PCR primer set for identifying genetically edited intermuscular bone-free gynogenetic gibel carp (carassius auratus gibelio) cg-ibfree and application thereof

Abstract

The application discloses a PCR primer set for identifying genetically edited muscle-sting-free gibel carp CG-IBfree and application thereof. Two pairs of species-specific primers are designed for gibel carp runx2b-A and runx2b-B genes, which can specifically identify gibel carp from common cultured cyprinid fishes such as common carp, grass carp and amur catfish. Meanwhile, a pair of strain-specific primers is designed for the runx2b-A3 allele editing site in the CG-IBfree, and only the primer amplifies a 407 bp specific fragment in the CG-IBfree, and no amplification product is obtained in the wild-type gibel carp. A complete PCR detection system is established, the detection sensitivity of the gibel carp runx2b-A specific primer reaches 0.05%, the detection sensitivity of the gibel carp runx2b-B specific primer reaches 0.025%, and the detection sensitivity of the CG-IBfree specific primer reaches 0.1%, and the system has good repeatability. The application realizes the double detection of gibel carp species identification and CG-IBfree strain identification, and provides an effective molecular detection tool for the germplasm resource identification of the muscle-sting-free gibel carp new strain.

Description

Technical Field

[0001] This application relates to the field of molecular identification technology for aquatic animals, specifically to a PCR primer set for identifying CG-IBfree gene-edited, spineless, heterotrophic silver carp and its application. Background Technology

[0002] Intermuscular bones (IBs), also known as intermuscular ossicles, are membranous, hard bony spines formed by the ossification of tendons in the intermuscular septa of fish. Major farmed freshwater fish in my country commonly contain numerous and morphologically complex intermuscular bones, severely impacting the consumer's eating experience and causing numerous inconveniences for fish processing. Therefore, creating new boneless fish germplasm has become a hot topic in fish genetics and breeding research.

[0003] In recent years, significant progress has been made in the study of the formation mechanism of intermuscular spines. Nie et al. (2022) identified the runx2b gene as a key gene regulating intermuscular spine formation through single-cell transcriptome analysis of zebrafish tail muscle tissue, and found that deletion of the runx2b gene completely inhibited intermuscular spine formation. Based on this, researchers successfully created new germplasm of blunt snout bream (Megalobrama amblycephala), grass carp (Ctenopharyngodon Idella), and crucian carp (Carassius auratus) with completely missing intermuscular spines using CRISPR / Cas9 gene editing technology (Dong et al., 2023; Kuang et al., 2023; Liu et al., 2026).

[0004] In the silver crucian carp (Carassius gibelio), based on the heterozygous silver crucian carp "Zhongke 3", two partial homologs (runx2b-A and runx2b-B) and all six alleles of the silver crucian carp were simultaneously knocked out using CRISPR / Cas9 technology, successfully creating a new silver crucian carp germplasm CG-IBfree completely lacking intermuscular spines (Gan RH, Li Z, Wang ZW, et al. Creation of intermuscular bone-free mutants in amphitriploid gibelcarp by editing two duplicated runx2b homeologs[J]. Aquaculture, 2023, 567:739300.). This strain is ready for industrial application. However, in the process of moving the new intermuscular spineless silver crucian carp germplasm from the laboratory to industrialization, a key technical bottleneck remains unresolved: how to quickly and accurately identify and trace the germplasm of this strain. Specifically, industrial applications need to address the following three identification issues: (1) How to quickly distinguish CG-IBfree strains from wild-type silver carp (WT) in the breeding, processing and distribution stages; (2) How to distinguish silver carp from other common farmed fish (such as carp, grass carp, blunt snout bream, etc.) to prevent genetic mixing and product adulteration; (3) The above identification methods must be easy to operate, provide intuitive results and have high sensitivity to meet the actual needs of large-scale industrial applications.

[0005] Currently, existing technologies have not established effective solutions to the aforementioned problems. While Gan et al. (2023b) disclosed a method for creating barbless intermuscular neutered silver carp mutants using CRISPR / Cas9 technology and provided primers for detecting gene editing efficiency, their primer design aimed to verify the success of the editing, not for industrial identification of CG-IBfree strains, and did not address a combined detection system integrating silver carp species identification and CG-IBfree strain identification. Therefore, there is an urgent need to develop a simple, specific, sensitive method for identifying CG-IBfree strains suitable for industrial applications. Summary of the Invention

[0006] In view of this, the purpose of this application is to provide a set of PCR primers for identifying gene-edited, spineless, heterozygous crucian carp (CG-IBfree) and their applications. Based on the sequence differences of two partial homologous genes, runx2b-A and runx2b-B, and their respective three alleles in the triploid genome of crucian carp, as well as the specific sequence of the runx2b-A3 allele editing site in the CG-IBfree strain, this application designs three sets of functionally complementary specific PCR primers. The first two sets target the species-specific runx2b-A and runx2b-B genes of crucian carp for species identification, respectively, while the third set targets the editing site specific to the CG-IBfree strain for precise strain identification. The combined use of these three sets of primers constructs a dual identification system of "species identification + strain identification," enabling rapid, accurate, and sensitive identification of the CG-IBfree strain. Experimental results show that the three primer sets described in this application all have high species specificity and strain specificity, and can only amplify the target band in silver carp samples without cross-amplification in common farmed fish such as carp, grass carp, and blunt snout bream. Among them, the CG-IBfree specific primer can detect CG-IBfree genomic DNA with a mass percentage as low as 0.1%, with high sensitivity and good repeatability, which can effectively meet the identification needs of new silver carp germplasm without intermuscular spines.

[0007] To achieve the above objectives, this application provides the following technical solution:

[0008] Firstly, this application provides a set of PCR primers for identifying gene-edited, spineless, heterotrophic silver carp (CG-IBfree), the primer set comprising three primer pairs, wherein:

[0009] The first set of primer pairs consists of primers specifically for amplifying the runx2b-A gene of crucian carp, including:

[0010] runx2b-A-2F: CTGTATTTATTTGCAGCCAAATTC (SEQ ID NO: 3);

[0011] runx2b-A-2R: GAAATGTCATACCTGTTATCTGCG (SEQ ID NO: 4);

[0012] The second set of primer pairs consists of primers specifically for amplifying the runx2b-B gene of crucian carp, including:

[0013] runx2b-B-1F: AGGCCGATGGATGGATATATATAC (SEQ ID NO: 5);

[0014] runx2b-B-1R: ATCCATTCTTCAACCCACTTCTCT (SEQ ID NO:6);

[0015] The third set of primer pairs consists of primers specific to CG-IBfree strains for amplification, including:

[0016] CG-IBfree-3F: GGATGACTCGAACTGGAGCG (SEQ ID NO: 23);

[0017] CG-IBfree-3R: AGCGGCGACTGTACGTATCA (SEQ ID NO: 24).

[0018] Of the primer sets mentioned above, the first and second primer pairs were designed based on the sequence differences of the runx2b gene between crucian carp and other fish species, such as carp, grass carp, and bluntnose bream, and could only amplify the runx2b-A and runx2b-B genes in crucian carp. The third primer pair was designed based on the editing site region of the runx2b-A3 allele in CG-IBfree, with the forward primer located at the runx2b-A3 allele editing site and the reverse primer located downstream of the editing site. This primer pair could not amplify the sequence in wild-type crucian carp. The amplification product size of the first primer pair was 335 bp, the second primer pair was 688 bp, and the third primer pair was 407 bp.

[0019] Secondly, this application provides a detection kit for identifying gene-edited, spineless, heterotrophic silver carp (CG-IBfree), the kit comprising the PCR primer set described in the first aspect.

[0020] In some embodiments, the kit may further comprise one or more components selected from the following: 2×TSINGKE® Master Mix (Blue), 2×Rapid Taq Master Mix, DNA extraction reagent, agarose, and DNA Marker.

[0021] In some preferred embodiments, the kit further includes a positive control and a negative control, wherein the positive control is CG-IBfree silver carp genomic DNA and the negative control is wild-type silver carp genomic DNA.

[0022] Thirdly, this application provides a method for identifying CG-IBfree, gene-edited, spineless, heterotrophic silver carp using the PCR primer set described in the first aspect, comprising the following steps:

[0023] Step 1: Extract genomic DNA from the sample to be tested;

[0024] Step 2: Using the genomic DNA extracted in Step 1 as a template, perform PCR amplification using the first set of primer pairs, the second set of primer pairs, and the third set of primer pairs, respectively;

[0025] Step 3: Detect the PCR amplification products from Step 2 by agarose gel electrophoresis;

[0026] Step 4: Make the following judgments based on the electrophoresis results:

[0027] If the target band appears at approximately 335 bp after PCR amplification using the first primer pair, and the target band appears at approximately 688 bp after PCR amplification using the second primer pair, then the sample to be tested is determined to be a silver carp species; if no target band appears after using either the first or second primer pair, then the sample to be tested is determined to be a non-silver carp species.

[0028] If the PCR amplification product of the third primer pair shows the target band of the expected size, the sample is determined to be a gene-edited, spineless, heterotrophic silver crucian carp (CG-IBfree); if the third primer pair does not show the target band, the sample is determined to be a wild-type silver crucian carp.

[0029] In some implementations, the following determination method may also be used:

[0030] If the sample is confirmed to be a silver carp species using only the first and second primer pairs, further confirmation of whether it is a CG-IBfree strain can be made by sequencing the PCR product: if the sequencing peaks show overlapping peaks in the edited site region, it suggests that the sample may be a CG-IBfree strain, and the complete edited genotype needs to be confirmed by single-clone sequencing; if the sequencing peaks are a single clear peak in the edited site region, it is a wild-type silver carp.

[0031] In some preferred embodiments, in step 2, the PCR amplification reaction system of the first primer pair and the second primer pair totals 25 µL, including 12.5 µL of 2×TSINGKE® Master Mix (Blue), 0.5 µL each of 10 µM upstream and downstream primers, 1.0 µL of 100 ng / µL DNA template, and ddH2O to make up to 25 µL.

[0032] In some preferred embodiments, in step 2, the PCR amplification reaction program for the first primer pair and the second primer pair is as follows: 95 °C pre-denaturation for 3 min; 95 °C denaturation for 30 s, 55 °C annealing for 30 s, 72 °C extension for 20 s, for a total of 30 cycles; and finally 72 °C extension for 5 min.

[0033] In some preferred embodiments, in step 2, the PCR amplification reaction system of the third primer pair is 25 µL in total, including 12.5 µL of 2×Rapid Taq Master Mix, 0.5 µL each of 10 µM upstream and downstream primers, 1.0 µL of 100 ng / µL DNA template, and ddH2O to make up to 25 µL.

[0034] In some preferred embodiments, in step 2, the PCR amplification reaction program of the third primer pair is as follows: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s, 60°C annealing for 15 s, 72°C extension for 10 s, for a total of 32 cycles; and finally 72°C extension for 5 min.

[0035] In some embodiments, the conditions for agarose gel electrophoresis in step 3 are: 1.5% agarose and 1×TAE buffer.

[0036] Fourthly, this application provides the application of the PCR primer set described in the first aspect or the kit described in the second aspect in identifying gene-edited, spineless, heterotrophic silver carp CG-IBfree.

[0037] Compared with the prior art, this application has at least the following beneficial effects:

[0038] 1. Based on the complex background of highly homologous six copy sequences of the runx2b gene in crucian carp, this application designed three sets of functionally complementary specific PCR primers. The first two sets target the species-specific runx2b-A and runx2b-B genes of crucian carp, respectively, for species identification. The third set targets the editing site of the runx2b-A3 allele in CG-IBfree strains for strain identification. Through a step-by-step verification logic of "first confirming the species, then identifying the strain," these three sets of primers effectively solve the technical challenge of simultaneously identifying crucian carp species and CG-IBfree strains in existing technologies.

[0039] 2. Specificity verification showed that the three sets of primers provided in this application amplified the expected bands only in their respective target samples, with no cross-amplification in common farmed fish such as carp, grass carp, and bluntnose bream, and could effectively distinguish between CG-IBfree and wild-type silver carp. Sensitivity testing showed that the CG-IBfree specific primers could still stably detect samples with CG-IBfree genomic DNA quality percentages as low as 0.1%. Furthermore, the method in this application was reproducible, yielding consistent amplification results in different batches of experiments.

[0040] 3. This application employs conventional PCR technology combined with agarose gel electrophoresis for detection. The species attribute and strain identity of the sample can be directly determined by the presence or absence of electrophoretic bands, making the operation simple. This method can meet the practical application needs of the new barbless silver crucian carp germplasm in industrial scenarios such as germplasm resource protection, purity testing of aquaculture populations, and traceability of aquatic product processing. Attached Figure Description

[0041] Figure 1 Electrophoresis image of PCR amplification products screened using primers specific to the runx2b gene of crucian carp.

[0042] Figure 2 This diagram shows the structure of the runx2b-A and runx2b-B genes in silver carp and the target locations of specific PCR primers.

[0043] Figure 3 Electrophoresis image of PCR amplification products screened for CG-IBfree specific primers for silver carp.

[0044] Figure 4 Electrophoresis image of PCR amplification products after adjusting the PCR reaction program for the silver carp CG-IBfree specific primers.

[0045] Figure 5 Electrophoresis image of PCR amplification products screened using CG-IBfree specific primers for silver carp.

[0046] Figure 6 Electrophoresis image of PCR amplification products screened using primers specific to the runx2b gene of crucian carp.

[0047] Figure 7 This is the result of quality testing for extracted genomic DNA.

[0048] Figure 8 The results of PCR amplification of the runx2b-A gene in crucian carp are shown in agarose gel electrophoresis and sequencing peak diagrams; where A is the agarose gel electrophoresis diagram and B is the sequencing peak diagram of the downstream primer of the runx2b-A editing site.

[0049] Figure 9 The results of PCR amplification of the runx2b-B gene in crucian carp are shown in agarose gel electrophoresis and sequencing peak diagrams. A is the agarose gel electrophoresis diagram, and B is the sequencing peak diagram of the upstream primer of the runx2b-B editing site.

[0050] Figure 10 Agarose gel electrophoresis image of CG-IBfree specific PCR amplification of silver carp.

[0051] Figure 11 Agarose gel electrophoresis image of specific PCR amplification of the runx2b-A gene in silver carp.

[0052] Figure 12 Agarose gel electrophoresis image of specific PCR amplification of the runx2b-B gene in silver carp.

[0053] Figure 13 Agarose gel electrophoresis image of CG-IBfree specific PCR amplification of silver carp.

[0054] Figure 14 The results are for the repeatability verification of the runx2b-A gene-specific primers for crucian carp.

[0055] Figure 15 The results show the repeatability verification of the runx2b-B gene-specific primers for crucian carp.

[0056] Figure 16 Results of repeatability verification of the CG-IBfree specific primers for silver carp. Detailed Implementation

[0057] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application.

[0058] The materials used in the following embodiments are not limited to those listed below, and other similar materials may be used instead. Unless otherwise specified, the instruments shall be used under conventional conditions or as recommended by the manufacturer. Those skilled in the art should have relevant knowledge of the use of conventional materials and instruments.

[0059] In this application, unless the context clearly indicates otherwise, the terms “including,” “comprising,” “containing,” “having,” etc., shall be understood as open-ended and mean “including but not limited to.”

[0060] To better understand this teaching and without limiting its scope, all figures and other numerical values ​​used in the specification and claims to express quantities, percentages, or proportions should, in all cases, be understood to be modified by the term "about." Therefore, unless otherwise stated, the numerical parameters set forth in the following specification and appended claims are approximate values ​​that may be adjusted according to the desired performance. At a minimum, each numerical parameter should be interpreted based on the reported significant figures and by applying common rounding techniques.

[0061] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter of this application pertains. Before a detailed description of this application, the following explanations of terminology are provided to better understand this application.

[0062] 1. CG-IBfree: The strain code for the gene-edited intermuscular bone-free interbreeding silver carp involved in this application. Specifically, it refers to the new silver carp germplasm completely lacking intermuscular bones obtained by Gan et al. (Gan RH, Li Z, Wang ZW, et al. Creation of intermuscular bone-free mutants in amphitriploid gibel carp by editing two duplicated runx2b homeologs[J]. Aquaculture,2023,567:739300) based on the interbreeding silver carp “Zhongke No. 3” by using CRISPR / Cas9 technology to simultaneously knock out two partial homologous genes, runx2b-A and runx2b-B, and all six alleles.

[0063] 2. Partial Homeolog: refers to a homologous gene with high sequence similarity that arises from a polyploidization event and originates from different ancestral species. In this application, the silver carp is a double triploid (AAABBB), and its runx2b gene has two partial homeologous genes: runx2b-A and runx2b-B.

[0064] 3. Alleles: refer to the different sequence forms of the same gene in different individuals of the same species or in different chromosome copies of the same genome. In this application, the silver carp runx2b-A and runx2b-B each contain 3 alleles (A1 / A2 / A3, B1 / B2 / B3), for a total of 6 copies.

[0065] 4. Diploid: Refers to a genome containing three sets of chromosomes from two different ancestral species, denoted as AAABBB. In this application, the silver carp is a diploid fish, and the specific primers in this application are designed based on this special genome.

[0066] 5. Overlapping peaks: In DNA sequencing peak diagrams, the appearance of two or more overlapping signal peaks of different bases at the same position indicates that the sample is heterozygous at that site and contains alleles of different sequences. In this application, the sequencing peak diagram of the PCR product of CG-IBfree exhibits overlapping peaks, suggesting that its editing site contains a mixture of wild-type and edited sequences.

[0067] Example 1: Screening of specific primers for silver carp runx2b

[0068] 1. Experimental Materials

[0069] Silver carp are diploid fish, and their runx2b gene contains two partial homologs: runx2b-A and runx2b-B, with approximately 91.8% sequence identity. Each partial homolog has three alleles, with approximately 99.6% sequence identity among the alleles (Gan et al., 2023). Given this complex genomic background, this application designed multiple sets of functionally complementary specific PCR primers. Genomic DNA from CG-IBfree silver carp (without intermuscular spines), wild-type silver carp (WT), carp, grass carp, and bluntnose bream was used as templates to extract and prepare DNA templates (100 ng / μL). The PCR amplification reagent used was Darling Biotech 2×TSINGKE® Master Mix (Blue).

[0070] 1.2 Design and Synthesis of Candidate Primers

[0071] The primer design was based on the Carassius gibelio genome sequence GCA_019843895.2 (Wang et al., 2022), and the genome assembly data has been published in the NCBI GenBank database. The cDNA sequences of the Carassius gibelio runx2b-A and runx2b-B genes and their alleles (runx2b-A1, runx2b-A2, runx2b-A3, runx2b-B1, runx2b-B2, runx2b-B3) have been submitted to Science Data Bank (ScienceDB), accession number https: / / doi.org / 10.57760 / sciencedb.04940.

[0072] Based on the sequence differences in the runx2b-A and runx2b-B gene regions between crucian carp (Carassius gibelio) and other cyprinid fish (carp, grass carp, and bluntnose bream), multiple pairs of candidate specific primers were designed for runx2b-A and runx2b-B, respectively. The candidate primers for runx2b-A and runx2b-B are shown in Table 1.

[0073] Table 1 Candidate primers for runx2b-A and runx2b-B

[0074]

[0075] All primers were synthesized and purified by Wuhan Tianyi Huayu Gene Technology Co., Ltd., and diluted to 10 μM before use.

[0076] 1.3 PCR reaction system and reaction procedure

[0077] The PCR reaction system for screening candidate primers for silver carp runx2b is shown in Table 2 below:

[0078] Table 2 Reaction System

[0079]

[0080] The PCR reaction procedure is as follows:

[0081] Pre-denaturation at 95 °C for 3 min, denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 20 s, for 30 cycles, and finally extension at 72 °C for 5 min.

[0082] 1.4 Electrophoretic detection of PCR products

[0083] Take 10 μL of the PCR amplification product and perform electrophoresis separation in 1×TAE electrophoresis buffer containing 1.5% agarose. The electrophoresis conditions are: voltage 220 V, electrophoresis time approximately 25 min. After electrophoresis, place the gel under a gel imaging system for development and observation, using Takara DL2000 DNA Marker as the molecular weight standard.

[0084] 2. Primer screening results

[0085] The genomic DNA of each sample was amplified by PCR using the above 6 pairs of candidate primers, and the electrophoresis results are as follows: Figure 1 As shown (lane arrangement: M is Takara DL2000 DNA Marker; lane 1 is CG-IBfree; lane 2 is WT; lane 3 is template-free control; lane 4 is carp; lane 5 is grass carp; lane 6 is blunt snout bream).

[0086] The screening results showed that among the candidate primers tested, primer pair 2 (runx2b-A) and primer pair 3 (runx2b-B) exhibited the best species specificity for the runx2b-A and runx2b-B genes in crucian carp. They amplified clear target bands only in crucian carp samples (CG-IBfree and WT), while no specific amplification bands were observed in carp, grass carp, blunt snout bream, and template-free controls. Therefore, primer pair 2 was selected as the specific amplification primer for runx2b-A in crucian carp, and primer pair 3 was selected as the specific amplification primer for runx2b-B. A schematic diagram of the structure of the runx2b-A and runx2b-B genes in crucian carp and the target locations of the specific PCR primers is shown below. Figure 2 As shown, both the runx2b-A and runx2b-B genes consist of 8 exons (represented by rectangles) and 7 introns (represented by thick lines).

[0087] The specific primer pair for silver carp runx2b-A (i.e., primer 2) determined through screening is as follows:

[0088] Upstream primer runx2b-A-2F: CTTGTATTTATTTGCAGCCAAATTC (SEQ ID NO:3);

[0089] Downstream primer runx2b-A-2R: GAAATGTCATACCTGTTATCTGCG (SEQ ID NO:4);

[0090] This primer pair was used to amplify the runx2b-A1, runx2b-A2, and runx2b-A3 fragments of the silver carp species. The sizes of the runx2b-A1, runx2b-A2, and runx2b-A3 fragments are 332 bp, 333 bp, and 335 bp, respectively. The specific sequences are as follows (underlined areas indicate primer positions, and square brackets indicate edited missing sequences):

[0091] runx2b-A1 (SEQ ID NO:13):

[0092] CTTGTATTTATTTGCAGCCAAATTC ATCAAATTGCTCTGATAAGTGACATATTTGTCATATTGTGGTGTACTTGTACATTCTTTAATTTTAGATTATTATTATTTAATTTTTATTTTTTTTATTAAAGGCAGTATGTTGTTTGCAGGGCACA[GGCCG]AAGCTGGA TGACTCGCCGAAGGCCGGACTCTTCTCTGACCGCCTCAGTGAACTGGAGCGTATCCGGCAGACCACCATGCGGGTTACCATGCCAACACAAACGCCACGGCCCTCGCTTAGCAACCCCAACTCCTTCACACCTCAGGGGCAGA CGCAGATAACAGGTATGACATTTC

[0093] runx2b-A2 (SEQ ID NO:14):

[0094] CTTGTATTTATTTGCAGCCAAATTCATCAAATTGCTCTGATAAGTGACATATTTGTCATATTGTGGTGTACTTGTACATTCTTTAATTTTAGATTATTATTATTTAATTATTTTTTTTTTTTATTAAAGGCAGTATGTTGTTTGCAGGGCACAGGCCGAAGCTGGATGACTCGCCGAAG[GCCGGACTCTTCTCTGACCGCCTCAG]TGAACTGGAGCGTATCCGGCAGACCACCATGCGGGTTACCATGCCAACACAAACGCCACGGCCCTCGCTTAGCAACCCCAACTCCTTCACACCTCAGGGGCAGA CGCAGATAACAGGTATGACATTTC

[0095] runx2b-A3 (SEQ ID NO: 15):

[0096] CTTGTATTTATTTGCAGCCAAATTC ATCAAATTGCTCTGATAAGTGACATATTTGTCATATTGTGGTGTACTTGTACATTCTTTAATTTTAGATTTAGATTATTATTTAATTATTTTTTTTTTTATTAAAGGCAGTATGTTGTTTGCAGGGCACAGGCCGAAGCTGGATGACTC[GCCGAAGGCCGGACTCTTCTCTGACCGCCTCAGT]GAACTGGAGCGTATCCGGCAGACCACCATGCGGGTTACCATGCCAACACAAACGCCACGGCCCTCGCTTAGCAACCCCAACTCCTTCACACCTCAGGGGCAGA CGCAGATAACAGGTATGACATTTC

[0097] The silver crucian carp runx2b-B specific primer pair (i.e., primer No. 3) determined through screening is:

[0098] Forward primer runx2b-B-1F: AGGCCGATGGATGGATATATATAC (SEQ ID NO: 5);

[0099] Reverse primer runx2b-B-1R: ATCCATTCTTCAACCCACTTCTCT (SEQ ID NO: 6);

[0100] This primer pair was used to amplify the runx2b-B1, runx2b-B2, and runx2b B3 fragments of the silver carp species. The amplified product sizes of the runx2b-B1, runx2b-B2, and runx2b-B3 fragments are 688 bp, 682 bp, and 688 bp, respectively. The specific sequences are as follows (underlined sequences indicate primer positions, square brackets indicate edited or deleted sequences, and lowercase letters indicate inserted sequences):

[0101] runx2b-B1 (SEQ ID NO:16):

[0102] AGGCCGATGGATGGATATATATAC TTTCTAAGATATAAGTTCTGTATTAATATTTGGACATTTAACACTTACATAATATATTACAATTATTGTTGACCATGGATACATTTAGGGTGCAAATGTGGTATGATAATAATAATATTGAATTACTCTGGGATATGCTTCAGAATCCAAACAATCCTAG AAAGAGGACAGAGGGTTTTGGGGAATGGATGGATGTGTATCATATTTAACTGTTTAAGTTTTATGTATTTGGCATACATTTACCTCAATCCAGTAGTTCATGAGTCTTTTTGAATGATTCGAAAGAACTGACTCATAAGAATCATTTGCTCATGAATCACA CAACATTTTGCTTGTTTTTACATGGAGCCCTTTTTTGAGATTTTTTTTTAATTAAAGGCAGTATATGTTGATTGCAGGGCACAGGCCGAAGTTGGATGACTCGCCGAAGgactGCTGGACTGTTCTCGGACCGTCTCAGTGAACTGGAGCGCATCCGGC AGACCACCATGCGGGTTACTGTGCCAACACAAACGCCACGGCCCTCGCTTAGCAGTCCCAACTCCTTCACACCTCAGGGGCAGACTCAGATTACAGGTATGGGATTGCATATAGATCAATAGCCTTGCTTATTAGTATTTACAAAGATAGATAGAAAAAA AGAGAAGTGGGTTG AAGAATGGAT

[0103] runx2b-B2 (SEQ ID NO:17):

[0104] AGGCCGATGGATGGATATATATACTTTCTAAGAATATAAGTTCTGTATTAATATTTGGACATTTAACACTTACATAATATATTACAATTATTGTTGACCATGGATACATTTAGGGTGCAAATGTGTTATGATGTAGTAATATTGAATTACTCCGGGATATGCTTCAGAATCCAAACAATCCTAGAAAGAGGACAGAGGGTTTGGGGAATGGATGGATGTGTATCATATTTAACTGTTTAAGTTTTATGTATTTGGCACACATTTACCTCAATCCAGTAGTTTATGAGTCTTTTTGAATGATTCGAAAGAACTGACTCATAAGAATCATTTGCTCATGAATCACACAACATTTTGCTTGTTTTTACATGGAGCCCTTTTTTGAGATTTTTTTTTTAATTAAAGGCAGTATATGTTGATTGCAGGGCACAGGCCGAAGTTGGATGACTCGCCGA[AGGC]T[G]GACTGTTCTCGGACCGTCTCAGTGAACTGGAGCGCATCCGGCAGACCACCATGCGGGTTACTGTGCCAACACAAACGCCACGGCCCTCGCTTAGCAGTCCCAACTCCTTCACACCTCAGGGGCAGACTCAGATTACAGGTATGGGATTGCATATAGATCAATAGCCTTGCTTATAAGTATTTACAAAGATAGATAGAAAA AGAGAAGTGGGTTGAA GAATGGAT

[0105] runx2b-B3(SEQ ID NO:18):

[0106] AGGCCGATGGATGGATATATATACTTTCTAAGAATATAAGTTCTGTATTAATATTTGGACATTTAACACTTACATAATATATTACAATTATTGTTGACCATGGATACATTTAGGGTGCAAATTTGGTATGATATAATAATATTGAATTACTCTGGGATATGCTTCAGAATCCAAACAATCCTAG AAAGAGGACAGAGGGTTTTGGGGAATGGATGGATGTGTATCATATTTAACTGTTTAAGTTTTATGTATTTGGCACACATTTACCTCAATCCAGTAGTTCATGAGTCTTTTTGAATGATTCGAAAGAACTGACTCATAAGAATCATTTGCTCATGAATCACA CAACATTTTGCTTGTTTTTACATGGAGCCCTTTTTTGAGATTTTTTTTAAAATTAAAGGCAGTATATGTTGATTGCAGGGCACAGGCCGAAGTTGGATGACTCGCCGAAGgactGCTGGACTGTTCTCGGACCGTCTCAGTGAACTGGAGCGCATCCGGC AGACCACCATGCGGGTTACTGTGCCAACACAAACGCCACGGCCCTCGCTTAGCAGTCCCAACTCCTTCACACCTCAGGGGCAGACTCAGATTACAGGTATGGGATTGCATATAGATCAATAGCCTTGCTTATTAGTATTTACAAAGATAGATAGAAAAAA AGAGAAGTGGGTTG AAGAATGGAT

[0107] Example 2: Screening of CG-IBfree specific primers and optimization of amplification conditions

[0108] 1. Screening of CG-IBfree specific primers

[0109] 1.1 Design and Synthesis of Candidate Primers

[0110] Based on the differential sequences between CG-IBfree and wild-type (WT) silver carp, multiple pairs of candidate specific primers were designed. These specific primers aim to amplify the target sequences in CG-IBfree silver carp, but not in wild-type (WT) silver carp. The candidate primers for CG-IBfree are shown in Table 3 below:

[0111] Table 3 CG-IBfree candidate primers

[0112]

[0113] All primers were synthesized and purified by Wuhan Tianyi Huayu Gene Technology Co., Ltd., and diluted to 10 μM before use.

[0114] 1.2 PCR reaction system and reaction procedure

[0115] The PCR reaction system is shown in Table 4:

[0116] Table 4. Specific primer reaction system for silver carp CG-IBfree

[0117]

[0118] The PCR reaction program was as follows: 95 °C pre-denaturation for 3 min; 95 °C denaturation for 15 s, 60 °C annealing for 15 s, 72 °C extension for 10 s, for a total of 32 cycles; and a final extension at 72 °C for 5 min.

[0119] 1.3 Screening Results

[0120] The above four pairs of candidate primers were used to perform PCR amplification on genomic DNA from CG-IBfree, WT, carp, grass carp, blunt snout bream, and a template-free control. Electrophoresis results are shown below. Figure 3 As shown (lane arrangement: M for Takara DL2000 DNA Marker; lane 1 for CG-IBfree; lane 2 for WT; lane 3 for template-free control; lane 4 for carp; lane 5 for grass carp; lane 6 for blunt snout bream).

[0121] The screening results showed that primer pair 3 had the best specificity. Furthermore, it amplified the specific target fragment in CG-IBfree samples, while no specific amplification bands were observed in WT and other control fish. Therefore, primer pair 3 was selected as the specific amplification primer for CG-IBfree. A schematic diagram showing the target location of the runx2b-A3 allele with primer pair 3 is shown below. Figure 2 As shown. This primer pair was designed based on the sequence differences in the edited region of the runx2b-A3 allele in CG-IBfree crucian carp without intermuscular spines. The forward primer is located at the edited site of the runx2b-A3 allele in CG-IBfree, and the reverse primer is located downstream of the edited site in CG-IBfree crucian carp. This specific primer cannot amplify the sequence in wild-type (WT) crucian carp.

[0122] The selected CG-IBfree primer pair (primer 3) is as follows:

[0123] CG-IBfree-3F: GGATGACTCGAACTGGAGCG (SEQ ID NO: 23);

[0124] CG-IBfree-3R: AGCGGCGACTGTACGTATCA (SEQ ID NO: 24);

[0125] This primer pair is used to amplify the CG-IBfree specific fragment of crucian carp. The fragment is 407 bp in size, and the specific sequence is as follows (underlined areas indicate primer positions, and square brackets indicate edited or deleted sequences):

[0126] CG-IBfree specific fragment (SEQ ID NO:27):

[0127] GGATGACTC[GCCGAAGGCCGGACTCTTCTCTGACCGCCTCAGT]GAACTGGAGCG TATCCGGCAGACCACCATGCGGGTTACCATGCCAACACAAACGCCACGGCCCTCGCTTAGCAACCCCAACTCCTTCACACCTCAGGGGCAGACGCAGATAACAGGTATGACATTTCTATTCTATTCTATTCTATTCTGAGAGGTGCTTCCGGATGATTATAAAGATAGATAGATAGATAGATA GATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGACTATACAATTTTAAAAGGTTTAAAAAGTTACTTGTAATTCATAAAATACGCAGGCATTGTTCATTTACAAATGTTTTATTGATATCATCTGCAAGTAAACCTACATGAATGAAGTAAA TGATACGTACAGTCGCCGCT

[0128] 2. Optimization of amplification conditions using CG-IBfree specific primers

[0129] 2.1 Adjustment of CG-IBfree specific primer PCR reaction program

[0130] The amplification efficiency of CG-IBfree specific primers (SEQ ID NO: 23 and SEQ ID NO: 24) was compared using the following five PCR amplification reagents. Other components are listed in Table 2.

[0131] #1: Use 2×TSINGKE ® Master Mix (Blue);

[0132] #2: Use 2×Rapid Taq Master Mix (Vazyme);

[0133] #3: Use 2×SuperNova PCR Mix (Dye);

[0134] #4: Use 2×K7 HiFi PCR Master Mix;

[0135] #5: Use iV 6 HiFi DNA Polymerase;

[0136] The PCR reaction program was as follows: 95 °C pre-denaturation for 3 min; 95 °C denaturation for 30 s, 60 °C annealing for 30 s, 72 °C extension for 10 s, for a total of 32 cycles; and a final extension at 72 °C for 5 min.

[0137] The results are as follows Figure 4 As shown, the test results indicate that under the modified reaction procedure, the amplification results of each amplification reagent were not ideal. Under these conditions, although clear and specific target fragments appeared in CG-IBfree samples, the amplification result of amplification reagent No. 3 showed bands in both WT and CG-IBfree, making it impossible to specifically identify CG-IBfree. The amplification results of the other amplification reagents showed bands in both CG-IBfree and other cyprinid fish, resulting in the inability to specifically identify silver carp.

[0138] 2.2 Screening of amplification reagents

[0139] Given that the amplification effect of each reagent was not good after the reaction procedure was changed, the rapid reaction procedure of the primer screening stage was retained, namely: 95 °C pre-denaturation for 3 min; 95 °C denaturation for 15 s, 60 °C annealing for 15 s, 72 °C extension for 10 s, for a total of 32 cycles; and finally 72 °C final extension for 5 min.

[0140] Under the above reaction procedure, using CG-IBfree genomic DNA as a template, and employing the selected CG-IBfree specific primers (SEQ ID NO:23 and SEQ ID NO:24), the amplification effects of the following six PCR amplification reagents were compared:

[0141] #1: Use 2×TSINGKE® Master Mix (Blue);

[0142] #2: Use 2×Rapid Taq Master Mix;

[0143] #3: Use 2×SuperNova PCR Mix (Dye);

[0144] #4: Use 2×K7 HiFi PCR Master Mix;

[0145] #5: Use iV 6 HiFi DNA Polymerase;

[0146] #6: Use 2×K7 HiFi PCR Master Mix.

[0147] Each reaction system is described in Table 4 (except for the amplification reagents).

[0148] The PCR reaction procedure was standardized as follows: 95 °C pre-denaturation for 3 min; 95 °C denaturation for 15 s, 60 °C annealing for 15 s, 72 °C extension for 10 s, for a total of 32 cycles; and finally 72 °C final extension for 5 min.

[0149] The results are as follows Figure 5 As shown in the figure, the amplification effect using amplification reagent No. 2 (2×Rapid Taq Master Mix) is the best, amplifying clear and specific target fragments only in CG-IBfree.

[0150] 3. Screening of specific PCR amplification reagents for silver carp runx2b

[0151] To obtain the optimal amplification effect of the runx2b-A specific primers (SEQ ID NO:3 and SEQ ID NO:4) and runx2b-B specific primers (SEQ ID NO:5 and SEQ ID NO:6) for silver carp, the amplification efficiency was compared using the following PCR amplification reagents:

[0152] Primer 1: runx2b-A, using 2×TSINGKE ® Master Mix (Blue);

[0153] Primer 2: runx2b-B, using 2×TSINGKE ® Master Mix (Blue);

[0154] Primer #3: runx2b-A, using 2×Rapid Taq Master Mix;

[0155] Primer #4: runx2b-B, using 2×Rapid Taq Master Mix;

[0156] Primer 5: runx2b-A, using iV 6 HiFi DNA Polymerase;

[0157] 6: runx2b-A primers, using 2×SuperNova PCR Mix (Dye);

[0158] 7: runx2b-B primers, using 2×SuperNova PCR Mix (Dye);

[0159] Primer #8: runx2b-A, using 2×K7 HiFi PCR Master Mix;

[0160] 9: runx2b-B primers, using 2×K7 HiFi PCR Master Mix;

[0161] 10: runx2b-B primer, using iV 6 HiFi DNA Polymerase.

[0162] Each reaction system was prepared according to Table 2 (except for the differences between primers and amplification reagents).

[0163] The PCR reaction program was as follows: 95 °C pre-denaturation for 3 min; 95 °C denaturation for 30 s, 55 °C annealing for 30 s, 72 °C extension for 20 s, for a total of 30 cycles; and a final extension at 72 °C for 5 min.

[0164] The screening results are as follows Figure 6 As shown in the figure. The results showed that the 2×TSINGKE® Master Mix (Blue) amplification reagent used in samples 1 and 2 had the best amplification effect. The amplification results showed that the runx2b-A primer and the runx2b-B primer produced clear and specific target fragments only in WT and CG-IBfree samples, and the band positions were accurate. The other amplification reagents produced unclear bands or weak bands in other fish samples. Therefore, 2×TSINGKE® Master Mix (Blue) was selected as the specific PCR amplification reagent for the runx2b-A and runx2b-B genes of crucian carp.

[0165] Example 3: Establishment of a specific PCR detection method for silver crucian carp runx2b-A, runx2b-B, and CG-IBfree intermuscular barbarian crucian carp.

[0166] 1. Primer sequence

[0167] The three pairs of specific primers identified through screening in Examples 1 and 2 are as follows:

[0168] The specific primer pair for silver carp runx2b-A is:

[0169] Upstream primer runx2b-A-2F: CTTGTATTTATTTGCAGCCAAATTC (SEQ ID NO:3);

[0170] Downstream primer runx2b-A-2R: GAAATGTCATACCTGTTATCTGCG (SEQ ID NO:4);

[0171] The specific primer pair for silver carp runx2b-B, as determined by screening, is as follows:

[0172] Upstream primer runx2b-B-1F: AGGCCGATGGATGGATATATATAC (SEQ ID NO:5);

[0173] Downstream primer runx2b-B-1R: ATCCATTCTTCAACCCACTTCTCT (SEQ ID NO:6);

[0174] The selected CG-IBfree primer pairs are:

[0175] CG-IBfree-3F: GGATGACTCGAACTGGAGCG (SEQ ID NO: 23);

[0176] CG-IBfree-3R: AGCGGCGACTGTACGTATCA (SEQ ID NO: 24).

[0177] 2. Preparation of template DNA for PCR amplification

[0178] 2.1 Genomic DNA Extraction

[0179] Muscle or fin tissues were collected from the tested silver carp (CG-IBfree or wild-type WT), carp, grass carp, and bluntnose bream, and genomic DNA was extracted using a kit. The extracted DNA was quality assessed by 1.5% agarose gel electrophoresis, and its concentration was determined.

[0180] Genomic DNA extraction quality test results as follows Figure 7 As shown in the diagram (lane arrangement: M for Takara DL15000 DNA Marker; lane 1 for CG-IBfree; lane 2 for WT; lane 3 for carp; lane 4 for grass carp; lane 5 for bluntnose bream). Results showed that the genomic DNA extracted using the kit method from CG-IBfree, WT, carp, grass carp, and bluntnose bream all exhibited clear and complete main bands on agarose gel electrophoresis, with no obvious degradation or tailing, indicating that the extracted genomic DNA was of good quality and suitable for subsequent PCR amplification.

[0181] 2.2 Preparation of DNA template stock solution

[0182] The extracted genomic DNA was diluted with sterile water to a working stock solution concentration of 100 ng / μL, which was then used as a template stock solution for PCR amplification.

[0183] 3. PCR reaction system and reaction procedure

[0184] 3.1 Specific PCR amplification of silver carp runx2b-A and runx2b-B

[0185] The specific PCR amplification reagent for silver carp runx2b-A and runx2b-B was 2×TSINGKE® Master Mix (Blue). The PCR reaction system is shown in Table 2 above; the PCR reaction program is as follows: 95 °C pre-denaturation for 3 min; 95 °C denaturation for 30 s, 55 °C annealing for 30 s, 72 °C extension for 20 s, for a total of 30 cycles; and finally 72 °C final extension for 5 min.

[0186] 3.2 Specific PCR amplification of CG-IBfree intermuscular barbel-free silver carp

[0187] The specific PCR amplification reagent for silver carp CG-IBfree was Vazyme's 2×Rapid Taq MasterMix. The PCR reaction system is shown in Table 4 above; the PCR reaction program was: 95 °C pre-denaturation for 3 min; 95 °C denaturation for 15 s, 60 °C annealing for 15 s, 72 °C extension for 10 s, for a total of 32 cycles; and finally 72 °C final extension for 5 min.

[0188] 4. Electrophoretic detection of PCR products

[0189] Take 10 μL of the PCR amplification product and separate it by electrophoresis in a 1×TAE gel containing 1.5% agarose. The electrophoresis conditions are 220 V and the electrophoresis time is about 25 min. After electrophoresis, place the gel under a gel imaging system for development and observation.

[0190] Example 4 Specificity Verification

[0191] This embodiment is used to verify the amplification specificity of the three sets of primers screened in this application.

[0192] 1. Specificity verification of the runx2b-A primer for silver carp

[0193] Using the genomic DNA extracted from CG-IBfree, WT, carp, grass carp, and blunt snout bream in Example 3 as templates, and sterile water as a template-free control, PCR amplification was performed using the primers shown in SEQ ID NO:3 and SEQ ID NO:4 and the reaction system in Table 2. The results were then detected according to the PCR reaction procedure and electrophoresis conditions in Example 3.

[0194] The results of runx2b-A gene-specific detection are as follows: Figure 8 As shown in A (lane arrangement: M is Takara DL2000 DNA Marker; lane 1 is CG-IBfree; lane 2 is WT; lane 3 is template-free control; lane 4 is carp; lane 5 is grass carp; lane 6 is bluntnose bream). The results showed that only the silver carp samples (CG-IBfree and WT) amplified a clear target band at approximately 335 bp, while no specific amplified fragment was observed in the control fish such as carp, grass carp, and bluntnose bream, as well as the template-free control.

[0195] The PCR amplification product of the runx2b-A gene was sequenced. The sequencing peak diagram is shown below. Figure 8 As shown in Figure B, the editing site region of the CG-IBfree sample exhibits typical peak characteristics, indicating that the sample contains multiple mutant alleles at the runx2b-A gene editing site.

[0196] 2. Specificity verification of the runx2b-B primer for silver carp

[0197] Using the genomic DNA extracted from CG-IBfree, WT, carp, grass carp, and blunt snout bream in Example 3 as templates, and sterile water as a template-free control, PCR amplification was performed using the primers shown in SEQ ID NO:5 and SEQ ID NO:6 and the reaction system in Table 2. The results were then detected according to the PCR reaction procedure and electrophoresis conditions in Example 3.

[0198] The results of runx2b-B gene specificity detection are as follows: Figure 9 As shown in A (lane arrangement: M is Takara DL2000 DNA Marker; lane 1 is CG-IBfree; lane 2 is WT; lane 3 is template-free control; lane 4 is carp; lane 5 is grass carp; lane 6 is bluntnose bream). The results showed that only the silver carp samples (CG-IBfree and WT) amplified a clear target band at approximately 688 bp, while no specific amplified fragment was observed in the control fish such as carp, grass carp, and bluntnose bream, as well as the template-free control.

[0199] The PCR amplification product of the runx2b-B gene was sequenced. The sequencing peak diagram is shown below. Figure 9As shown in Figure B, the editing site region of the CG-IBfree sample exhibits typical peak characteristics, indicating that the sample also has multiple mutant alleles at the runx2b-B gene editing site.

[0200] The above results indicate that the runx2b-A and runx2b-B primers for detecting silver carp are species-specific, amplifying the target band only in silver carp samples, and can effectively distinguish silver carp from common farmed cyprinid fish such as carp, grass carp, and blunt snout bream.

[0201] 3. Validation of CG-IBfree strain specificity

[0202] Amplification was performed using the CG-IBfree specific primer pair (SEQ ID NO: 5 and SEQ ID NO: 6) designed in Example 1, following the reaction system in Table 2 of Example 1 and the PCR reaction procedure for CG-IBfree, and the results were detected using the electrophoresis detection method in Example 1.

[0203] Test results as follows Figure 10 As shown in the diagram (lane arrangement: M for Takara DL2000 DNA Marker; lane 1 for CG-IBfree; lane 2 for WT; lane 3 for template-free control; lane 4 for carp; lane 5 for grass carp; lane 6 for bluntnose bream). The results showed that the specific target fragment was amplified only at approximately 407 bp in the CG-IBfree sample, while no specific amplification band was observed in the WT silver carp, carp, grass carp, bluntnose bream, and template-free control.

[0204] The above results indicate that the detection system established in this application can perform accurate and specific identification of CG-IBfree intermuscular barb, achieving dual identification of "species identification (silver crucian carp-specific primers) + strain identification (CG-IBfree-specific primers)".

[0205] Example 5: Sensitivity Verification

[0206] This embodiment is used to determine the sensitivity of the PCR detection method of this application.

[0207] 1. Preparation of graded dilution samples

[0208] Using the CG-IBfree genomic DNA at a concentration of 100 ng / µL from Example 3 as the stock solution, CG-IBfree DNA samples were prepared by serial dilution with sterile water at concentrations of 5%, 1%, 0.2%, 0.1%, 0.05%, and 0.025% by mass. PCR amplification was performed using these serially diluted samples as templates with three sets of primer pairs, following the same reaction system and procedure as in Example 3. Sterile water was used as a template-free control (lane 7), and each experiment was performed in triplicate.

[0209] 2. Sensitivity verification results

[0210] 2.1 Sensitivity of the runx2b-A primer for silver carp

[0211] Electrophoresis results as follows Figure 11 As shown in the figure. The results showed that clear target bands appeared at approximately 335 bp in lanes 1 (5%) to 5 (0.05%); no target bands were observed in lane 6 (0.025%) and lane 7 (without template control). This indicates that the detection limit of the runx2b-A specific primers is 0.05%.

[0212] 2.2 Sensitivity of the runx2b-B primer for silver carp

[0213] Electrophoresis results as follows Figure 12 As shown in the figure. The results showed that clear target bands appeared at approximately 688 bp in lanes 1 (5%) to 6 (0.025%); no target band was observed in lane 7 (without template control). This indicates that the detection limit of the runx2b-B specific primers is 0.025%.

[0214] 2.3 Sensitivity of CG-IBfree primers

[0215] Electrophoresis results as follows Figure 13 As shown in the figure. The results showed that clear target bands appeared at approximately 407 bp in lanes 1 (5%) to 4 (0.1%); no target bands were observed in lanes 5 (0.05%), 6 (0.025%), and 7 (without template control). This indicates that the detection limit of the CG-IBfree specific primers is 0.1%.

[0216] The above results indicate that all three primer sets possess high detection sensitivity: the runx2b-A specific primer for crucian carp can still detect CG-IBfree DNA at a mass percentage of 0.05%, the runx2b-B specific primer can still detect it at 0.025%, and the CG-IBfree specific primer can still detect it at 0.1%. This high sensitivity makes the method described in this application applicable to the detection of trace amounts of CG-IBfree DNA in mixed samples.

[0217] Example 6 Repeatability Verification

[0218] This embodiment is used to verify the repeatability of the detection method of this application.

[0219] 1. Experimental Design

[0220] Using CG-IBfree genomic DNA samples at concentrations of 1% and 0.2% (prepared as in Example 5), PCR amplification was performed using three sets of primers. DNA was extracted three times for each sample, and three PCR experiments were conducted, with WT and template-free controls included.

[0221] 2. Repeatability verification results

[0222] 2.1 Reproducibility of the runx2b-A primer for silver carp

[0223] Electrophoresis results as follows Figure 14 As shown in the figure. The results showed that clear target bands appeared at approximately 335 bp in lanes 1 (1% CG-IBfree), 2 (WT), 4 (0.2% CG-IBfree), and 5 (WT); while no bands were observed in lanes 3 (without template control) and 6 (without template control). The results of the three replicate experiments were consistent.

[0224] 2.2 Reproducibility of the runx2b-B primer for silver carp

[0225] Electrophoresis results as follows Figure 15 As shown in the figure. The results showed that clear target bands appeared at approximately 688 bp in lanes 1 (1% CG-IBfree), 2 (WT), 4 (0.2% CG-IBfree), and 5 (WT); while no bands were observed in lanes 3 (without template control) and 6 (without template control). The results of the three replicate experiments were consistent.

[0226] 2.3 Reproducibility of CG-IBfree primers

[0227] Electrophoresis results as follows Figure 16 As shown in the figure. The results showed that clear target bands appeared at approximately 407 bp in lanes 1 (1% CG-IBfree) and 4 (0.2% CG-IBfree); no bands were observed in lanes 2 (WT), 3 (no template control), 5 (WT), and 6 (no template control). The results of the three replicate experiments were consistent.

[0228] The above results indicate that the specific PCR detection methods for silver carp runx2b-A, runx2b-B, and CG-IBfree all have good repeatability, and the results are consistent between different batches of experiments.

[0229] Example 7: Method for Determining Detection Results

[0230] Based on the verification results of the above embodiments, the detection results of this application are determined according to the following criteria:

[0231] Step 1: Species identification

[0232] If the target band appears at approximately 335 bp after PCR amplification using the runx2b-A-2F / runx2b-A-2R primer pair (first group), and the target band appears at approximately 688 bp after PCR amplification using the runx2b-B-1F / runx2b-B-1R primer pair (second group), then the sample to be tested is determined to be a silver carp species.

[0233] If the target band is not found in either of the two primer pairs, it is determined that the non-silver crucian carp species in the sample may be other fish such as carp, grass carp, or blunt snout bream, or that the DNA quality is unqualified, or that the PCR system is abnormal.

[0234] Step 2: Strain identification (only for samples confirmed to be silver carp)

[0235] If the target band appears at 407 bp after PCR amplification using the CG-IBfree-3F / CG-IBfree-3R primer pair (Group 3), then the silver carp sample is determined to be a gene-edited, spineless, heterotrophic silver carp strain CG-IBfree.

[0236] If no 407 bp target band is observed after amplification using CG-IBfree primers, the silver carp sample is determined to be a wild-type silver carp (WT).

[0237] If the sample is confirmed to be a silver carp species using only the first two primer pairs, further confirmation of whether it is a CG-IBfree strain can be made by sequencing the PCR product: if the sequencing peaks show overlapping peaks in the edited site region, it suggests that the sample may be a CG-IBfree strain, and the complete edited genotype needs to be confirmed by single-clone sequencing; if the sequencing peaks are a single clear peak in the edited site region, it is a wild-type silver carp.

[0238] The third set of primers in this application can directly determine the strain identity through electrophoresis strips without sequencing, significantly simplifying the detection process.

[0239] The present application has been described in detail above. Specific examples have been used to illustrate the principles and implementation methods of the present application. The descriptions of the embodiments above are only for the purpose of helping to understand the present application and its core ideas. It should be noted that those skilled in the art can make several improvements and modifications to the present application without departing from the principles of the present application, and these improvements and modifications also fall within the protection scope of the claims of the present application.

Claims

1. A set of PCR primers for identifying gene-edited, spineless, heterotrophic silver carp (CG-IBfree), characterized in that, The primer set comprises three primer pairs, wherein: The first set of primer pairs consists of primers specifically for amplifying the runx2b-A gene of crucian carp, including: runx2b-A-2F: Nucleotide sequence as shown in SEQ ID NO:3; and runx2b-A-2R: Nucleotide sequence as shown in SEQ ID NO:4; The second set of primer pairs consists of primers specifically for amplifying the runx2b-B gene of crucian carp, including: runx2b-B-1F: Nucleotide sequence as shown in SEQ ID NO:5; and runx2b-B-1R: Nucleotide sequence as shown in SEQ ID NO:6; The third set of primer pairs consists of primers specific to CG-IBfree strains for amplification, including: CG-IBfree-3F: Nucleotide sequence as shown in SEQ ID NO:23; and CG-IBfree-3R: Nucleotide sequence as shown in SEQ ID NO:

24.

2. A detection kit for identifying CG-IBfree, gene-edited, spineless, heterotrophic silver carp, characterized in that, The kit contains the PCR primer set as described in claim 1.

3. The detection kit according to claim 2, characterized in that, The kit also contains one or more components selected from the following: 2×TSINGKE (blue color) ® Master Mix, 2×Rapid Taq Master Mix, DNA Extraction Reagent, Agarose, DNA Marker.

4. The detection kit according to claim 3, characterized in that, The kit also includes a positive control and a negative control, wherein the positive control is CG-IBfree silver carp genomic DNA and the negative control is wild-type silver carp genomic DNA.

5. A method for identifying gene-edited, spineless, heterotrophic silver carp (CG-IBfree) using the PCR primer set described in claim 1, characterized in that, Includes the following steps: Step 1: Extract genomic DNA from the sample to be tested; Step 2: Using the genomic DNA extracted in Step 1 as a template, perform PCR amplification using the first set of primer pairs, the second set of primer pairs, and the third set of primer pairs, respectively; Step 3: Detect the PCR amplification products from Step 2 by agarose gel electrophoresis; Step 4: Make the following judgments based on the electrophoresis results: If the target band appears at approximately 335 bp after PCR amplification using the first primer pair, and the target band appears at approximately 688 bp after PCR amplification using the second primer pair, then the sample to be tested is determined to be a silver carp species; if no target band appears after using either the first or second primer pair, then the sample to be tested is determined to be a non-silver carp species. If the PCR amplification product of the third primer pair shows a target band of approximately 407 bp, the sample is determined to be a gene-edited, spineless, heterotrophic silver crucian carp (CG-IBfree); if the third primer pair does not show a target band, the sample is determined to be a wild-type silver crucian carp.

6. The method according to claim 5, characterized in that, The following judgment method can also be used: If the sample is confirmed to be a silver carp species using only the first and second primer pairs, further confirmation of whether it is a CG-IBfree strain can be made by sequencing the PCR product: if the sequencing peaks show overlapping peaks in the edited site region, it suggests that the sample may be a CG-IBfree strain, and the complete edited genotype needs to be confirmed by single-clone sequencing; if the sequencing peaks are a single clear peak in the edited site region, it is a wild-type silver carp.

7. The method according to claim 5, characterized in that, In step 2, the total PCR amplification reaction system of the first and second primer pairs is 25 µL, containing 2×TSINGKE (blue) primer. ® Master Mix 12.5 µL, forward and reverse primers 0.5 µL each (10 µM), DNA template 1.0 µL, ddH2O to bring the total to 25 µL; PCR amplification program for the first and second primer pairs: 95 °C pre-denaturation for 3 min; 95 °C denaturation for 30 s, 55 °C annealing for 30 s, 72 °C extension for 20 s, for a total of 30 cycles; final extension at 72 °C for 5 min.

8. The method according to claim 5, characterized in that, In step 2, the PCR amplification reaction system of the third primer pair totals 25 µL, including 12.5 µL of 2×Rapid Taq Master Mix, 0.5 µL each of 10 µM forward and reverse primers, 1.0 µL of 100 ng / µL DNA template, and ddH2O to bring the total to 25 µL. The PCR amplification reaction program of the third primer pair is as follows: 95 °C pre-denaturation for 3 min; 95 °C denaturation for 15 s, 60 °C annealing for 15 s, 72 °C extension for 10 s, for a total of 32 cycles; and a final extension at 72 °C for 5 min.

9. The method according to claim 5, characterized in that, In step 3, the conditions for agarose gel electrophoresis are: 1.5% agarose and 1×TAE buffer.

10. The application of the PCR primer set of claim 1 or the kit of any one of claims 2-4 in identifying gene-edited, non-muscularly spurred, heterotrophic silver carp CG-IBfree.

Images