A composite probe for detecting drug-resistant genes of drug-resistant bacteria, a test strip and application thereof

Abstract

The application provides a composite probe for detecting drug-resistant gene of drug-resistant bacteria, a test strip, a device and application thereof, and belongs to the technical field of drug-resistant bacteria detection. The composite probe comprises an Ago enzyme functionalized capture probe and a SAF signal composite probe; the Ago enzyme functionalized capture probe comprises an Ago enzyme and a base complementary strand for the drug-resistant gene of the drug-resistant bacteria; and the SAF signal composite probe comprises streptavidin, gold nanoparticles and ferrocene. Compared with single signal detection technology, the application has both visual qualitative and accurate quantitative capabilities, high specificity and good repeatability, and provides core technical support for on-site rapid prevention and control of drug-resistant bacteria.

Description

Technical Field

[0001] This invention belongs to the field of drug-resistant bacteria detection technology, and particularly relates to a composite probe, test strip and application for detecting drug resistance genes of drug-resistant bacteria. Background Technology

[0002] Methicillin-resistant Staphylococcus aureus (MRSA), a highly pathogenic multidrug-resistant foodborne bacterium, poses a core threat due to the various drug-resistant genes carried by its strains. These genes can mediate resistance to multiple antibiotics, including β-lactams, significantly increasing the difficulty of clinical infection treatment and posing a greater risk to food safety. MRSA is widely distributed in livestock and poultry meat, dairy products, water bodies, and throughout the entire food processing chain. Drug-resistant genes can spread and proliferate with bacterial contamination, easily causing foodborne poisoning and skin infections, and can also induce fatal diseases such as sepsis and severe systemic infections. Furthermore, horizontal transfer of drug-resistant genes can exacerbate the spread of drug-resistant bacteria in the environment and food, seriously threatening public health and the safety and stability of the food supply chain. Therefore, conducting precise, rapid, and on-site DNA testing and screening for MRSA drug-resistant genes is crucial for tracing the source of drug-resistant contamination, blocking the spread of drug-resistant bacteria, and achieving precise control of MRSA resistance. This has significant practical implications for food safety management and clinical anti-infection control.

[0003] Currently, several mainstream detection systems have been developed for detecting MRSA resistance or its resistance gene DNA. These mainly include traditional antimicrobial susceptibility testing, conventional PCR gene detection, isothermal amplification detection, and traditional rapid test strip detection. Each of these technologies has significant application shortcomings and technical limitations. Traditional antimicrobial susceptibility phenotyping is a classic method for determining resistance, directly reflecting the resistance phenotype of the strain. However, this method requires multiple steps, including strain isolation and culture, and antimicrobial susceptibility incubation and identification, resulting in an overall detection cycle of 24–72 hours. The process is cumbersome, with extremely low detection efficiency, and it cannot directly target the resistance gene for source tracing, making early and rapid screening difficult. Conventional PCR and real-time quantitative PCR, among other molecular DNA detection technologies, are widely used for detecting drug resistance genes due to their high specificity and sensitivity. However, these technologies are highly dependent on sophisticated amplification instruments, professional laboratory personnel, and standardized experimental environments, resulting in high detection costs and poor portability, making them unsuitable for on-site screening scenarios such as food processing sites and rapid testing at the grassroots level. Furthermore, traditional nucleic acid testing struggles to effectively distinguish between dead and live bacteria with residual drug resistance genes, easily leading to false positives and interfering with the accurate assessment of drug resistance risk. Traditional nucleic acid test strips offer advantages such as ease of operation, rapid detection, and high portability, making them suitable for rapid on-site screening. However, existing test strips often rely on a single colorimetric signal output, exhibiting limitations such as limited detection sensitivity, weak resistance to interference from complex food matrices, lack of precise quantification capabilities, and poor signal stability, making it difficult to meet the accurate detection needs of low-abundance MRSA drug resistance genes in complex food samples. In recent years, new detection technologies such as electrochemical and optical sensing have been gradually applied to the field of nucleic acid detection, effectively improving detection sensitivity. However, most technologies are still single-signal detection modes with a single signal output dimension. They are easily affected by external factors such as food matrix impurities, ambient temperature, and humidity, resulting in poor detection stability and repeatability. They cannot achieve accurate qualitative and quantitative detection of MRSA resistance genes in complex scenarios.

[0004] Compared to traditional single-signal detection systems, dual-mode synergistic detection strategies can achieve complementary and cross-validation of feature information through two detection signals based on different principles. This effectively compensates for the shortcomings of single-signal detection, such as weak anti-interference ability, limited detection dimensions, and high error rate. It significantly improves the specificity, sensitivity, and environmental adaptability of nucleic acid detection. The dual-signal synergistic amplification effect reduces the detection limit of drug resistance genes, while significantly reducing false positive and false negative results, ensuring the accuracy and reliability of MRSA drug resistance gene detection results. Currently, there are still many technical bottlenecks in on-site detection of MRSA drug resistance genes. The core difficulties lie in the low enrichment efficiency of drug-resistant MRSA strains in complex food samples, the large interference from free drug resistance gene detection, the difficulty in accurately controlling nucleic acid amplification reaction conditions, and the single and unstable on-site detection signal. Existing conventional detection systems lack efficient target strain enrichment and purification modules, failing to remove matrix impurities from samples, making it difficult to accurately capture low-abundance drug resistance genes. Furthermore, traditional test strip detection cannot achieve integrated and controllable nucleic acid amplification and detection reactions. Room temperature detection environments easily lead to insufficient RPA isothermal amplification efficiency and incomplete nucleic acid binding reactions, greatly affecting detection accuracy. Therefore, further research is urgently needed to obtain a testing method that is easy to operate, low in cost, requires no large instruments, has good performance, and is suitable for the needs of on-site testing at the grassroots level. Summary of the Invention

[0005] In view of this, the purpose of the present invention is to provide a composite probe, test strip and application for detecting drug resistance genes of drug-resistant bacteria.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a composite probe for detecting drug resistance genes in drug-resistant bacteria, the composite probe comprising an Ago enzyme-functionalized capture probe and a SAF signaling composite probe; The Ago enzyme-functionalized capture probe contains an Ago enzyme and a base-complementary strand targeting the drug resistance gene of drug-resistant bacteria. The SAF signal composite probe contains streptavidin, gold nanoparticles, and ferrocene.

[0007] Preferably, the drug-resistant bacteria are methicillin-resistant Staphylococcus aureus.

[0008] Preferably, the complementary base sequence of the drug resistance gene is shown in SEQ ID NO.1.

[0009] Preferably, the method for preparing the SAF signal composite probe includes the following steps: 1) Mix 0.5-2 mL of gold nanoparticles with 30-50 μL of streptavidin (SA) at a concentration of 0.5-2.0 mg / mL for 15-60 min to obtain SA-modified gold nanoparticles; 2) Mix SA-modified gold nanoparticles with 80-120 μL of buffer solution, adjust the pH to 5.5-6.5, and then mix with 10-30 μL of 0.5-2 mM ferrocene formate to obtain a mixed solution; 3) Mix the mixture with 5~15μL of EDC / NHS working solution, covalently couple it in the dark for 1~3 h, block it for 15~60 min, centrifuge at 10000~15000 rpm for 10~30 min, wash, resuspend, and obtain the SAF signal composite probe. The EDC / NHS working solution comprises 5-15 mg / mL EDC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide) and 5-15 mg / mL NHS (N-hydroxysuccinimide).

[0010] Preferably, the blocking agent used in step 3) is 40~80μL of 5%~15% bovine serum albumin (BSA).

[0011] This invention provides a test strip containing the composite probe, wherein the test strip is a side-flow chromatography test strip; The side-flow chromatography test strip includes a sample pad, a conjugation pad, a nitrocellulose membrane, an absorbent pad, and a PVC backing card; The Ago enzyme-functionalized capture probe is immobilized on the detection line of the nitrocellulose membrane, and the control line is coated with streptavidin; the SAF signal composite probe is immobilized on the binding pad; and biotin-containing primers designed for RPA amplification of the target drug resistance gene are immobilized on the sample pad.

[0012] This invention provides the application of the composite probe or the test strip described herein in the preparation of products for detecting drug-resistant bacteria.

[0013] Preferably, the product further includes phage-functionalized capture magnetic beads; The phage-functionalized capture magnetic beads are made by amylating iron oxide and linking it to an inactivated phage.

[0014] Preferably, the inactivated bacteriophage includes Staphylococcus aureus bacteriophage.

[0015] Preferably, the concentration of the Ago enzyme-functionalized capture probe in the product is 0.8~1.2 mg / mL; The concentration of the SAF signal composite probe is 0.8~1.2 mg / mL.

[0016] Compared with the prior art, the present invention has the following beneficial effects: This invention constructs a composite probe, test strip, and their applications for detecting drug-resistant genes in antibiotic-resistant bacteria. The composite probe includes an Ago enzyme-functionalized capture probe and a SAF signal composite probe. The Ago enzyme achieves precise identification of drug-resistant genes by specifically binding to target gDNA, ensuring high detection specificity. The chromatography test strip is modified with a streptavidin (SA)-gold nanoparticles (AuNPs)-ferrocene (Fc) functionalized capture probe, which can simultaneously output both colorimetric and electrochemical detection signals. The innovatively designed integrated detection device incorporates a test strip fixing slot and a constant temperature heating module, transferring the RPA isothermal amplification reaction to the sample pad on the test strip, truly realizing the integrated process of enrichment-amplification-detection. In addition, this invention also includes a phage-functionalized magnetic bead enrichment unit, which can specifically capture target drug-resistant MRSA strains, efficiently enriching target bacteria while removing matrix impurities from complex samples.

[0017] The detection system of this invention possesses excellent specificity, high efficiency, dual-mode accuracy, and practicality. Specificity: Functionalized bacteriophages specifically recognize only their host MRSA strains. Combined with the precise recognition of drug resistance gene target sequences by Ago enzymes, the dual specificity ensures no cross-reaction with non-target pathogens, resulting in excellent detection specificity. High efficiency: Relying on the rapid enrichment effect of bacteriophage magnetic beads, the in-situ RPA isothermal amplification efficiency of the sample pad, and the signal amplification effect of nanomaterials, the entire detection process from sample pretreatment to result output can be completed within 70 minutes, with a linear range covering 10¹~10¹⁰. 8 With a detection limit as low as 10 CFU / mL, its detection performance is far superior to traditional colloidal gold test strips. Dual-mode accuracy: colorimetric signals enable rapid on-site visual screening, while electrochemical signals provide precise quantitative detection. The two signal principles complement and mutually correct each other, effectively avoiding the shortcomings of single signals being susceptible to environmental and matrix interference. The detection results are highly accurate and repeatable. Practicality: The integrated device design greatly simplifies the operation process, making it suitable for various practical samples such as fresh meat, dairy products, and environmental water. It exhibits good spike recovery, minimal matrix interference, and requires no complex sample pretreatment, making it highly valuable for on-site promotion and application.

[0018] This invention's detection method requires no large, precision instruments, is simple to operate, and has a total detection time of less than 70 minutes. It features a wide linear detection range and a low detection limit, making it suitable for on-site testing of complex samples such as food and environmental water samples. The test strips are simple to prepare, low in cost, and have good storage stability, making them suitable for diverse applications such as grassroots supervision, food company self-inspection, and emergency monitoring. Compared to single-signal detection technologies, this invention combines visual qualitative screening with precise quantitative detection capabilities, exhibiting high specificity and good repeatability, providing core technical support for rapid on-site control of foodborne drug-resistant pathogens. Attached Figure Description

[0019] Figure 1 This is a schematic diagram of the dual-mode detection of the present invention; wherein, A is a flowchart of the enrichment and lysis of drug-resistant bacteria to be detected by phage-functionalized capture magnetic beads, B is a flowchart of the target gene extracted by the detection device being amplified by RPA on the test strip and then subjected to colorimetric detection, C is a schematic diagram of electrochemical detection of the test strip, and D is a schematic diagram of the layered explosion of the device designed in the present invention.

[0020] Figure 2 Characterization diagrams of phage-functionalized magnetic beads for MRSA capture are shown below. A represents the scanning electron microscopy (SEM) results of the phage; B represents the SEM image of Staphylococcus aureus; C and D represent the SEM and transmission electron microscopy images, respectively, of the phage-functionalized magnetic beads after binding with MRSA; E and F represent the transmission electron microscopy images of live and dead bacteria; G represents the electrochemical results of streptavidin, SA-colloidal gold, and SA-AuNPs-ferrocene; H represents the zeta potential spectra of the magnetic beads, phage-functionalized magnetic beads, and their MRSA capture; and I represents the electrochemical detection results of the T-line on the test strip after individual modification with Ago enzyme and gDNA.

[0021] Figure 3 The results represent the detection of the binding process between functionalized Ago enzymes and target drug resistance genes. In the DNA detection mode of capillary electrophoresis, AH represents the detection results of Ago enzyme, DNA, mecA, mecA (bio), Ago enzyme-gDNA, Ago enzyme-mecA (MRSA drug resistance gene), primer F, and F-SA, respectively. I represents the detection result of Ago enzyme in the protein detection mode of capillary electrophoresis.

[0022] Figure 4 The optimized conditions of the present invention are as follows: the optimized conditions of AE are the manganese ion concentration of the incubation solution, the incubation time of Ago enzyme and gDNA, the reaction pH, the modification concentration of Ago enzyme, and the concentration of buffer B used when extracting protein.

[0023] Figure 5 The diagram shows the standard curve and signal graph for dual-mode detection, as well as the specificity and stability of the present invention. Specifically, A represents the colorimetric results of the test strip detecting samples containing different concentrations of the target gene; B represents the specific colorimetric results of the test strip detecting samples with different bacterial genes; C represents the standard curve of the colorimetric results; D and E represent the electrochemical detection results and their standard curves for different concentrations of bacteria based on the designed test strip; F and G represent the specificity results of the designed test strip in detecting different bacteria, both between and within groups; and H represents the stability results of the designed test strip.

[0024] Figure 6The results of bioluminescence detection of phage lysis of target bacteria and heating rate of heating pad are shown, where A is the result of bioluminescence detection of phage lysis of target bacteria and B is the result of heating rate of heating pad. Figure 7 The diagram shows the actual detection device of the present invention; wherein, A is a comparison diagram of the actual detection device with the size of a coin, B is a physical diagram of the device used to quickly perform electrochemical detection on the test strip on site, and CF is a layered physical diagram of the device of the present invention. Detailed Implementation

[0025] This invention provides a composite probe for detecting drug resistance genes in drug-resistant bacteria, the composite probe comprising an Ago enzyme-functionalized capture probe and a SAF signaling composite probe; The Ago enzyme-functionalized capture probe contains an Ago enzyme and a base-complementary strand targeting the drug resistance gene of drug-resistant bacteria. The SAF signal composite probe contains streptavidin, gold nanoparticles, and ferrocene.

[0026] In this invention, the drug-resistant bacteria are preferably methicillin-resistant Staphylococcus aureus; the complementary base sequence of the drug resistance gene is shown in SEQ ID NO.1: SEQ ID NO.1:TCTGCAGTACCGGATTT; In this invention, the method for preparing the SAF signal composite probe includes the following steps: 1) Mix 0.5-2 mL of gold nanoparticles with 30-50 μL of streptavidin at a concentration of 0.5-2.0 mg / mL for 15-60 min to obtain SA-modified gold nanoparticles; 2) Mix SA-modified gold nanoparticles with 80-120 μL of buffer solution, adjust the pH to 5.5-6.5, and then mix with 10-30 μL of 0.5-2 mM ferrocene formate to obtain a mixed solution; 3) Mix the mixture with 5~15μL of EDC / NHS working solution, covalently couple it in the dark for 1~3 h, block it for 15~60 min, centrifuge at 10000~15000 rpm for 10~30 min, wash, resuspend, and obtain the SAF signal composite probe. In this invention, gold nanoparticles are mixed with streptavidin to obtain SA-modified gold nanoparticles; the size of the gold nanoparticles is preferably 10-30 nm, more preferably 15-25 nm, and even more preferably 20 nm; the amount of gold nanoparticles used is preferably 0.5-2 mL, more preferably 0.7-1.5 mL, and even more preferably 1 mL; the concentration of the streptavidin is preferably 0.5-2.0 mg / mL, more preferably 0.7-1.5 mg / mL, and even more preferably 1.0 mg / mL; the amount of streptavidin used is preferably 30-50 μL, more preferably 35-45 μL, and even more preferably 40 μL; the mixing time is preferably 15-60 min, more preferably 20-45 min, and even more preferably 30 min; the mixing temperature is preferably room temperature, more preferably 20-26°C, and even more preferably 23°C.

[0027] In this invention, SA-modified gold nanoparticles are mixed with a buffer solution, the pH is adjusted, and then mixed with ferroceneformic acid to obtain a mixture. The buffer solution is preferably MES buffer solution, and the pH of the MES buffer solution is preferably 5.0-6.0, more preferably 5.2-5.8, and even more preferably 5.5. The amount of buffer solution used is preferably 80-120 μL, more preferably 90-110 μL, and even more preferably 100 μL. The pH of the SA-modified gold nanoparticles mixed with the buffer solution is preferably 5.5-6.5, more preferably 5.8-6.2, and even more preferably 6.0. The concentration of ferroceneformic acid is preferably 0.5-2 mM, more preferably 0.7-1.5 mM, and even more preferably 1 mM. The amount of ferroceneformic acid used is preferably 10-30 μL, more preferably 15-25 μL, and even more preferably 20 μL.

[0028] In this invention, a mixture is combined with an EDC / NHS working solution, covalently coupled in the dark, blocked, centrifuged, washed, and resuspended to prepare a SAF signal composite probe. The preferred volume of the EDC / NHS working solution is 5-15 μL, more preferably 8-12 μL, and even more preferably 10 μL. The EDC / NHS working solution preferably comprises EDC and NHS. The preferred concentration of EDC is 5-15 mg / mL, more preferably 8-12 mg / mL, and even more preferably 10 mg / mL. The preferred concentration of NHS is 5-15 mg / mL, more preferably 8-12 mg / mL, and even more preferably 10 mg / mL. mg / mL; the preferred temperature for light-protected covalent coupling is room temperature, more preferably 20-26℃, more preferably 23℃; the preferred time for light-protected covalent coupling is 1-3 h, more preferably 1.5-2.5 h, and even more preferably 2 h; the preferred blocking agent used in the blocking is BSA, and the preferred amount of BSA is 40-80 μL, more preferably 50-70 μL, and even more preferably 60 μL; the preferred concentration of BSA is 5%-15%, more preferably 8%-12%, and even more preferably 10%; the preferred blocking time is 15-60 min, more preferably 20-45 min, and even more preferably 30 min; the preferred centrifugation speed is 10000-15000 rpm, more preferably 11000-14000 rpm, and even more preferably 12000 rpm; the preferred centrifugation time is 10-30 min, more preferably 12-20 min, and even more preferably 15 min; the washing preferably includes washing 2-3 times with buffer solution, preferably PBS buffer.

[0029] This invention provides a test strip containing the composite probe, wherein the test strip is a side-flow chromatography test strip; The side-flow chromatography test strip includes a sample pad, a conjugation pad, a nitrocellulose membrane, an absorbent pad, and a PVC backing card; The Ago enzyme-functionalized capture probe is immobilized on the detection line of the nitrocellulose membrane, and the control line is coated with streptavidin; the SAF signal composite probe is immobilized on the binding pad; and biotin-containing primers designed for RPA amplification of the target drug resistance gene are immobilized on the sample pad.

[0030] Reconstitution efficiency of lyophilized amplification reagents on the sample pad: rapid, complete, and uniform dissolution can be achieved.

[0031] This invention utilizes a glass fiber sample pad with a three-dimensional interconnected porous fiber network structure. Amplification primers and core RPA reaction components are uniformly spray-dried onto the fiber surface, rather than embedded within a solid matrix. When the sample solution wets the sample pad via capillary action, the liquid phase directly contacts the entire surface of the lyophilized reagents. Simultaneously, the sample volume (50-100 μL) is significantly larger than the total mass of the lyophilized reagents (micrograms), constituting a typical "excess solvent - small amount of solute" dissolution system, allowing for complete dissolution within seconds. Furthermore, the sucrose and Tween-20 components in the sample pad pretreatment system protect the bioactivity of the enzymes and primers during lyophilization and also act as a solubilizer during reconstitution, further accelerating the dissolution rate and ensuring the synchronous and uniform release of all components.

[0032] In a side-flow chromatography system, the sample pad is the upstream first contact area. Its high porosity and large flow resistance prevent the sample solution from flowing through instantaneously; instead, a 3-5 minute liquid-phase retention window forms within the sample pad. During this retention time, the dissolved amplification reagents and the target nucleic acids in the sample can be thoroughly mixed through molecular diffusion, forming a homogeneous reaction system. This avoids the problem of uneven local reagent concentrations and provides a good liquid-phase foundation for subsequent amplification reactions.

[0033] This application's design of fixing the amplification reagent to the sample pad is not a simple positional adjustment, but a systematic design that works in conjunction with the device's built-in 37°C isothermal heating module. Together, they achieve efficient in-situ amplification on the sample pad: 1. Adapted to isothermal reaction characteristics for in-situ initiation: RPA is an isothermal amplification technology with an optimal reaction temperature of 37~39°C, requiring no thermal cycling to initiate the reaction. The heating area of ​​the detection device in this application is directly opposite the sample pad, and the system is preheated to 37°C before sample addition. When the sample solution dissolves the lyophilized reagent, the system is at the optimal reaction temperature. Primers, recombinases, polymerases, and other components can immediately bind to the target nucleic acid after dissolution, initiating the amplification reaction without the time delay of "dissolution followed by heating." 2. Continuous process of amplification and chromatography simultaneously: The amplification reaction is mainly initiated and continues during the liquid phase retention stage of the sample pad. As the chromatography process progresses, the amplification products gradually migrate downstream to the binding pad and NC membrane, forming a continuous reaction flow of "in-situ amplification - continuous extension - chromatographic detection." Compared to the traditional two-step method of "independent in-tube amplification followed by sample loading and chromatography", this design eliminates the need for additional reaction containers and manual transfer operations, truly achieving integrated detection with "one-step sample loading and fully automated process".

[0034] The technical advantages of this invention compared to the conventional design of conjugate pads / independent reaction pads are as follows: 1. Longer amplification reaction window and higher detection sensitivity: The sample pad is at the upstream end of the chromatography line, where the liquid flow residence time is the longest. Reagents dissolved here can achieve the longest amplification reaction time. If placed on the conjugate pad, the dissolved reagents quickly enter the NC membrane with the liquid flow, resulting in insufficient amplification reaction and directly leading to insufficient target amplification yield and decreased detection sensitivity. 2. Matrix retains impurities and reduces background interference: The RPA amplification system contains multiple components such as polymerase, recombinase, and salt ions. If released at the conjugate pad location, a large amount of protein and high concentration of salt ions easily increase the non-specific adsorption of the NC membrane, increasing background noise. When placed before the sample pad, large molecular weight protein impurities can be retained by the glass fiber matrix, and only small molecule amplification products move downstream with the liquid flow, effectively reducing background signal and improving the detection signal-to-noise ratio. 3. Simplified structure and higher integration: No additional independent reaction pad is required, which simplifies the structure and assembly process of the test strip; the sample pad simultaneously undertakes four functions: "sample receiving - impurity filtration - reagent reconstitution - in situ amplification", which is the core structural basis for the invention to achieve "enrichment-amplification-detection integrated process".

[0035] This invention provides the application of the composite probe or the test strip described herein in the preparation of products for detecting drug-resistant bacteria.

[0036] In this invention, the product also includes phage-functionalized capture magnetic beads; The phage-functionalized capture magnetic beads are made by amylating iron oxide and linking it to an inactivated phage.

[0037] In this invention, the inactivated bacteriophage includes Staphylococcus aureus bacteriophage.

[0038] In this invention, the concentration of the Ago enzyme-functionalized capture probe in the product is preferably 0.8~1.2 mg / mL, more preferably 0.9~1.2 mg / mL, and even more preferably 1.0 mg / mL; The concentration of the SAF signal composite probe is preferably 0.8~1.2 mg / mL, more preferably 0.9~1.2 mg / mL, and even more preferably 1.0 mg / mL.

[0039] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0040] Source of materials: Ferrocene (Fc), Chloroauric acid trihydrate (HAuCl4) 3H2O (purity 99.99%) was purchased from Shanghai Aladdin Biochemical Technology Co., Ltd. (Shanghai, China).

[0041] Streptavidin (SA) bovine serum albumin (BSA, molecular weight 45 kDa) was purchased from Solarbio Science & Technology Co., Ltd. (Beijing, China).

[0042] Physiological saline (catalog number ST341) and phosphate buffered saline (PBS, 0.01 mol / L, pH 7.4) were purchased from Shanghai Yuanye Biotechnology Co., Ltd. (Shanghai, China).

[0043] The experimental water was double-distilled deionized water (resistivity 18.2 MΩ). cm).

[0044] LB broth medium and microbial grade agar powder were purchased from Hangzhou Microbial Reagent Co., Ltd. (Hangzhou, China).

[0045] Methicillin-resistant Staphylococcus aureus (MRSA, GDMCC NO.1.1263) was provided by Guangdong Provincial Center for Microbial Culture Collection (Guangzhou, China). Its specific bacteriophage is Staphylococcus aureus phage IME-SA118. The original isolate of this bacteriophage was obtained from sewage samples in China and has been publicly included in the NCBI GenBank database with accession number KR902361.1.

[0046] Escherichia coli O157:H7 (GDMCC NO.1.2702), Salmonella Typhimurium (GDMCC NO.1.3028), and Listeria monocytogenes (GDMCC NO.1.347) were purchased from Guangdong Provincial Microbial Culture Collection Center (GDMCC). Glass fiber membranes, nitrocellulose (NC) membranes (used for preparing sample pads and conjugation pads, respectively), PVC backing cards, absorbent pads, and the XYZ three-dimensional scribing and gold spraying instrument were purchased from Shanghai Jinbiao Biotechnology Co., Ltd. (Shanghai, China).

[0047] The electrochemical workstation was purchased from Shanghai Chenhua Instrument Co., Ltd. (model CHI 760e, Shanghai, China).

[0048] The bioluminescence imaging system was purchased from Guangzhou Yuwei Biotechnology Instruments Co., Ltd. (model Tanon ABL X5, Guangzhou, China).

[0049] The screen-printed electrodes (SPEs) were purchased from DropSens (Herissau, Switzerland), a subsidiary of Metrohm.

[0050] Example 1

[0051] Preparation and characterization of phage-functionalized trapping magnetic beads and trapping probes (SAF)

[0052] (1.1) Preparation of phage-functionalized trapping magnetic beads

[0053] (1.1.1) Preparation of specific phage solutions

[0054] Methicillin-resistant Staphylococcus aureus (MRSA) was inoculated into LB liquid medium and placed in a constant temperature shaker at 37°C and 220 r / min for 6 h until the bacteria entered the logarithmic growth phase. At this point, the bacterial solution was uniformly turbid, and the optical density (OD) at 600 nm was [value missing]. 600 The concentration of the target phage was approximately 0.5-0.8. Subsequently, the purified target phage was added at a phage to bacterial culture volume ratio of 1:100, and the culture was continued under the above conditions with shaking for 6 h.

[0055] During cultivation, the bacteriophage sequentially completes host adsorption and genetic material injection, synthesizes nucleic acids and proteins with the help of the bacterial metabolic system, and then assembles to form progeny bacteriophages, ultimately causing lysis of the host bacteria. The bacterial solution gradually changes from turbid to clear. After cultivation, the mixture is transferred to centrifuge tubes and centrifuged at 8000 r / min for 15 min to remove unlysed bacterial precipitate. The supernatant is filtered through a 0.22 μm filter membrane to further remove impurities and residual bacteria. The resulting bacteriophage lysate can be used for subsequent titer determination and related experiments.

[0056] To verify the host specificity of bacteriophages, logarithmically growing MRSA bacterial suspension was thoroughly mixed with melted LB semi-solid agar medium cooled to 45°C at a 1:1 ratio to prepare a bacterial upper semi-solid medium. 100 μl of diluted bacteriophage suspension was added to this mixture, quickly mixed, and immediately poured onto the surface of the pre-solidified lower solid agar plate. After the upper medium had completely solidified, the plate was inverted and incubated at 37°C for 12 h. After incubation, clearly defined circular transparent / translucent plaques appeared on the plate surface; these were MRSA-specific plaques. A single plaque is typically formed by the proliferation and lysis of a single bacteriophage and can be used for bacteriophage isolation, purification, and titer counting.

[0057] Take the cultured MRSA bacterial solution, wash it once with physiological saline, and then adjust the bacterial concentration to 10 with physiological saline. 8 CFU / mL (optical density value at 670 nm OD) 670(≈0.3), transfer to a suitable liquid culture medium and culture to the logarithmic growth phase. Take an appropriate amount of bacterial suspension, centrifuge at 25℃ and 10000×g for 5 min, and discard the supernatant; add 100-fold concentrated AO / PI staining working solution at a ratio of 1 μL per 100 μL of bacterial suspension, mix thoroughly, and incubate at 37℃ in the dark for 15 min. Acridine orange (AO) has an excitation wavelength / emission wavelength of 503 nm / 530 nm and emits green fluorescence; propidium iodide (PI) has an excitation wavelength / emission wavelength of 535 nm / 617 nm and emits red fluorescence. After incubation, drop 10 μL of bacterial suspension onto a glass slide, cover with a 24 mm square coverslip, and observe the staining results using a fluorescence microscope.

[0058] Methicillin-resistant Staphylococcus aureus (MRSA) was inoculated into LB liquid medium and incubated in a constant temperature shaker at 37°C and 220 rpm for 6 h until the bacteria entered the logarithmic growth phase; at this point, the bacterial culture was uniformly turbid, and the OD value was [missing value]. 600 The value was 0.7. The purified target phage was then added to the bacterial culture at a ratio of 1:100, and the culture was continued under the same conditions with shaking for 6 hours. During the culture, the phage sequentially completed host adsorption and genetic material injection, utilized the bacterial metabolic system to replicate its own nucleic acid and proteins, assembled to form progeny phages, and ultimately induced bacterial lysis, causing the bacterial culture to gradually change from turbid to clear. After the culture was completed, the mixture was transferred to centrifuge tubes and centrifuged at 8000 rpm for 15 min to remove unlysed bacterial precipitate; the supernatant was filtered through a 0.22 μm filter membrane to further remove impurities and residual viable bacteria.

[0059] (1.1.2) Preparation of phage-functionalized trapping magnetic beads

[0060] 6.5 g of 1,6-hexanediamine, 2.0 g of anhydrous sodium acetate, and 1.0 g of ferric chloride hexahydrate were mixed in 30 mL of ethylene glycol and stirred at 50 °C until dissolved. The dispersed solution was then transferred to a polytetrafluoroethylene (PTFE) reactor and reacted at 200 °C for 6 hours. After cooling to room temperature, the product was collected using an external magnet and washed with ethanol (3 × 5 mL). Finally, the Fe3O4 nanoparticles were vacuum-dried at 60 °C for subsequent use. The yield was 88.9%. 1.0 mL of purified Staphylococcus aureus phage (2 × 10⁻⁶ g) was then prepared. 10 The test tubes containing 5 mg / mL of PBS were placed in a 70°C oven for 60 minutes to inactivate the PDDA. Then, 2.5 mL of PBS and 1% (w / v) PDDA were added to 500 μL of Fe3O4-NH2 (5 mg / mL) solution, bringing the final volume to 5.0 mL. The reaction was carried out at 1500 rpm for 1 hour. The resulting MB / PDDA was then washed three times with water and added in equal volumes (5.0 mL) to the inactivated PDDA solution from step (1.1.1) at a concentration of 10 mg / mL.15 The phage solution was prepared at PFU / mL and reacted at 150 rpm for 18 hours. The resulting product was then washed three times with water, followed by blocking with 1% (w / v) BSA and reacting at 1500 rpm for 1 hour. Finally, the phage-functionalized trapping beads were washed three times with 5.0 mL of water and stored at 4°C for subsequent use.

[0061] (1.1.3) Preparation of SA-AuNPs-Fc materials

[0062] Take 1 mL of 20 nm gold nanoparticles, add 40 μL of 1.0 mg / mL streptavidin (SA), and gently react at room temperature for 30 min to obtain SA-modified gold nanoparticles via electrostatic adsorption. Add 100 μL of 0.1 M pH 5.5 MES buffer to adjust the pH to 6.0, then add 20 μL of 1 mM ferrocene (Fc-COOH) and mix well. Then add 10 μL of freshly prepared 10 mg / mL LEDC and 10 mg / mL NHS respectively, and covalently couple at room temperature in the dark for 2 h. After the reaction is complete, add 60 μL of 10% BSA to block at room temperature for 30 min, centrifuge at 12000 rpm for 15 min, wash the precipitate 2-3 times with 0.01 M pH 7.4 PBS, resuspend, and prepare the SA-Fc-AuNPs probe, which is stored at 4℃ in the dark.

[0063] (1.2) Characterization of composite probes

[0064] The morphology of the prepared phage-functionalized trapping magnetic beads and MRSA was characterized using scanning electron microscopy (SEM) and transmission electron microscopy (TEM). The results are as follows: Figure 2 As shown: the bacteriophage exhibits clearly defined head and tail fimbriae ( Figure 2 MRSA exhibits typical Gram-positive coccal morphological characteristics. The bacteria are nearly spherical with good individual morphological uniformity. The cell wall structure is intact, and the surface is smooth and plump, without signs of damage such as depressions, perforations, breaks, or leakage of cell contents. The bacterial arrangement is mainly in grape-like clusters. Figure 2 (B) The phage-functionalized magnetic microspheres are generally spherical and well dispersed. A large number of MRSA cells are specifically enriched on the surface of the magnetic beads and in the inter-bead space. Some adjacent magnetic beads form slight cross-links through the bacteria attached to their surfaces, demonstrating the excellent capture and enrichment ability of these functionalized magnetic beads for MRSA. Figure 2 (C). TEM characterization results further verified the binding and distribution of magnetic beads with MRSA. The black shadows on the surface of MRSA represent the magnetic beads bound to it. Figure 2(D). Under a transmission electron microscope, live MRSA bacteria in the logarithmic growth phase maintain an intact cellular ultrastructure. The bacteria are regularly spherical with a clear and smooth outer edge. The cell wall is a thick peptidoglycan structure characteristic of Gram-positive bacteria, with uniform thickness, high and continuous electron density, and no defects, breaks, or peeling. The cell membrane adheres tightly to the inner side of the cell wall, exhibiting a clear phospholipid bilayer structure with intact boundaries and close adhesion to the cell wall. The cytoplasm is full and plump, with a uniform medium electron density. Intracellular granular material is uniformly distributed, without signs of vacuolization, content aggregation, or leakage. A nucleoid region with lower electron density is visible in the central region of the bacteria, with filamentous nucleic acid material diffusely distributed. The nucleoid structure is intact and orderly. Figure 2 (E); The overall spherical outline of the dead MRSA bacteria can be basically maintained, but the intracellular ultrastructure has undergone irreversible degeneration, the internal structure is disordered, large areas of electron-transparent regions appear, and a large amount of cytoplasmic contents leak out through the cell wall damage, leaving only a small amount of intracellular particulate matter. Figure 2 (Middle F).

[0065] Electrochemical results showed that an electrical signal could only be detected at the T line of the test strip when the target drug resistance gene was present in the test solution and the T line was modified with gDNA-functionalized Ago enzyme. Modification of the T line with gDNA or Ago enzyme alone did not produce a significant electrical signal, thus verifying the feasibility of using functionalized Ago enzyme to detect drug resistance genes. Figure 2 (G). Phages were modified onto magnetic beads and subsequently specifically bound to MRSA. A continuous decrease in the zeta potential was observed, due to the negative charge on the phage and MRSA surfaces, confirming the success of the modification and binding. Figure 2 (H).

[0066] Example 2

[0067] Dual-mode quantitative detection of MRSA resistance genes based on composite probes

[0068] (2.1) Preparation of experimental strains and bacterial culture

[0069] The non-target strains used in the experiment, including methicillin-resistant Staphylococcus aureus (MRSA, GDMCC 1.1263), Escherichia coli O157:H7 (GDMCC 1.2702), Salmonella typhimurium (GDMCC 1.3028), and Listeria monocytogenes (GDMCC NO. 1.347), were all purchased from the Guangdong Provincial Microbial Culture Collection Center (GDMCC).

[0070] MRSA strains were inoculated into LB liquid medium and cultured at 37°C with shaking at 200 rpm until the logarithmic growth phase. The bacterial concentration was determined using the plate count method. The MRSA bacterial cultures in the logarithmic phase were then serially diluted with sterile PBS to prepare concentrations of 10¹, 10², 10³, and 10⁻⁶. 4 10 5 10 6 10 7 10 8 MRSA standard bacterial culture at CFU / mL, refrigerated at 4°C for later use.

[0071] (2.2) Assembly of side-flow chromatography test strips

[0072] The lateral flow chromatography test strip used in this embodiment is assembled by sequentially overlapping a sample pad, a conjugate pad, an NC membrane modified with a phage-functionalized capture probe, an absorbent pad, and a PVC backing card. The sample pad and conjugate pad are pretreated by soaking in PBS buffer containing 1% BSA, 2.5% sucrose, and 1% Tween-20 for 30 min, and then dried at 37°C before use. The prepared SAF signal composite probe is uniformly sprayed onto the conjugate pad at a spray volume of 40 μL / cm², and then freeze-dried at -50°C for 2 h before use. The prepared functionalized Ago enzyme at a concentration of 1 μM and streptavidin at a concentration of 1 mg / mL are uniformly sprayed onto the NC membrane using a membrane scrubbing instrument to create T and C lines. The designed RPA amplification primers (SEQ ID NO.2: ATATCAATCTATTAACTGATGGTATGCAACAAGTCG) are uniformly sprayed onto the sample pad at a spray volume of 100 μL / cm². Attach each component to the PVC backing card in sequence, with an overlap width of 2 mm. After assembly, cut the paper into 4 mm wide strips using a strip cutter. After sealing and drying, store at 4°C for later use.

[0073] (2.3) Optimization of detection conditions

[0074] Using the colorimetric signal intensity of the detection line as the evaluation index, the key detection conditions were optimized using a single-factor variable method. The optimal detection conditions were ultimately determined to be: Ago enzyme and gDNA incubation solution Mn. 2+ The concentration is 2mM ( Figure 4 (A); incubation time is 10 min ( Figure 4 (B); the optimal pH is 7 ( Figure 4 (C); The concentration of the functionalized Ago enzyme modified on the T line was 1 μM ( Figure 4 The optimal elution buffer concentration for Ago enzyme expression is 50% (D); Figure 4 (E). Subsequent tests were all conducted under these optimal conditions.

[0075] (2.4) Feasibility verification of the dual-mode detection method

[0076] (2.4.1) Verification of phage capture performance

[0077] The performance of magnetic beads in capturing and lysing drug-resistant bacteria was verified using ATP bioluminescence. Results showed that the magnetic beads began to lyse bacteria approximately 20 minutes after capture, and the lysis of the captured bacteria was essentially complete by 60 minutes. Figure 5 (A). The capture efficiency of functionalized magnetic beads against drug-resistant bacteria first increases and then decreases, reaching a maximum of 98% at 15 minutes. Figure 2 Middle I).

[0078] (2.4.2) Validation of the capture performance of functionalized Ago enzyme complex probe

[0079] The DNA detection function of a capillary electrophoresis apparatus is used to verify whether the Ago enzyme complex probe has been successfully synthesized and whether it has successfully bound to the target drug resistance gene. The total migration rate of DNA in capillary electrophoresis is equal to the sum of its own electrophoretic migration rate and electroosmotic flow rate. The relative deviation of conventional capillary electrophoresis for DNA length determination is generally within 5% to 10%, while the relative deviation for low molecular weight fragments (<100 bp) will be larger, which is within the inherent error range of the method itself.

[0080] The results showed that the Ago enzyme alone, because it cannot be stained by DNA dyes, did not produce a DNA signal peak in the detection range of 20-1000 nt. Figure 3 (A). The main peak of the gDNA is at 33 nt, which is consistent with the designed gDNA length of 25 nt in this protocol. Figure 3 (B). The signal peak of the target drug resistance gene mecA is at 135bp, which corresponds exactly to the length of the mecA gene fragment. Figure 3 (C); while after RPA amplification, mecA, due to the modification of primers with biotin, has an increased relative molecular mass, and the signal peak of mecA (bio) is at 145bp ( Figure 3 Based on this, the results of incubation of Ago enzyme with gDNA showed that the signal peak of Ago (gDNA) was at 212 nt (…). Figure 3 Compared to the gDNA itself, the electrophoretic mobility of the ago (gDNA) decreased significantly, resulting in a peak shift, proving that the designed gDNA single strand was successfully modified onto the ago enzyme. The binding results of ago (gDNA) to the target drug resistance gene produced four peaks at positions of 55, 145, 212, and 357 nt / bp. Figure 3The peak at 55 nt corresponds to free gDNA that has not yet bound to Ago enzyme; the peak at 145 bp corresponds to mecA (bio) after RPA amplification of the target drug resistance gene; the peak at 212 nt corresponds to the remaining Ago (gDNA) that has not bound to the target gene; and the peak at 357 bp corresponds to the peak where Ago (gDNA) has bound to the target gene mecA, proving the successful binding of Ago (gDNA) to the target gene. In addition, the biotin-modified primer F (bio) was also characterized using capillary electrophoresis, and the results showed a peak at 24 nt (…). Figure 3 (G), then streptavidin was added to the F (bio) solution, and the results showed a peak at 246 nt, and the primer peak at 24 nt was significantly lower than that of the original solution. Figure 3 (H), which is due to the specific binding of streptavidin to biotin on the primer, verifying that biotin was successfully modified on the primer.

[0081] By replacing the DNA clips in the capillary electrophoresis apparatus with protein clips, the Ago enzyme was further characterized. The results showed that the molecular weight of the protein was 100 kDa, consistent with the results of protein gel electrophoresis.

[0082] (2.4.3) Verification of the specificity and stability of the detection system

[0083] Specificity tests were performed using five non-target pathogens (Salmonella typhimurium, ST; Klebsiella pneumoniae, KP; Pseudomonas aeruginosa, PA; Escherichia coli, EC (E. coli)), and the results are as follows: Figure 5 China B and Figure 5 As shown in Figure F: only the test strip for MRSA samples showed obvious visible bands and colorimetric signals, while no bands or colorimetric signals were observed for the other non-target strains and the blank control group, confirming that the detection system of the present invention has extremely high specificity for MRSA.

[0084] The test strips were subjected to homogeneity testing between different batches and between different groups of the same batch. The results are as follows: Figure 5 As shown in G, the test strip exhibits good homogeneity. The test results at different times also demonstrate that the test strip has good stability. Figure 5 H.

[0085] (2.4.4) Dual-mode quantitative detection of drug resistance genes and establishment of standard curve

[0086] Take MRSA standard bacterial solutions of different concentrations (0-10) 7After enrichment and lysis by phage-functionalized magnetic beads, the assembled test strip was inserted into the slot of the device housing. The heating pad at the bottom of the device was then activated to reach 37°C. The supernatant was then dripped onto the sample pad of the test strip through the sample application port on the device housing. The chromatography reaction was carried out under optimal conditions for 15 min. After the reaction was completed, signal acquisition and quantitative detection were performed using both colorimetric and electrochemical modes. Colorimetric mode detection: Under uniform illumination, images of the test strip are captured using a smartphone. ImageJ software is used to measure the grayscale values ​​of the test line (T line) and the control line (C line). The corrected grayscale value (T / C value) is used as the quantitative signal. The results are as follows: Figure 5 China A Figure 5 As shown in C. The limit of detection (LOD) for total MRSA in the colorimetric mode is 10. 2 CFU / mL, linear detection range is 10 2 ~10 7 CFU / mL, the linear regression equation is: gray value = 3051.07 lg x -5985.71, correlation coefficient R²=0.997.

[0087] Electrochemical mode detection: 300 μL of saturated KCl electrolyte solution was added to the screen-printed electrode of the prepared portable electrochemical workstation. The test strip was pulled out of the device casing with the T-line inverted onto the working electrode. Differential pulse voltammetry (DPV) was performed using the portable electrochemical workstation. The test parameters were: potential range 0.6 V~0.1 V, scan rate 50 mV / s, pulse amplitude 0.05 V, deposition time 15 s. The detection signal was transmitted to a smartphone in real time via a Wi-Fi module. The results are as follows: Figure 6 As shown in Figure D, the LogCMRSA values ​​from bottom to top are 0, 1, 2, 3, 4, 5, 6, and 7, respectively, with the electrochemical gradient corresponding to different concentrations increasing accordingly. The detection limit for viable bacterial MRSA in electrochemical mode is 10 CFU / mL, and the linear detection range is 10–10⁻⁶ CFU / mL. 7 CFU / mL, the linear regression equation is: peak current value (μA) = 2.37lg x +3.31, correlation coefficient R 2 = 0.997 ( Figure 6 (E).

[0088] Both detection modes showed good linear correlation and could accurately quantify the MRSA resistance gene mecA. The entire detection process could be completed within 70 minutes without the need for large precision instruments, making it suitable for on-site real-time detection needs.

[0089] Example 3

[0090] Actual sample testing and methodological performance validation

[0091] (3.1) Pretreatment of actual samples

[0092] Five actual samples were selected: commercially available cakes, milk, orange juice, pork, and river water samples taken on-site. All samples were purchased from local markets in Guangzhou and collected from the surrounding environment. The sample pretreatment methods are as follows: Liquid samples (milk, orange juice, river water): Take 20 mL of liquid sample and filter it through 50 μm Whatman filter paper to remove large particulate impurities; the milk sample is diluted 10 times with sterile PBS before use; the orange juice sample is adjusted to pH 7.0 with 1 M NaOH solution before use; the drinking water and sewage samples are filtered directly before use.

[0093] Solid samples (cake, pork): Take 20 g of homogenized solid sample, add 100 mL of sterile PBS, shake at 500 rpm for 10 min at room temperature, filter through double gauze to remove solid residue, centrifuge the filtrate at 5000 rpm for 3 min, and take the supernatant for use.

[0094] Meanwhile, some pork and milk samples were left at room temperature for 48 hours to prepare spoiled samples for actual contamination detection and verification.

[0095] (3.2) Spike recovery experiment of actual sample

[0096] Background values ​​were measured on the actual samples after the above pretreatment to confirm the absence of MRSA background contamination. Then, a final concentration of 10 was added to each sample. 2 CFU / mL, 10 4 MRSA standard bacterial suspensions at CFU / mL were used for spiked recovery experiments. Three replicates were prepared for each spike concentration. The dual-mode detection method established in this invention was used for determination, while the traditional plate count method was used as a standard control. Spike recoveries and relative standard deviations (RSDs) were calculated.

[0097] The results (Table 1) show that the spiked recoveries of the method of the present invention for the five actual samples were 91.7%–111%, and the relative standard deviations (RSD) of the colorimetric modes were all less than 20% (with slight fluctuations due to paper-based sensing). Specifically, the colorimetric recovery rate for cake samples was 100%–101%, and the electrochemical recovery rate was 98.0%–100%; the colorimetric recovery rate for milk samples was 92.0%–97.7%, and the electrochemical recovery rate was 97.0%–98.6%; the colorimetric recovery rate for orange juice samples was 94.0%–95.1%, and the electrochemical recovery rate was 96.0%–96.5%; the colorimetric recovery rate for pork samples was 101%–111%, and the electrochemical recovery rate was 100%–105%; and the colorimetric recovery rate for river water samples was 91.7%–98.7%, and the electrochemical recovery rate was 99.2%–99.7%, which fully meets the recovery rate requirements (80%–120%) for food microbiological testing.

[0098] Table 1 Measurement Results

[0099] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A composite probe for detecting drug resistance genes in drug-resistant bacteria, characterized in that, The composite probe includes an Ago enzyme-functionalized capture probe and a SAF signaling composite probe. The Ago enzyme-functionalized capture probe contains an Ago enzyme and a base-complementary strand targeting the drug resistance gene of drug-resistant bacteria. The SAF signal composite probe contains streptavidin, gold nanoparticles, and ferrocene.

2. The composite probe according to claim 1, characterized in that, The drug-resistant bacteria are methicillin-resistant Staphylococcus aureus.

3. The composite probe according to claim 2, characterized in that, The complementary base sequence of the drug resistance gene is shown in SEQ ID NO.

1.

4. The composite probe according to claim 1, characterized in that, The method for preparing the SAF signal composite probe includes the following steps: 1) Mix 0.5-2 mL of gold nanoparticles with 30-50 μL of streptavidin at a concentration of 0.5-2.0 mg / mL for 15-60 min to obtain SA-modified gold nanoparticles; 2) Mix SA-modified gold nanoparticles with 80-120 μL of buffer solution, adjust the pH to 5.5-6.5, and then mix with 10-30 μL of 0.5-2 mM ferrocene carboxylic acid to obtain a mixed solution; 3) Mix the mixture with 5~15μL of EDC / NHS working solution, covalently couple it in the dark for 1~3 h, block it for 15~60 min, centrifuge at 10000~15000 rpm for 10~30 min, wash, resuspend, and obtain the SAF signal composite probe. The EDC / NHS working solution comprises 5~15 mg / mL EDC and 5~15 mg / mL NHS.

5. The composite probe according to claim 4, characterized in that, Step 3) The sealing agent used in the sealing is 40~80μL of 5%~15% BSA.

6. A test strip comprising the composite probe according to any one of claims 1 to 5, characterized in that, The test strip is a side-flow chromatography test strip; The side-flow chromatography test strip includes a sample pad, a conjugate pad, a nitrocellulose membrane, an absorbent pad, and a PVC backing card; The Ago enzyme-functionalized capture probe is immobilized on the detection line of the nitrocellulose membrane, and the control line is coated with streptavidin; the SAF signal composite probe is immobilized on the binding pad; and biotin-containing primers designed for RPA amplification of the target drug resistance gene are immobilized on the sample pad.

7. The use of the composite probe according to any one of claims 1 to 5 or the test strip according to claim 6 in the preparation of products for detecting drug-resistant bacteria.

8. The application according to claim 7, characterized in that, The product also includes phage-functionalized capture magnetic beads; The phage-functionalized capture magnetic beads are made by amylating iron oxide and linking it to an inactivated phage.

9. The application according to claim 8, characterized in that, The inactivated bacteriophage includes Staphylococcus aureus bacteriophage.

10. The application according to claim 9, characterized in that, The concentration of the Ago enzyme-functionalized capture probe in the product is 0.8~1.2 mg / mL; The concentration of the SAF signal composite probe is 0.8~1.2 mg / mL.

Images