 The effect of chi-miR-1224 overexpression on the mRNA and protein levels of adipogenic differentiation marker genes (PPARγ, C / EBPα, and FABP4); P <0.01 (t-test). Detailed Implementation

[0030] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto. Example 1: Sample Analysis and Acquisition of SNP Locus Data 1.1 Blood sample collection and genomic DNA extraction This invention collected blood samples from goats at a farm in Zhanjiang City, Guangdong Province. During sampling, 5 mL of blood was collected from the goat's jugular vein using a veterinary lancet and placed in an EDTA anticoagulant tube. The anticoagulant tube was then transported back to the laboratory in an insulated box with ice packs and stored at -20°C. Genomic DNA was extracted from the blood samples using a blood genomic DNA extraction kit from Kangwei Century (Jiangsu) Biotechnology Co., Ltd. The qualified genomic DNA was sent to Beijing Compson Biotechnology Co., Ltd. for secondary quality control and library construction, and then subjected to PE150 whole-genome resequencing on the BGI Genomics platform. Raw data was obtained in FASTQ format. High-depth whole-genome resequencing was performed on 20 samples, with an average sequencing depth of 11.32×. Low-depth whole-genome resequencing was performed on 72 samples, with an average sequencing depth of 1.06×.

[0031] 1.2 Analysis of raw sequencing data and genome alignment High-depth sequencing data and low-depth sequencing data are subjected to the same quality control process.

[0032] (1) Use Fastp software to filter the original data file.

[0033] (2) The quality-controlled data were aligned using BWA software (reference genome is ARS1, GCA_001704415.1).

[0034] (3) Use Samtools to sort the compared BAM files.

[0035] (4) Use GATK to remove duplicate segments.

[0036] 1.3 Detection of variant sites and genotyping (1) GATK HaploytypeCaller generates gvcf files for each sample according to autosomal number.

[0037] (2) GATK CombineGVCFs merges the gvcf files of each sample of a single chromosome.

[0038] (3) GATK Genotype GVCFs were used for population SNP calling based on chromosomes.

[0039] (4) GATK MergeVcfs merges the vcf files of autosomal populations.

[0040] (5) GATK SelectVariants filters SNPs in vcf files of a population.

[0041] (6) GATK Variant Filtration to mark false positive SNP sites.

[0042] (7) The grep command filters the marked SNP sites.

[0043] (8) Plink software filters SNP sites (geno0.1--maf0.05--hwele-06).

[0044] (9) Genotype filling was performed using glimpse2 software, resulting in 20,802,514 high-quality SNPs. Example 2: Genome-wide selection signal analysis of southern and northern goat populations To further identify selection features distinguishing southern and northern goats, we conducted genome-wide selection signal analysis between a representative southern goat population (70 individuals) and a northern goat population (69 individuals). We employed multiple statistical methods: FST, θπ ratio, and Tajima's D were estimated using VCFtools v0.1.15, and XP-EHH was calculated using Selscanv1.2.0. All indicators were calculated using a 50-kb sliding window with a 20-kb step size. Genomic regions falling within the top 1% of each statistic and overlapping across different methods were considered candidate selection scan regions. To validate strong selection signals, we performed XP-CLR analysis using XP-CLR v1.0.

[0045] Experimental results are as follows Figure 1 As shown, the selection signal analysis results indicate that a signal containing a specific signal is present on chromosome 7. PPP2CA Significant selection signals were observed in the gene region (windowing Fst = 0.19–0.30, θπ ratio = 0.73–0.91, XP-EHH = 2.99–3.67), which also showed high XP-CLR scores and low Tajima's D values. Example 3: Association analysis between molecular markers and growth traits in goats 3.1 Screening of associated SNP sites In screening PPP2CA When there is a potential causative mutation within a gene region, we PPP2CA Three mutation sites were identified in the 3'UTR region of the gene, located at positions 64662058 (A / T), 64664905 (T / C), and 64665080 (C / G) on chromosome 7. The T allele at the g.64662058AT mutation site was dominant in the northern goat population (gene frequency 76.09%), but relatively low in the southern goat population (gene frequency 22.14%). At g.64664905TC, the mutant T allele was dominant in the northern goat population (AF = 76.81%), but relatively low in the southern goat population (AF = 22.86%). At g.64665080CG, the mutant C allele was dominant in the northern goat population (AF = 78.26%), but relatively low in the southern goat population (AF = 22.86%). To verify the relationship between these loci and goat growth traits, a total of 448 goats with growth phenotype records were selected as the discovery set to identify and statistically analyze the phenotypic differences in their genotypes. Due to experimental batches, data gaps, and quality control screening, the number of samples involved in each locus was not exactly the same.

[0046] The experimental results are shown in Tables 1-6 and Figures 2-4 As shown, in the discovery set, the g.64662058A>T locus was significantly associated with body height, and individuals with the TT genotype were significantly taller than those with the AA genotype (+2.83 cm). P =0.0161), indicating that the T allele is a favorable allele. The g.64664905T>C locus is significantly associated with body height and hip height, and individuals with the CC genotype have a height (+2.29 cm, P =0.0109) and hip height (+1.99 cm, P The C allele was significantly higher than that of the TT genotype (g.64665080C>G) at a height of 0.0449, indicating that the C allele was the favorable allele. The g.64665080C>G locus was significantly associated with body height; individuals with the GG genotype were significantly taller than those with the CC genotype (+1.85 cm).P =0.0323), indicating that the G allele is a favorable allele.

[0047] Table 1. Effects of different genotypes at the discovery set g.64662058A>T locus on growth traits in goats.

[0048] Table 2. Effects of different genotypes at the discovery set g.64664905T>C locus on growth traits in goats.

[0049] Table 3. Effects of different genotypes at the discovery set g.64665080C>G locus on growth traits in goats.

[0050] Table 4. Association analysis of the concentrated PPP2CA gene g.64662058A>T site with goat growth traits.

[0051] Table 5 shows the association analysis between the concentrated PPP2CA gene g.64664905C>G site and goat growth traits.

[0052] Table 6. Association analysis of the concentrated PPP2CA gene g.64665080C>G site with goat growth traits.

[0053] PPP2CA The nucleotide sequence of the 3'UTR transcript of the gene g.64662058A>T site is shown below (200 bp upstream and downstream of the g.64662058A>T site, totaling 401 bp, corresponding to genomic coordinates 64661858-64662258): CAAACUAAUGUGUCUACUUAUCAGUCACUGCAGUUUCUGGUAAUAAAUAUUGCUGUGUAACAUGGACAUUUUAAGAUGAUUGAGAGAUUGGUCAGUUUUUAACAAAUACUUGAACAUUGCUUGUCACAUGACCUUACAGUUAAAUUGUCUCAGAUAGGAUAUAGCUCUUAAAAUAUUUUCCUCUAUUAAUUUAAGUUCUUAAAAUGAAACAAAAUCAAAUGAAAAACUAUUACUGGAUCAUGGUUUAGUGUUAUGCACAUUCACCCAAGGAUAAAAAUGGCAUUUGAAAUGAAGUGGCAGUGAUAAGCACAUAAUGAGUUCCCCCCCAGCCUGUCUUUUAUCCUUUGAAUAGUAUUAGGAAGUUGAAAUAGAUACUAAUACUUGAUAAUACCAGUAUAAAU; The nucleotide sequence corresponding to the positioning sequence (64661858-64662258) containing the above SNP site is shown below: CAAACTAATGTGTCTACTTATCAGTCACTGCAGTTTCTGGTAATAAATATTGCTGTGTAACATGGACATTTTAAGATGATTGAGAGATTGGTCAGTTTTTAACAAATACTTGAACATTGCTTGTCACATGACCTTACAGTTAAATTGTCTCAGATAGGATATAGCTCTTAAAATATTTTCCTCTATTAATTTAAGTTCTTTAAATGAAACAAAATCAAATGAAAAACTATTACTGGATCATGGTTTAGTGTTATGCACATTCACCCAAGGATAAAAATGGCATTTGAAATGAAGTGGCAGTGATAAGCACATAATGAGTTCCCCCCCAGCCTGTCTTTTATCCTTTGAATAGTATTAGGAAGTTGAAATAGATACTAATACTTGATAATACCAGTATAAAT。

[0054] PPP2CAThe nucleotide sequence of the 3'UTR transcript of the gene g.64664905T>C site is shown below (200 bp upstream and downstream of the g.64664905T>C site, for a total of 401 bp, corresponding to genomic coordinates 64664705-64665105): CCAACCAGUCCAUUCUGAACAUCAGUCCUGGGUGUUCUUUGCUAAAUGAUGCUAAAUGAUGCUAAAGGUGAAACUUCAGUACUUUGGCCACCUCAUGUGAAGAGUUGACUCAUUGGAAAAGACUCUGAUGCUGGGAGGGAUUGGGGGCAGGAGGAGAAGGGGAUGACAGAGGAUGAGAUGGCUGGAUGGCAUCACUGACUU GAUGGACGUGAGUUUGAGUGAACUCCAGGAGAUGAUGGACAGGGAGGCCUGGCAUGCUGUGAUUCAUGGGGUCUCAAAGAGUCAGACAUGACGGAGCAACUGAACUGAACUGAAUCUUUGUUUCCUGUAAUCACAUGGAAAAGAAUAAUCUCUGUUGUUCAGAUACAAACUUGUCCCUGACUCUGCAGCCCCAUGGACUG; The corresponding nucleotide sequences containing the above SNP sites (64664705-64665105) are shown below: CCAACCAGTCCATTCTGAACATCAGTCCTGGGTGTTCTTTGCTAAATGATGCTAAATGATGCTAAAGGTGAAACTTCAGTACTTTGGCCACCTCATGTGAAGAGTTGACTCATTGGAAAAGACTCTGATGCTGGGAGGGATTGGGGGCAGGAGGAGAAGGGGATGACAGAGGATGAGATGGCTGGATGGCATCACTGACTC GATGGACGTGAGTTTGAGTGAACTCCAGGAGATGATGGACAGGGAGGCCTGGCATGCTGTGATTCATGGGGTCTCAAAGAGTCAGACATGACGGAGCAACTGAACTGAACTGAATCTTTGTTTCCTGTAATCACATGGAAAAGAATAATCTCTGTTGTTCAGATACAAACTTGTCCCTGACTCTGCAGCCCCATGGACTG.

[0055] PPP2CA The nucleotide sequence of the 3'UTR transcript of the gene g.64665080C>G site is shown below (with the g.64665080C>G site as the center, 200 bp upstream and the downstream ends at the end of the 3'UTR region, totaling 389 bp, corresponding to genomic coordinates 64664880-64665268): AGAUGGCUGGAUGGCAUCACUGACUUGAUGGACGUGAGUUUGAGUGAACUCCAGGAGAUGAUGGACAGGGAGGCCUGGCAUGCUGUGAUUCAUGGGGUCUCAAAGAGUCAGACAUGACGGAGCAACUGAACUGAACUGAAUCUUUGUUUCCUGUAAUCACAUGGAAAAGAAUAAUCUCUGUUGUUCAGAUACAAA CUUGUCCCUGACUCAGCAGCCCCAUGGACUGUGGCAUACCAGGCUUCUCCAUUUUUCACUAUCUCCCAGAGUUGGUGGGUGCCAUCCAACCAUCUUUUCUGUUACCCCCUCUUUCCUCCUGCCCUCAGUCUUUGCCAGCAUCAUGGUCUUUUCCAAUGAGUUGGGUCUUUGUAUCAGGUGGUGAAAGGAUUAGAG; The corresponding nucleotide sequences containing the above SNP sites (64664880-64665268) are shown below: AGATGGCTGGATGGCATCACTGACTTGATGGACGTGAGTTTGAGTGAACTCCAGGAGATGATGGACAGGGAGGCCTGGCATGCTGTGATTCATGGGGTCTCAAAGAGTCAGACATGACGGAGCAACTGAACTGAACTGAATCTTTGTTTCCTGTAATCACATGGAAAAGAATAATCTCTGTTGTTCAGATACAAA CTTGTGCCTGACTCTGCAGCCCCATGGACTGTGGCATACCAGGCTTCTCCATTTTTCACTATCTCCCAGAGTTGGTGGTGCCATCCAACCATCTTTTCTGTTACCCCCTCTTTCCTCCTGCCCTCAGTCTTTGCCAGCATCATGGTCTTTCCAATGAGTTGGGTCTTTGTATCAGGTGGTGAAAGGATTAGAG.

[0056] 3.2 Verification of SNP site specificity To verify whether the selected SNP loci can be used to predict goat growth traits, an additional 522 goat samples with growth phenotype records, independent of the discovery set, were selected for independent identification and statistical verification. Due to experimental batches, data gaps, and quality control screening, the number of samples involved for each locus was not exactly the same.

[0057] The experimental results are shown in Tables 7-12 and Figures 5-7 As shown, in the independent validation set, the effect directions of the three SNP loci were completely consistent with those in the discovery set: For the g.64662058A>T locus: individuals with the TT genotype were significantly taller than those with the AA genotype (+1.95 cm). P =0.0216), verifying the stable genetic effect of this locus on body height. g.64664905T>C locus: Individuals with CC and CT genotypes had a body height (CC+2.27 cm, P =0.0395; CT+2.04 cm, P =0.0332) and hip height (CC+2.42 cm, P =0.0377; CT+2.45 cm, P The height of individuals with the C>G locus was significantly higher than that of individuals with the TT genotype (+0.0157), and the direction of the effect was completely consistent with the discovery set (CC>CT>TT), verifying the stable genetic effect of this locus on body height and hip height. At the g.64665080C>G locus: individuals with the GG genotype were significantly taller than individuals with the CC genotype (+2.69 cm). P=0.0208), the direction of the effect is completely consistent with the discovery set (GG>GC>CC), verifying the stable genetic effect of this locus on body height.

[0058] Table 7. Effects of different genotypes at the validation set g.64662058A>T locus on growth traits in goats.

[0059] Table 8. Effects of different genotypes at the T>C locus in the validation set g.64664905 on growth traits in goats.

[0060] Table 9. Effects of different genotypes at the C>G locus in the validation set g.64665080 on growth traits in goats.

[0061] Table 10 Association analysis between the PPP2CA gene g.64662058A>T site in the validation set and growth traits in goats.

[0062] Table 11 Association analysis between the PPP2CA gene g.64664905C>G site in the validation set and growth traits in goats.

[0063] Table 12 Association analysis between the PPP2CA gene g.64665080C>G site in the validation set and growth traits in goats. Example 4: Overexpression experiment to verify the effect of mutant SNP sites on cell growth 4.1 PPP2CA Detection of miRNA overexpression efficiency at gene mutation sites Since SNPs in the 3'UTR region typically regulate gene expression by altering miRNA binding affinity, we used RNAHybrid 2.2 software to predict the potential miRNAs for this variant. The results showed that... PPP2CA The gene is a highly targeted gene of chi-miR-1224 (-20.2 kcal / mol). Prediction results indicate that the mutation at chromosome 7, 64,662,058 (A / T), is located within the core binding region of this miRNA, suggesting that variations in this allele may alter the regulatory effects of the miRNA. Figure 8 ).

[0064] A dual-luciferase reporter assay was performed using HEK293T cells to verify the targeting relationship. Cells were cultured in DMEM medium (Gibco, USA) supplemented with 10% fetal bovine serum (VISTECH, China) and 1% penicillin-streptomycin, and incubated at 37°C in a humidified incubator with 5% CO2. When the cells reached a certain confluence, they were passaged using 0.25% trypsin-EDTA (Gibco, USA) at a 1:n ratio.

[0065] For the luciferase reporter gene construct, a construct containing the predicted binding site of chi-miR-1224 was synthesized. PPP2CA The wild-type (WT) 3'-UTR fragment (as shown in SEQ ID NO.7) was digested with 0.25% EDTA using trypsin and inserted downstream of the firefly luciferase gene in the pmirGLO dual-luciferase reporter vector (Promega, USA) (using double digestion with NheI and XhoI followed by ligation). Mutant (MUT) versions of these vectors (as shown in SEQ ID NO.8) were constructed by site-directed mutagenesis to disrupt binding complementarity within the seed region.

[0066] The dual-luciferase assay was performed in 96-well plates. Cells in logarithmic growth phase were cultured at 1.5 × 10⁶ cells per well. 4 Cells were seeded at a density of [number] cells and incubated overnight. Co-transfection was performed using Lipo8000 transfection reagent (Beyotime, China), with 0.2 μg WT or MUT reporter plasmid and 0.2 μg miRNA mimic or negative control (NC) mimic per well. Six hours after transfection, the transfection medium was replaced with 100 μL of fresh complete medium. After culturing for another 48 hours, luciferase activity was detected using the Dual-Glo® luciferase detection system (Promega, E2980). First, 35 μL of luciferase substrate was added to detect firefly luciferase activity, followed by 30 μL of Stop&Glo® reagent to detect Renida luciferase activity. Relative luciferase activities were calculated by normalizing the firefly fluorescence signal to the Renida signal.

[0067] The nucleotide sequence of the negative control (NC) mimic is as follows: UUCUCCGAACGUGUCACGUdTdT; The nucleotide sequence of the chi-miR-1224 mimic is as follows: GUGAGGACUCGGGAGGUGGAGG.

[0068] The results of the dual-luciferase reporter gene assay showed that in HEK-293T cells transfected with chi-miR-1224, the luciferase activity of PPP2CA-WT was significantly reduced.P <0.05), while having no significant effect on the luciferase activity of the PPP2CA-Mut mutant plasmid ( P >0.05), see Figure 9 Western blot results further confirmed that overexpression of chi-miR-1224 significantly inhibited the expression level of PPP2CA protein. P <0.05). In summary, the above results confirm that chi-miR-1224 directly targets... PPP2CA The 3'UTR of the gene was modified, and the protein expression of the gene was suppressed in HEK-293T cells.

[0069] 4.2 PPP2CA Effect of overexpression of chi-miR-1224 at a mutated site on the proliferation of goat preadipocytes The effect of chi-miR-1224 on the proliferation of primary goat preadipocytes was assessed using a 5-ethynyl-2'-deoxyuridine (EdU) incorporation assay to evaluate its functional role. A brief summary of the steps is as follows: Goat preadipocytes (from Cyos) were used at a rate of 2 × 10⁻⁶. 5 Cells were seeded at a density of [number] cells / mL in 96-well plates. Following the method described in 4.1, 0.2 μg of miRNA mimic or negative control (NC) mimic was transfected into the cells using Lipo8000 transfection reagent, followed by incubation with 20 μM EdU (Beyotime, China) for 2 hours. Subsequently, cells were fixed with 4% paraformaldehyde, permeabilized with 0.3% Triton X-100, and blocked with 3% BSA. A Click reaction was performed for 30 minutes, followed by nuclear staining with DAPI for 10 minutes. Images were acquired using a fluorescence microscope (excitation wavelength 470 nm, emission wavelength 525 nm), and the proportion of EdU-positive cells was calculated to determine the proliferation rate.

[0070] To assess adipogenic differentiation, adipocytes were induced to differentiate when they reached 50%–70% confluence. After the induction period, cells were fixed with 4% paraformaldehyde for 20 minutes and stained with filtered Oil Red O working solution (Oil Red O:water = 3:2) for 15 minutes. The accumulation of lipid droplets was observed and photographed under a microscope.

[0071] EdU incorporation experiments showed that, compared with the NC mimics group, chi-miR-1224 transfection significantly promoted the proliferation of preadipocytes. P <0.05), see Figure 10Finally, to validate the differentiation phenotype at the molecular level, we used qRT-PCR and Western blot to detect the expression of key adipogenic differentiation marker genes (PPARγ, C / EBPα, and FABP4).

[0072] 4.3 Detection of expression levels of key adipogenic differentiation marker genes To validate differentiation phenotypes at the molecular level, the expression of key adipogenic differentiation marker genes (PPARγ, C / EBPα, and FABP4) in cells cultured in section 4.2 was detected using qRT-PCR and Western blot.

[0073] Total RNA was extracted from cells using RNAiso Plus reagent (Takara, Japan). RNA concentration and purity were determined using a spectrophotometer. Reverse transcription was performed using the Hifair® II First-Strand cDNA Synthesis Kit (Yeasen, China). Quantitative PCR was performed on an ABI ViiA 7 system using Hieff® qPCR SYBR Green premix (Yeasen, China). The reaction program was: initial denaturation at 95°C for 5 minutes, followed by 40 cycles of 95°C for 10 seconds and 60°C for 30 seconds. The relative expression levels of adipogenic marker genes (including PPARγ, C / EBPα, and FABP4) were calculated using the 2⁻ΔΔCt method, with β-actin as an internal control.

[0074] Total protein was extracted using RIPA lysis buffer supplemented with protease and phosphatase inhibitors. Protein concentration was quantified using a BCA protein assay kit (UElandy, China). Protein samples were denatured at 100°C for 10 min, separated by SDS-PAGE, and electrotransferred to PVDF membranes (Millipore, USA). The membranes were blocked with 5% skim milk at room temperature for 1 h, then incubated overnight at 4°C with primary antibodies (PPARγ, 1:2,000; FABP4, 1:2,000; or β-actin, 1:50,000). After washing with TBST, the membranes were incubated with HRP-labeled secondary antibody (1:10,000) at room temperature for 1 h. Protein bands were visualized using an ECL chemiluminescence system and analyzed using an imaging system.

[0075] The results showed that the chi-miR-1224 mimics group significantly upregulated the mRNA and protein expression levels of these adipogenic genes. P <0.01), see Figure 11 These findings provide mechanistic evidence that selection acts on... PPP2CASpecific variations in the 3'UTR of the gene finely regulate the proliferation and adipogenesis of preadipocytes through allele-specific miRNA interference, ultimately leading to regional phenotypic differentiation in Chinese local goats. The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A molecular marker for detecting the SNP associated with the goat PPP2CA gene and growth traits, characterized in that... It is at least one of the following: (a) The nucleotide sequence containing the upstream and downstream sequences of the SNP site is SEQ ID NO.1, and the site is located at position 176 of the goat reference genome at nucleotide position 64662058 on chromosome 7. (b) The nucleotide sequence containing the upstream and downstream sequences of the SNP site is shown in SEQ ID NO.2, and the site is located at position 176 of the goat reference genome chromosome 7. (c) Located at nucleotide position 64665080 on chromosome 7 of the goat reference genome, the base of which is C or G. The nucleotide sequence containing the upstream and downstream sequences of this SNP site is shown in SEQ ID NO.3, and the site is located at position 176 of this sequence.

2. A reagent or kit for detecting SNP molecular markers associated with the goat PPP2CA gene and growth traits, characterized in that: Includes primers for amplifying the SNP site at 176 bp in the nucleotide sequences of SEQ ID NO.1–3.

3. The reagent or kit for detecting SNP molecular markers related to growth traits in goats according to claim 2, characterized in that: The primers described can be designed according to primer design principles to detect SNP molecular markers related to growth traits in goats' PPP2CA gene, thereby predicting the growth traits of goats.

4. The application of the reagent or kit for detecting SNP molecular markers related to growth traits of goat PPP2CA gene as described in claim 1 and / or any of the reagents or kits for detecting SNP molecular markers related to growth traits of goat PPP2CA gene as described in claims 2 to 3 in the detection, prediction or assisted prediction of goat growth traits.

5. The application of the reagent or kit for detecting SNP molecular markers related to growth traits of the goat PPP2CA gene as described in claim 1 and / or any of the reagents or kits for detecting SNP molecular markers related to growth traits of the goat PPP2CA gene as described in claims 2 to 3 in goat resource identification, improvement or molecular marker-assisted breeding.

6. A molecular marker-assisted selection breeding method for meat goats, characterized in that... It is at least one of the following: (a) Identify the SNP molecular markers of breeding goats in the core goat population, select individuals with the TT type at the 176bp of the SNP marker shown in SEQ ID NO.1, and eliminate individuals with the AT and AA types, so as to increase the frequency of the T gene at this locus generation by generation, thereby improving the growth traits of offspring goats; (b) Identify the SNP molecular markers of breeding goats in the core goat population, select individuals with the CC type at the 176bp of the SNP marker shown in SEQ ID NO.4, and eliminate individuals with the CT and TT types, so as to increase the frequency of gene C at this locus in each generation, thereby improving the growth traits of offspring goats. (c) Identify the SNP molecular markers of breeding goats in the core goat population, select individuals with the GG type at the 176bp of the SNP marker shown in SEQ ID NO.5, and eliminate individuals with the CG and CC types, so as to increase the frequency of the G gene at this locus generation by generation, thereby improving the growth traits of offspring goats.

7. Application of reagents that downregulate PPP2CA gene expression in regulating goat preadipocyte proliferation.

8. The application of the reagent for downregulating PPP2CA gene expression according to claim 7 in regulating the proliferation of goat preadipocytes, characterized in that: The reagents used to downregulate PPP2CA gene expression include the chi-miR-1224 mimic, whose nucleotide sequence is as follows: GUGAGGACUCGGGAGGUGGAGG.

9. The application of the reagent for downregulating PPP2CA gene expression according to claim 7 in regulating the proliferation of goat preadipocytes, characterized in that: The reagent for downregulating PPP2CA gene expression also includes a reagent for transferring the chi-miR-1224 mimic into cells.

Images