A set of reference gene combinations for gene expression analysis of different developmental stages of macrobrachium rosenbergii larvae and application thereof

Abstract

The application discloses a combination of reference genes for gene expression analysis of different development stages of macrobrachium rosenbergii larvae and application thereof, and belongs to the technical field of molecular biology. ND-ASHI The combination of reference genes is composed of Prosbeta7 Gene and ND-ASHI Gene; the nucleotide sequence of the Prosbeta7 Gene is shown as SEQ ID NO. 1; and the nucleotide sequence of the ND-ASHI Gene is shown as SEQ ID NO. 2. Research finds that Prosbeta7 Gene and β‑ Gene have a variance of less than 0.04 in the whole cycle of hatching of the macrobrachium rosenbergii larvae, which is far lower than the expression fluctuation of traditional reference genes actin 、 GAPDH and EF1a in the same sample, solves the industry pain points of expression drift and inaccurate quantification of traditional reference genes in the metamorphosis stage of the larvae, and significantly improves the reliability of gene expression comparison in the development stage of the larvae.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and in particular to a set of internal reference gene combinations for gene expression analysis at different developmental stages of giant freshwater prawn larvae and their applications. Background Technology

[0002] The giant freshwater prawn (Macrobrachium rosenbergii) is one of the core economic shrimp species in my country's freshwater aquaculture. Its larval hatching and metamorphosis are key aspects of seedling production management and developmental biology research. Quantitative real-time PCR (qRT-PCR) is currently the mainstream technique for gene expression level analysis, and stable internal reference genes are crucial for eliminating systematic errors in sample preparation, reverse transcription, and amplification efficiency, ensuring accurate and comparable quantitative results.

[0003] Currently, β-actin is commonly used in research on giant freshwater prawns. β-actin ), glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ) and eukaryotic transcription elongation factor 1a ( EF1a Traditional housekeeper genes, such as those mentioned above, are used as internal controls. These genes have been validated and used in adult tissues and under specific stress conditions. Publicly available studies on screening internal control genes also largely focus on different tissues of adult giant freshwater prawns, adult pathogen infections, and adult environmental stress. However, research targeting the larval development stage faces the following obstacles: 1. Lack of dedicated internal reference data for the entire hatching cycle of larvae.

[0004] Traditional housekeeper genes are subject to significant fluctuations and poor stability in expression levels during the complete hatching cycle of giant freshwater prawn larvae (0-21 days). This is due to the intense physiological processes such as embryonic differentiation, larval metamorphosis, and osmotic pressure regulation. As a result, they cannot meet the calibration requirements for gene expression comparisons across developmental stages, and direct use of them can lead to significant deviations in quantitative results.

[0005] 2. The screening system has insufficient coverage and limited rigor.

[0006] Current internal reference screening for larvae is mostly based on a small number of developmental time points and a limited number of candidate genes. It does not conduct initial screening through large-scale expression profiling analysis at the whole transcriptome level, making it difficult to screen out truly stable internal reference genes throughout the entire genome.

[0007] 3. The reliability of single-gene internal reference calibration is insufficient.

[0008] Existing studies mostly use single internal reference genes for expression calibration. However, during periods of drastic physiological changes, such as metamorphosis in larvae, single internal reference genes are prone to expression drift. There is a lack of systematically validated multi-gene internal reference combinations to further improve the reliability of quantitative results.

[0009] Based on the aforementioned technical deficiencies, developing a set of highly stable internal reference gene combinations for the entire hatching cycle of giant freshwater prawn larvae and establishing standardized screening and verification methods is the core requirement for solving the problem of inaccurate quantification of gene expression in larval development studies. It can also provide a reliable calibration tool for molecular detection technology in seedling production. Summary of the Invention

[0010] The purpose of this invention is to provide a set of internal reference gene combinations for gene expression analysis at different developmental stages of giant freshwater prawn larvae and their applications, in order to solve the problems existing in the prior art.

[0011] To address the deficiency in existing technologies regarding the lack of a stable internal reference for the entire hatching cycle of Macrobrachium rosenbergii larvae, this invention aims to: 1. Provide a set of internal reference gene combinations suitable for the complete developmental stage of giant freshwater prawn larvae from 0 to 21 days. Their expression levels are not affected by the developmental metamorphosis process and are highly stable throughout the entire cycle. 2. A standardized screening method for the above-mentioned internal reference gene combinations is provided, which is based on layer-by-layer filtering of whole transcriptome data combined with experimental verification. The process is reproducible and the results are reliable. 3. Expand the application scenarios of the above-mentioned internal reference gene combinations and provide corresponding detection kits to offer a unified calibration standard for basic research on larval development and molecular detection in seedling production.

[0012] To achieve the above objectives, the present invention provides the following solution: In a first aspect, the present invention provides an internal reference gene combination, wherein the internal reference gene combination comprises... ND-ASHI Genes and Prosbeta7 Genome composition; The ND-ASHI The nucleotide sequence of the gene is shown in SEQ ID NO.1; The Prosbeta7 The nucleotide sequence of the gene is shown in SEQ ID NO.2.

[0013] Secondly, the present invention also provides an application of the aforementioned internal reference gene combination in detecting gene expression at different developmental stages of giant freshwater prawn larvae.

[0014] Preferably, the applications include, but are not limited to: 1) Comparative analysis of differential gene expression at different developmental stages of giant freshwater prawn larvae; 2) Detection of osmotic pressure regulation gene expression during freshwater acclimation of giant freshwater prawn larvae; 3) Validation of gene expression levels in larval giant freshwater prawns under pathogen infection and environmental stress; 4) Gene expression studies related to nutritional regulation and germplasm selection of giant freshwater prawn larvae; 5) Internal reference calibration system for the molecular determination kit for the larval development stage of giant freshwater prawn.

[0015] Thirdly, the present invention also provides the application of the aforementioned internal reference gene combination in the preparation of products for detecting gene expression in different developmental stages of giant freshwater prawn larvae.

[0016] Fourthly, the present invention also provides a primer composition for amplifying the aforementioned internal reference gene combination, the primer composition comprising primer sets with nucleotide sequences as shown in SEQ ID NO. 3-4 and primer sets with nucleotide sequences as shown in SEQ ID NO. 5-6; The nucleotide sequence is shown in the primer set of SEQ ID NO. 3-4, which is used to amplify the nucleotide sequence. ND-ASHI Gene; The nucleotide sequence is shown in the primer set of SEQ ID NO. 5-6, which is used to amplify the nucleotide sequence. Prosbeta7 Gene.

[0017] Fifthly, the present invention also provides the application of the primer composition described above in detecting gene expression at different developmental stages of giant freshwater prawn larvae.

[0018] Preferably, the applications include, but are not limited to: 1) Comparative analysis of differential gene expression at different developmental stages of giant freshwater prawn larvae; 2) Detection of osmotic pressure regulation gene expression during freshwater acclimation of giant freshwater prawn larvae; 3) Validation of gene expression levels in larval giant freshwater prawns under pathogen infection and environmental stress; 4) Gene expression studies related to nutritional regulation and germplasm selection of giant freshwater prawn larvae; 5) Internal reference calibration system for the molecular determination kit for the larval development stage of giant freshwater prawn.

[0019] In a sixth aspect, the present invention also provides the application of the primer composition described above in the preparation of products for detecting gene expression in different developmental stages of giant freshwater prawn larvae.

[0020] In a seventh aspect, the present invention also provides a product for detecting gene expression in different developmental stages of giant freshwater prawn larvae, the product comprising the primer composition described above.

[0021] Preferably, the product is a reagent kit.

[0022] Eighthly, the present invention also provides a method for detecting the expression of a target gene at different developmental stages of giant freshwater prawn larvae, comprising the steps of using the aforementioned internal reference genome as an internal reference gene to detect the expression of the target gene at different developmental stages of giant freshwater prawn larvae.

[0023] The present invention discloses the following technical effects: This invention, through large-scale whole-transcriptome screening combined with multiple rounds of experimental verification, obtained a reference gene combination specifically adapted to the entire developmental cycle of giant freshwater prawn larvae from 0 to 21 days. The core technical effects are as follows: 1. Its stability is significantly better than that of traditional internal reference materials. The screening of this invention ND-ASHI Genes and Prosbeta7 The expression level variance of the gene throughout the entire larval incubation period was less than 0.04, which is far lower than that of traditional internal controls. β-actin , GAPDH and EF1a The expression fluctuations in the same sample solve the industry pain points of expression drift and inaccurate quantification in traditional internal controls during the larval metamorphosis stage, and can significantly improve the reliability of gene expression comparisons across developmental stages.

[0024] 2. The screening system is rigorous and standardized. This invention establishes a complete screening process of "whole transcriptome data filtering - variance threshold screening - transcript uniqueness screening - qPCR software multi-method re-evaluation". All screening criteria are quantified and reproducible, which not only ensures the comprehensiveness of the screening, but also provides a technical paradigm that can be referenced for the screening of internal references in other crustacean larvae.

[0025] 3. Application scenarios possess both scientific research and industrial value. This set of internal references can not only be used for gene expression calibration in larval development in basic scientific research, but also extended to the seedling production end, serving as an internal reference benchmark for molecular detection methods such as larval development stage determination and dilution process detection, providing molecular tool support for the standardization of seedling production.

[0026] 4. Dual-gene combination calibration has higher accuracy. use ND-ASHI Gene+ Prosbeta7 The expression level normalization of the dual internal reference gene combination can further reduce systematic error compared with the single internal reference gene, and can still ensure the accuracy and repeatability of quantitative results in the metamorphosis stage where the physiological state of the larvae changes drastically. Attached Figure Description

[0027] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0028] Figure 1 The results show the PCR product band detection results of the candidate internal reference gene primers; from left to right, they are: MK, Prosbeta7 , RpL14 , ND-ASHI , CD98hc , QIL1 , Fkbp12 , ATPsynB , RpL13A MK ( RpL14 and CD98hc (The strip contains stray bands); Figure 2 Box plots showing the expression levels of 6 candidate reference genes and 3 conventional reference genes at 22 developmental time points; Figure 3 Ranking of candidate internal reference genes based on the stability of different software evaluation methods; Figure 4 This serves as a validation of the application of the internal reference gene combination screened in this invention. Detailed Implementation

[0029] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0030] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0031] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0032] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0033] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0034] Relying on the skills of the art ND-ASHI Genes and Prosbeta7 For the full-length conserved nucleic acid segments of the gene, conventional primer design tools such as Primer5 and NCBI Primer-BLAST can be used to design primer pairs that specifically amplify the corresponding gene in any conserved region. These primers can then be applied to samples from juvenile giant freshwater prawns. ND-ASHI Genes and Prosbeta7 The quantitative calibration of gene expression all fall within the protection scope of this invention.

[0035] Example 1: Screening of internal reference genes in giant freshwater prawn larvae 1. Experimental Materials Fertilized eggs of healthy giant freshwater prawns (obtained from the germplasm bank of the National Giant Freshwater Prawn Genetic and Breeding Center of Zhejiang Freshwater Fisheries Research Institute) were selected from the same batch and incubated under standardized seedling conditions. Larval samples were collected at 22 consecutive time points from day 0 to day 21 after hatching. Three independent biological replicates were set up at each time point, with each replicate weighing 0.1 grams and containing 20 to 800 larvae of the same period. After sampling, the samples were immediately flash-frozen in liquid nitrogen and then transferred to an ultra-low temperature freezer at -80°C for storage.

[0036] 2. Transcriptome Sequencing and Data Preprocessing Total RNA was extracted from each sample using the Trizol method. After passing quality control by agarose gel electrophoresis and nucleic acid detection, cDNA libraries were constructed, and transcriptome sequencing was performed using the Illumina sequencing platform. The raw sequencing data were filtered for quality control and compared with the *Macrobrachium rosenbergii* reference genome to calculate the TPM values ​​of each gene expression level.

[0037] 3. Multi-round screening process 1) The TPM values ​​of all genes were transformed using Log2, and genes with an expression level of 0 in all 66 samples were removed; 2) Calculate the average expression level of each gene in all samples, remove low-expression genes with an average Log2 (TPM) value less than 6, and retain high-expression genes; 3) Calculate the variance of the expression level of each gene in all samples, and retain genes with a variance less than 0.04, resulting in 39 stable expression candidate genes; 4) Based on the gene structure annotation information, genes with multiple alternative splicing transcripts were removed, and genes with only one transcript were retained, resulting in a total of 21 candidate internal reference genes.

[0038] 5) Based on the gene structure annotation information, genes without introns were removed, resulting in a total of 16 candidate internal reference genes.

[0039] 4. Candidate gene sequencing and primer design Candidate genes were ranked for stability using internal control stability assessment software. The top 8 genes were selected, and trans-intronic quantitative PCR primers were designed based on the conserved region sequence of each gene's CDS. The primer amplification product length was controlled between 80 and 200 bp. Six genes showed a single band with no non-specific amplification and correct band size and position as detected by agarose gel electrophoresis. Figure 1 ), respectively QIL1 , ND-ASHI , Prosbeta7 , Fkbp12 , ATPsynB and RpL13A .

[0040] In this preferred embodiment ND-ASHI Genes and Prosbeta7 The gene-specific primer sequences are shown in Table 1.

[0041] Table 1 ND-ASHI Genes and Prosbeta7 Gene-specific primer sequences ND-ASHI The nucleotide sequence of the gene's CDS region is shown in SEQ ID NO.1: atggcgaacgttaccaagtccgtcctccggctttcgtctttaagtagactgcagagtttaactgggacccagtcagtgagatatggaggaaattggaataaggattggaagcctggtccatacccagtgactcctgaagaacgagaagcagcagcacgcaagtacggattgcgccctgatgagtacgaaccctatcctgatgatggcttgggaaagggtgattacccaaagcttccacttatttcagccgatgcccgagacccttaccgtgattgggattttccagaacaccgacgtgactttggagagccgatacaagtggactatgatatgcacggattagatcggctggatgttacctccaaacttcgttactctttgggtcagcaagcaatggcattccttggcgtcatgactgccttctttgtcgtatacttttatttagatgacaagaagatgcattggcctgtgctggcaaagcagttcccagggcaagaacaagtgcactacacttttgagccagcagagtag; Prosbeta7 The nucleotide sequence of the gene CDS region is shown as SEQ ID NO. 2: .

[0042] 5. Assessment of Transcriptome Expression Fluctuations The six qualified internal reference genes and three commonly used internal reference genes selected above were used. EF1a , β-actin , GAPDH Transcriptome data were retrieved and fluctuations were compared. The results showed that the fluctuation ranges of the six candidate internal reference genes were small, with expression variances of 0.030, 0.031, 0.035, 0.038, 0.019, and 0.037, all below the screening threshold of 0.04; while EF1a, β-actin , GAPDH The expression amplitude was relatively large, with expression variances of 0.078, 2.718, and 0.112, respectively, which were higher than those of the six candidate internal reference genes initially screened in this invention. Figure 2 ).

[0043] 6. qPCR detection verification Total RNA was extracted from 66 samples at 22 time points and uniformly reverse transcribed into cDNA. Using the cDNA from each sample as a template, qPCR was performed on the 6 candidate genes and 3 conventional internal reference genes selected above. Three replicates were set for each sample. The experimental procedure was strictly followed according to the instructions of the real-time fluorescence kit, and the Ct values ​​of each gene were recorded.

[0044] The Ct values ​​were imported into RefFinder internal reference stability analysis software to calculate and rank the stability index of each candidate gene, including four evaluation methods and a comprehensive evaluation result. The comprehensive evaluation result showed that all six new candidate internal reference genes were more stable than the three traditional internal reference genes. ND-ASHI , Prosbeta7 The optimal stability is finally determined. ND-ASHI Genes and Prosbeta7 The gene stability ranked first and second, making it the optimal internal reference combination for the entire developmental stage of Macrobrachium rosenbergii larvae. In the software's overall ranking, ND-ASHI Gene, Prosbeta7 The genes are ranked 1st and 2nd respectively. EF1a , β-actin , GAPDH Ranked 7th, 8th, and 9th respectively Figure 3 The results confirm that the stability of the internal reference gene combination screened in this invention is significantly better than that of traditional internal references throughout the entire developmental cycle of giant freshwater prawn larvae.

[0045] Example 2: Application Verification of Internal Reference Gene Combinations Zodiaceous larvae of the giant freshwater prawn cannot grow and develop in freshwater. They require a salinity of 8-13‰ to metamorphose into juveniles before they can continue to grow and develop in freshwater. Therefore, the final stage of the rearing process is desalination, which usually begins based on the experience of the rearing specialists, once approximately 80% of the zodiaceous larvae have completed metamorphosis. Desalination typically takes 3 days, with small amounts administered multiple times daily to reduce stress and mortality in the juveniles. Transcriptome comparisons of larvae before, during, and after desalination revealed... CREB1 The expression level of the gene (GO injection showed that this gene is related to the regulation of stimulus response) showed a trend of first increasing and then decreasing: 12.46 before desalination, 28.73, 28.57, and 22.03 on days 1-3 of desalination, respectively, and 16.23 after desalination. Therefore, juvenile shrimp desalinated for half a day on the first day were used as experimental materials for verification experiments, using the gene screened in this invention. ND-ASHI Gene+ Prosbeta7 Genome collaboration was used as an internal control, employing 2 -ΔΔCt Legal testing CREB1 The expression changes of the gene (KO id: K05870; Description: Cyclic-AMPresponse element binding protein B, transcript variant X1) in the early freshwater acclimation stage of giant freshwater prawn larvae; three parallel control groups with traditional single internal controls were also set up.

[0046] Validation results: The upregulated genes in the study... CREB1 To verify, ND-ASHI , Prosbeta7 Using three commonly used genes as internal controls, all resulted in approximately a 3-fold upregulation of the target gene, but the most stable result was achieved using [the specific gene used]. ND-ASHI and Prosbeta7 As a result of the internal reference gene, the second is... EF1a far more than β-actin and GAPDH Stable. Adopted ND-ASHI Gene+ Prosbeta7 The dual-internal-reference calibration method resulted in smaller fluctuations in intra-group biological reproducibility, better data repeatability, and more stable trends. In contrast, the results of conventional single-internal-reference calibration showed not only large intra-group variations but also significant deviations among the three methods. This demonstrates that the internal-reference gene combination screened in this invention can significantly improve the accuracy and reliability of gene expression quantification in Macrobrachium rosenbergii larvae samples. Figure 4 ).

[0047] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A combination of internal reference genes, characterized in that, The internal reference gene combination consists of ND-ASHI Genes and Prosbeta7 Genome composition; The ND-ASHI The nucleotide sequence of the gene is shown in SEQ ID NO.1; The Prosbeta7 The nucleotide sequence of the gene is shown in SEQ ID NO.

2.

2. The application of the internal reference gene combination as described in claim 1 in detecting gene expression at different developmental stages of giant freshwater prawn larvae.

3. The application of the internal reference gene combination according to claim 1 in the preparation of a product for detecting gene expression in different developmental stages of giant freshwater prawn larvae.

4. A primer composition for amplifying the internal reference gene combination of claim 1, characterized in that, The primer composition includes primer sets with nucleotide sequences as shown in SEQ ID NO. 3-4 and primer sets with nucleotide sequences as shown in SEQ ID NO. 5-6; The nucleotide sequence is shown in the primer set of SEQ ID NO. 3-4, which is used to amplify the nucleotide sequence. ND-ASHI Gene; The nucleotide sequence is shown in the primer set of SEQ ID NO. 5-6, which is used to amplify the nucleotide sequence. Prosbeta7 Gene.

5. The use of the primer composition of claim 4 in detecting gene expression at different developmental stages of giant freshwater prawn larvae.

6. The use of the primer composition of claim 4 in the preparation of a product for detecting gene expression in different developmental stages of giant freshwater prawn larvae.

7. A product for detecting gene expression at different developmental stages of giant freshwater prawn larvae, characterized in that, The product includes the primer composition of claim 4.

8. The product according to claim 7, characterized in that, The product in question is a reagent kit.

9. A method for detecting the expression of a target gene at different developmental stages of giant freshwater prawn larvae, characterized in that, The method includes the step of using the internal reference genome as described in claim 1 as an internal reference gene to detect the expression of the target gene at different developmental stages of giant freshwater prawn larvae.

Images