A soybean height response density-related snp molecular marker and application thereof

Abstract

The present application relates to the technical field of molecular genetic breeding, and particularly relates to a SNP molecular marker related to soybean plant height response density and application thereof. The present application provides five SNP sites significantly associated with soybean plant height response density, and develops corresponding KASP molecular markers and primers based on each SNP site. The KASP primers of the present application are used for PCR amplification and genotyping of the soybean to be tested, so as to quickly identify the genotype of soybean plant height response density, and thus to screen out soybean varieties resistant to dense planting. The present application provides molecular assisted selection technology support for early identification and screening of soybean dense planting germplasm, improves the accuracy and efficiency of screening of soybean dense planting germplasm, helps to speed up the breeding process of soybean dense planting varieties, and has a wide application prospect.

Description

Technical Field

[0001] This invention relates to the field of molecular genetic breeding technology, and in particular to a SNP molecular marker related to soybean plant height response density and its application. Background Technology

[0002] Soybeans are an important global oilseed crop, protein source, and industrial raw material. Increasing soybean planting density is the core way to increase yield per unit area and ensure food and oil security, and breeding soybean varieties that are tolerant to dense planting is the key to achieving increased yield through dense planting.

[0003] Soybean tolerance to high-density planting is a complex quantitative trait controlled by multiple genes. Plant height response to high-density planting is a core indicator for measuring soybean tolerance. Soybean varieties tolerant to high-density planting show minimal changes in plant height under such conditions, are less prone to excessive growth and lodging, while varieties sensitive to high-density planting exhibit abnormally high plant height under these conditions, leading to dense canopy cover and reduced lodging resistance. Traditional breeding methods for soybean tolerance to high-density planting rely on field phenotypic selection, requiring multi-year, multi-location trials under different density conditions. This is not only time-consuming and labor-intensive with a long breeding cycle, but also susceptible to interference from environmental conditions and cultivation management, resulting in low selection accuracy and failing to meet the need for rapid development of soybean varieties tolerant to high-density planting.

[0004] Molecular marker-assisted breeding technology has become an important tool in crop breeding due to its advantages of early selection, independence from environmental influences, accuracy, and high efficiency. Kompetitive Allele-Specific PCR (KASP) molecular markers are a novel SNP genotyping technology based on allele-specific amplification and high-sensitivity fluorescence detection. It designs two upstream specific primers with different fluorescent linkers and one universal downstream primer for each SNP site. Accurate identification of SNP sites is achieved through genotyping based on the fluorescence signal after PCR amplification. It features high throughput, low cost, ease of operation, and high genotyping accuracy, and has been widely applied in molecular breeding of various crops.

[0005] Genome-wide association analysis (GWAS) is an effective tool for identifying genes and SNPs associated with complex traits, enabling rapid and accurate location of SNPs related to soybean plant height response density. Based on significantly associated SNPs identified through GWAS, KASP markers were developed and applied to early (low-generation) screening in soybean high-density planting breeding. This effectively reduces breeding workload, accelerates breeding progress, and significantly improves breeding efficiency.

[0006] Currently, there are few reported molecular markers related to soybean dense planting tolerance, and most of them target single traits. There is a lack of KASP markers that are directly associated with plant height and dense planting response, have good genotyping effects, and can be applied on a large scale. Therefore, it is of great significance to discover SNP sites that are significantly associated with soybean plant height response density and to develop corresponding KASP markers. Summary of the Invention

[0007] To address the aforementioned technical challenges, this invention provides a SNP molecular marker related to soybean plant height response density (soybean high-density planting tolerance). The SNP molecular marker is at least one of SNP sites 1 to 5. Specifically, SNP site 1 (qPDGR5.1) is located at 1096073 bp on chromosome 5 of the soybean genome, with a polymorphism of C / G; SNP site 2 (qPDGR18.2) is located at 4285387 bp on chromosome 18 of the soybean genome, with a polymorphism of G / A; SNP site 3 (qPDGR19.1) is located at 46728040 bp on chromosome 19 of the soybean genome, with a polymorphism of T / A; SNP site 4 (qPDGR3.2) is located at 45206037 bp on chromosome 3 of the soybean genome, with a polymorphism of A / G; and SNP site 5 (qPDGR4.1) is located at 42154075 bp on chromosome 4 of the soybean genome, with a polymorphism of T / C. The version number of the soybean genome is Glycine max Wm82.a2.v1.

[0008] Among them, the C genotype in SNP locus 1 is the superior allele, and soybean varieties carrying this genotype show less variation in plant height under dense planting conditions, with significantly better tolerance to dense planting than the G genotype; the G genotype in SNP locus 2 is the superior allele, and soybean varieties carrying this genotype have significantly better tolerance to dense planting than the A genotype; the A genotype in SNP locus 3 is the superior allele, and soybean varieties carrying this genotype have significantly better tolerance to dense planting than the T genotype; the G genotype in SNP locus 4 is the superior allele, and soybean varieties carrying this genotype have significantly better tolerance to dense planting than the A genotype; the C genotype in SNP locus 5 is the superior allele, and soybean varieties carrying this genotype have significantly better tolerance to dense planting than the T genotype.

[0009] In some implementation schemes, soybeans carrying at least one of the following genotypes are classified as high-density-tolerant soybeans: soybeans carrying at least one of the following genotypes: SNP locus 1C, SNP locus 2G, SNP locus 3A, SNP locus 4G, and SNP locus 5C. Soybeans carrying at least one of the following genotypes are classified as low-density-tolerant soybeans.

[0010] In the specific implementation process, when the genotype of SNP locus 1 is CC, the genotype of SNP locus 2 is GG, the genotype of SNP locus 3 is AA, the genotype of SNP locus 4 is GG, or the genotype of SNP locus 5 is CC, the soybean variety is determined to have the characteristic of dense planting. Alternatively, if the genotype of SNP locus 1 is GG, the genotype of SNP locus 2 is AA, the genotype of SNP locus 3 is TT, the genotype of SNP locus 4 is AA, or the genotype of SNP locus 5 is TT, then the soybean variety is determined to have weak tolerance to dense planting.

[0011] In some embodiments, SNP site 1 is located at position 81 of the sequence shown in SEQ ID No. 1; SNP site 2 is located at position 81 of the sequence shown in SEQ ID No. 2; SNP site 3 is located at position 81 of the sequence shown in SEQ ID No. 3; SNP site 4 is located at position 51 of the sequence shown in SEQ ID No. 4; and SNP site 5 is located at position 54 of the sequence shown in SEQ ID No. 5.

[0012] SEQ ID No. 1: TCTTGAATTTTCTCAATTAATGTGTTTGGTAATACTTGAAGCTTCATTTTCCCTGTAATCTCAGTTATTTGTTTAAATCAGCCTTGTTCAATTTTTAAAAATTCAGTTTTGGTCCATCATTAAACTAGGAAGAATGGACGCATGAAAGTATTCATCATACCCATGTCAGACACATTCCCTTATTAAAGCACAAACGGACACTTGGATACT SEQ ID No. 2: CACAGGCATAGAATTCCGCCTGCTGAATTTGATGCCTGCTTGTGCTTCCCAACTGACTTCAGAATCCCCCCATAGTGCTTGACACATGGATTTGTCTATAGCCTCCTTTTTTGTCTCTTGTATGCATATCATGTCTATACGCTGTTTGTTGACCAATCTTCTGATTGCTGGCCACTTGATCCCCCTCCCTAACCCTCGGACATTGTATGTTA SEQ ID No. 3: ACACAACATAAAATATCGTTTTCAGATCAGGGTGGCCCACTTAATGGTGATTTATTGTCGCAACTCCGATCTCTCATCTCAGACTCCACAAATTTGTTCTAAAACTACTTACGATACAGCCACGGTGCCACCGGTTGCGGGATCATCTCACAACCAACCACACATAGTGATTCTCATCAACAC SEQ ID No.4: TCCGCTGCGTAAAATTTGTATTTAGCCACTCTACGCCTTCTCTTTCTTTCGGCCTCATTCCACCGCCAAGTGTTCTTTGGCTTGGTCACTGCCATTTGTGGGCCATAACATTCTCGAGATGATGCTAATTCATTGGAATACAAAGCTGATGGAGGAGTAGTGGTTGCTCCTGGCAACCCACATGCACATTTTGTTGTTGTTG SEQ ID No. 5: GGATTGACTTAACCAAACTCAAATTCAAGATTTTATCAAAGTCTACCTAACCCCAAGGCTTTCCCAATGCAATCTACCATGCCCTACTCGACAATGCAATAAAAAAATCAATTGTACAACTTCCACACTTAGTTGTCCAATCCAAGGCATGCAGGAGGTGTTGATTTCTCACGTTGTCTATATATTCATATAGCCAAAGTACAA Furthermore, the present invention provides primers for amplifying the SNP molecular marker.

[0013] Preferably, the primers are KASP-specific primers.

[0014] Preferably, the KASP-specific primers include at least one primer sequence shown in SEQ ID No. 6 to SEQ ID No. 8, SEQ ID No. 9 to SEQ ID No. 11, SEQ ID No. 12 to SEQ ID No. 14, SEQ ID No. 15 to SEQ ID No. 17, and SEQ ID No. 18 to SEQ ID No. 20.

[0015] Each SNP site's KASP-specific primers consist of two upstream-specific primers (F1, F2) and one universal downstream primer (R). The 3' ends of the two upstream-specific primers are allelic variants, and the 5' ends are connected to the FAM (carboxyfluorescein) and HEX (hexachlorofluorescein aminophosphate) fluorescent linker sequences that are compatible with the KASP reaction system, respectively.

[0016] Among them, the KASP-specific primers for SNP site 1 include SEQ ID No. 6 to SEQ ID No. 8; The upstream primer F1 has the following nucleotide sequence as shown in SEQ ID NO.6: 5'- GAAGGTGACCAAGTTCATGCTTCCCTGTAATCTCAGTTATTTGTTTTAAATCAG -3'; The upstream primer F2 has the following nucleotide sequence as shown in SEQ ID NO.7: 5'-GAAGGTCGGAGTCAACGGATTTCCCTGTAATCTCAGTTATTTGTTTAAATCAC -3'; The downstream primer R has the following nucleotide sequence as shown in SEQ ID NO.8: 5'- TCATGCGTCCATTCTTCCTAGT -3'; Among them, the KASP-specific primers for SNP site 2 include SEQ ID No. 9 to SEQ ID No. 11; The upstream primer F1 has the following nucleotide sequence as shown in SEQ ID NO.9: 5'- GAAGGTGACCAAGTTCATGCTGAATCCCCCCATAGTGCTTGA -3'; The upstream primer F2 has the following nucleotide sequence as shown in SEQ ID NO.10: 5'-GAAGGTCGGAGTCAACGGATTGAATCCCCCCATAGTGCTTGG -3'; The downstream primer R has the following nucleotide sequence as shown in SEQ ID NO.11: 5'- AAGATTGGTCAACAAACAGCGTAT -3'; Among them, the KASP-specific primers for SNP site 3 include SEQ ID No. 12 to SEQ ID No. 14; The upstream primer F1 has the following nucleotide sequence as shown in SEQ ID NO.12: 5'- GAAGGTGACCAAGTTCATGCTCGCAACTCCGATCTCTCATCTCA -3'; The upstream primer F2 has the following nucleotide sequence as shown in SEQ ID NO.13: 5'-GAAGGTCGGAGTCAACGGATTCGCAACTCCGATCTCTCATCTCT -3'; The downstream primer R has the following nucleotide sequence as shown in SEQ ID NO.14: 5'-GCACCGTGGCTGTATCGTAAGTA -3'; Among them, the KASP-specific primers for SNP site 4 include SEQ ID No. 15 to SEQ ID No. 17; The upstream primer F1 has the following nucleotide sequence as shown in SEQ ID NO.15: 5'- GAAGGTGACCAAGTTCATGCTACTCTACGCCTTCTCTTTCTTTCG -3'; The upstream primer F2 has the following nucleotide sequence as shown in SEQ ID NO.16: 5'-GAAGGTCGGAGTCAACGGATTACTCTACGCCTTCTCTTTCTTTCA -3'; The downstream primer R has the following nucleotide sequence as shown in SEQ ID NO.17: 5'- CACTACTCCTCCATCAGCTTTGTA -3'; Among them, the KASP-specific primers for SNP site 5 include SEQ ID No. 18 to SEQ ID No. 20; The upstream primer F1 has the following nucleotide sequence as shown in SEQ ID NO.18: 5'- GAAGGTGACCAAGTTCATGCTCAAGATTTTATCAAAGTCTACCTAACCCC -3'; The upstream primer F2 has the following nucleotide sequence as shown in SEQ ID NO.19: 5'- GAAGGTCGGAGTCAACGGATTCAAGATTTTATCAAAGTCTACCTAACCCT -3'; The downstream primer R has the following nucleotide sequence as shown in SEQ ID NO.20: 5'-GGATTGGACAACTAAGTGTGGAAG-3'.

[0017] Furthermore, the present invention provides reagents or kits for detecting the dense planting tolerance characteristics of soybeans, including the primers described above.

[0018] Preferably, the kit is a PCR kit.

[0019] Preferably, the kit further includes at least one of the following: PCR amplification buffer, dNTPs, Taq DNA polymerase, and ultrapure water.

[0020] The kit of this invention can be directly used for KASP genotyping of soybean samples, is easy to operate, and is suitable for large-scale sample detection.

[0021] Furthermore, the present invention provides the application of the SNP molecular marker, the primer, the reagent or kit in at least one of the following aspects: (1) Identify or assist in screening soybean varieties tolerant to high-density planting; (2) Genetic breeding of soybean dense planting trait.

[0022] In some implementations, the steps of the application include: extracting genomic DNA from the soybean sample to be tested, detecting the genotype of at least one SNP site among SNP sites 1 to SNP sites 5, and determining whether the soybean variety has the characteristic of being tolerant to dense planting.

[0023] In some implementation schemes, the genotypes of SNP loci 1 to SNP loci 5 are detected simultaneously to determine whether soybean varieties have the characteristic of being tolerant to dense planting.

[0024] The accuracy is higher when all five SNP loci are used to determine dense planting tolerance.

[0025] When determining the tolerance to dense planting characteristics using five SNP loci, if the genotype of SNP locus 1 is CC, the genotype of SNP locus 2 is GG, the genotype of SNP locus 3 is AA, the genotype of SNP locus 4 is GG, and the genotype of SNP locus 5 is CC, then the soybean variety is determined to have the tolerance to dense planting characteristics.

[0026] In some implementations, the steps of the application include: using the genomic DNA of the soybean sample to be tested as a template, performing PCR amplification with the primers shown in SEQ ID No. 6 to SEQ ID No. 20, performing KASP genotyping on the PCR amplification products to obtain the genotypes of SNP sites 1 to 5, and determining whether the soybean variety has the characteristic of being tolerant to dense planting.

[0027] In some implementations, the application further includes determining whether a soybean variety has the characteristic of being tolerant to dense planting, according to the above-described determination method.

[0028] In some implementations, the soybean sample is preferably a young leaf.

[0029] Preferably, the PCR amplification reaction system is as follows: 2 μL DNA template, 0.14 μL primer premix, 5 μL 2×KASP main solution, and 3 μL DD water.

[0030] Preferably, the PCR amplification reaction program is as follows: 95℃ pre-denaturation for 15 min, 1 cycle; 95℃ denaturation for 10 s, 65℃ annealing for 60 s, with the annealing temperature decreasing by 1℃ per cycle, 10 cycles; 95℃ denaturation for 10 s, 57℃ annealing for 60 s, 30 cycles; 30℃ plate reading for 30 s, 1 cycle.

[0031] Preferably, the step of KASP genotyping detection of PCR amplification products includes: reading fluorescence signals using a real-time PCR instrument, and determining the base type of each SNP site based on the fluorescence signal type: if a FAM fluorescence signal is detected, the corresponding site is the first allele (SNP site 1 is G, SNP site 2 is A, SNP site 3 is A, SNP site 4 is G and SNP site 5 is C); if a HEX fluorescence signal is detected, the corresponding site is the second allele (SNP site 1 is C, SNP site 2 is G, SNP site 3 is T, SNP site 4 is A and SNP site 5 is T).

[0032] Preferably, the step of determining whether a soybean variety is tolerant to high-density planting based on the genotyping results includes: soybeans carrying at least one genotype from SNP locus 1C, SNP locus 2G, SNP locus 3A, SNP locus 4G, and SNP locus 5C are tolerant to high-density planting soybeans; soybeans carrying at least one genotype from SNP locus 1G, SNP locus 2A, SNP locus 3T, SNP locus 4A, and SNP locus 5T are not tolerant to high-density planting soybeans (with weaker high-density planting characteristics).

[0033] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention provides SNP loci significantly associated with soybean plant height response density and develops corresponding KASP molecular markers and primers based on each SNP locus. Using the KASP primers of this invention for PCR amplification and genotyping of soybean samples, the genotype of soybean plant height response density can be rapidly identified, thereby screening for soybean varieties tolerant to high-density planting. This invention provides molecular-assisted selection technology support for the early identification and screening of soybean germplasm tolerant to high-density planting, improving the accuracy and efficiency of screening for such germplasm, and helping to accelerate the breeding process of soybean varieties tolerant to high-density planting, thus having broad application prospects.

[0034] Specifically: 1. The five SNP loci identified in this invention are all significantly associated with soybean plant height response density and have clear superior alleles, which can directly reflect the dense planting tolerance of soybean and provide precise molecular targets for molecular breeding of soybean dense planting tolerance. The SNP loci are derived from whole genome resequencing and GWAS analysis of 253 soybean germplasms, with strong population representativeness and high practicality and reliability of the markers.

[0035] 2. The KASP-specific primers developed in this invention are designed for allelic variations at each SNP site, exhibiting high specificity, high PCR amplification efficiency, and clear genotyping results. They can quickly and accurately distinguish between different allelic genotypes, with a genotyping error rate of only 0.7% to 1.6%, lower than that of gene chip technology. Furthermore, they do not require electrophoresis detection and are easy to operate.

[0036] 3. The KASP marker of the present invention has the advantages of high throughput and low cost. It can be detected by a conventional real-time PCR instrument. The cost of single sample detection is 1 / 5 to 1 / 10 of that of sequencing method. It can realize rapid screening of soybean germplasm on a large scale and is suitable for batch application in breeding practice.

[0037] 4. The SNP sites, KASP markers and kits of the present invention can be applied to the early low-generation screening of soybean dense planting tolerant breeding. The identification of dense planting tolerant germplasm can be completed at the soybean seedling stage, without the need for multi-year and multi-location field phenotypic trials, effectively reducing the breeding workload, shortening the breeding cycle, and significantly improving the breeding efficiency of soybean dense planting tolerant varieties.

[0038] 5. The correlation coefficient (r) between the KASP marker of this invention and the soybean plant height response density. 2 All are ≥ 0.25, where r of qPDGR5.1 2 = 0.46, qPDGR18.2 of r 2 = 0.50, qPDGR19.1 of r 2 = 0.60, qPDGR3.2 of r 2 =0.45, qPDGR4.1 of r 2 = 0.52, indicating a high correlation between the marker and the dense planting phenotype, accurate screening results, and the ability to significantly improve the accuracy of dense planting tolerant soybean germplasm selection. Attached Figure Description

[0039] Figure 1 This is a graph showing the results of principal component analysis and kinship matrix analysis.

[0040] Figure 2 This is a graph showing the association between SNP locus genotypes and soybean plant height and density response.

[0041] Figure 3This is a genotyping result diagram of the KASP marker qPDGR5.1. Red dots represent the C genotype, blue dots represent the G genotype, and green dots represent the CG heterozygous genotype.

[0042] Figure 4 This is a genotyping result diagram of the KASP marker qPDGR18.2. Red dots represent the G genotype, and blue dots represent the A genotype.

[0043] Figure 5 This is a genotyping result diagram of the KASP marker qPDGR19.1. Red dots represent the T genotype, and blue dots represent the A genotype.

[0044] Figure 6 This is a genotyping result diagram of the KASP marker qPDGR3.2. Red dots represent genotype A, blue dots represent genotype G, and green dots represent heterozygous genotype AG.

[0045] Figure 7 This is a genotyping result diagram of the KASP marker qPDGR4.1. Red dots represent the T genotype, blue dots represent the C genotype, and green dots represent the CT heterozygous genotype. Detailed Implementation

[0046] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0047] In the embodiments provided in this specification, unless specific techniques or conditions are specified, the techniques or conditions described in the literature in this field, or the product instructions, shall be followed. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased from legitimate channels.

[0048] This invention relates to molecular biology experiments. Unless otherwise specified, reference can be made to the book *Molecular Cloning* (J. Sambrook, E.F. Fritsch, and T. Maniatis, Science Press, 1994). This book and its subsequent editions are the most commonly used and guiding reference books for those skilled in the art when performing experiments related to molecular biology. In addition, depending on the experimental purpose, those skilled in the art may conduct corresponding experiments under the guidance of the operating manuals accompanying various commercially available kits or entrust them to specialized companies, such as primer synthesis.

[0049] Example 1: Identification of SNP sites significantly associated with soybean plant height response density 1. Experimental materials: A natural population of 253 soybean germplasm accessions, mainly from the Huang-Huai-Hai and Northeast China soybean ecological regions.

[0050] 2. Phenotypic determination: 253 soybean germplasm accessions were planted at a conventional density (200,000 plants / hm²). 2 ) and high density (400,000 plants / hm) 2 Under normal field management conditions, soybean plant height was measured at maturity, and the plant height response value (the ratio of densely planted plant height to conventionally planted plant height) was calculated.

[0051] 3. Whole genome resequencing: Young leaves of soybean at stage V4 were collected, and genomic DNA was extracted using the CTAB method. Whole genome SNP microarray detection was performed, with the reference genome being Glycine_max_ZH13_V2. A total of 40,367 high-quality SNP markers were obtained. The markers were evenly distributed on the 20 soybean chromosomes, with an average marker spacing of about 28 kb.

[0052] 4. GWAS Analysis: A mixed linear model from the GAPIT 3.4 software package was used, integrating principal component analysis (PCA) and kinship matrix analysis to correct for the effects of population structure and kinship. Figure 1 The significance threshold was determined through 1000 permutation tests. P ≤ 9.0×10 -3 ), and visualize the associated signals; Manhattan plots and QQ plots were drawn using CMplot 4.5.1 to present the GWAS results, and SNP sites that were significantly associated with soybean plant height response density were screened out ( Figure 2 ).

[0053] 5. Results: Five SNP loci significantly associated with soybean plant height response density were identified, namely 1096073 bp (C / G) on chromosome 5, 4285387 bp (G / A) on chromosome 18, 46728040 bp (T / A) on chromosome 19, 45206037 bp (G / A) on chromosome 3, and 42154075 bp (T / C) on chromosome 4. The superior alleles for each locus were C, G, A, G, and C, respectively. Soybean varieties carrying the superior alleles showed significantly lower plant height response values ​​and stronger tolerance to dense planting.

[0054] Example 2: Development and Synthesis of KASP-Specific Primer Sets 1. Primer design: Based on the five SNP sites and their upstream and downstream nucleotide sequences obtained in Example 1, KASP-specific primers were designed using the NCBI Primer-BLAST online tool. Each primer set contains two upstream specific primers (F1, F2) and one universal downstream primer (R). The 3' ends of the two upstream primers are allelic variant bases, and the 5' ends are connected to FAM and HEX fluorescent adapter sequences, respectively.

[0055] Among them, the KASP-specific primers for SNP site 1 include SEQ ID No. 6 to SEQ ID No. 8; The upstream primer F1 has the following nucleotide sequence as shown in SEQ ID NO.6: 5'- GAAGGTGACCAAGTTCATGCTTCCCTGTAATCTCAGTTATTTGTTTTAAATCAG -3'; The upstream primer F2 has the following nucleotide sequence as shown in SEQ ID NO.7: 5'-GAAGGTCGGAGTCAACGGATTTCCCTGTAATCTCAGTTATTTGTTTAAATCAC -3'; The downstream primer R has the following nucleotide sequence as shown in SEQ ID NO.8: 5'- TCATGCGTCCATTCTTCCTAGT -3'; Among them, the KASP-specific primers for SNP site 2 include SEQ ID No. 9 to SEQ ID No. 11; The upstream primer F1 has the following nucleotide sequence as shown in SEQ ID NO.9: 5'- GAAGGTGACCAAGTTCATGCTGAATCCCCCCATAGTGCTTGA -3'; The upstream primer F2 has the following nucleotide sequence as shown in SEQ ID NO.10: 5'-GAAGGTCGGAGTCAACGGATTGAATCCCCCCATAGTGCTTGG -3'; The downstream primer R has the following nucleotide sequence as shown in SEQ ID NO.11: 5'- AAGATTGGTCAACAAACAGCGTAT -3'; Among them, the KASP-specific primers for SNP site 3 include SEQ ID No. 12 to SEQ ID No. 14; The upstream primer F1 has the following nucleotide sequence as shown in SEQ ID NO.12: 5'- GAAGGTGACCAAGTTCATGCTCGCAACTCCGATCTCTCATCTCA -3'; The upstream primer F2 has the following nucleotide sequence as shown in SEQ ID NO.13: 5'-GAAGGTCGGAGTCAACGGATTCGCAACTCCGATCTCTCATCTCT -3'; The downstream primer R has the following nucleotide sequence as shown in SEQ ID NO.14: 5'-GCACCGTGGCTGTATCGTAAGTA -3'; Among them, the KASP-specific primers for SNP site 4 include SEQ ID No. 15 to SEQ ID No. 17; The upstream primer F1 has the following nucleotide sequence as shown in SEQ ID NO.15: 5'- GAAGGTGACCAAGTTCATGCTACTCTACGCCTTCTCTTTCTTTCG -3'; The upstream primer F2 has the following nucleotide sequence as shown in SEQ ID NO.16: 5'-GAAGGTCGGAGTCAACGGATTACTCTACGCCTTCTCTTTCTTTCA -3'; The downstream primer R has the following nucleotide sequence as shown in SEQ ID NO.17: 5'- CACTACTCCTCCATCAGCTTTGTA -3'; Among them, the KASP-specific primers for SNP site 5 include SEQ ID No. 18 to SEQ ID No. 20; The upstream primer F1 has the following nucleotide sequence as shown in SEQ ID NO.18: 5'- GAAGGTGACCAAGTTCATGCTCAAGATTTTATCAAAGTCTACCTAACCCC -3'; The upstream primer F2 has the following nucleotide sequence as shown in SEQ ID NO.19: 5'- GAAGGTCGGAGTCAACGGATTCAAGATTTTATCAAAGTCTACCTAACCCT -3'; The downstream primer R has the following nucleotide sequence as shown in SEQ ID NO.20: 5'-GGATTGGACAACTAAGTGTGGAAG-3'.

[0056] 2. Primer synthesis: The designed primer sequences were synthesized by a biotechnology company. The synthesized primers were purified by PAGE and prepared into a 10 μmol / L stock solution, which was stored at -20℃ for later use.

[0057] Example 3: Validation and Application of KASP Markers 1. Experimental materials: 92 soybean germplasms, different from those in Example 1, including dense-planting tolerant germplasms and dense-planting sensitive germplasms.

[0058] 2. Genomic DNA extraction: Genomic DNA was extracted from the young leaves of 92 soybean germplasms using the CTAB method. The DNA concentration and purity were determined using an ultra-micro nucleic acid and protein detector. The DNA concentration was adjusted to 50 ng / μL and stored at -20℃.

[0059] 3. KASP PCR Amplification: PCR amplification was performed using the KASP primer set from Example 2. The reaction system consisted of: 2 μL DNA template, 0.14 μL primer premix (F1:F2:R=1:1:3), 5 μL 2×KASP main solution, and 3 μL DD water. The reaction program was as follows: 95℃ pre-denaturation for 15 min; 95℃ denaturation for 10 s, 65℃ annealing for 60 s, 10 cycles (annealing temperature decreased by 1℃ per cycle); 95℃ denaturation for 10 s, 57℃ annealing for 60 s, 30 cycles; 30℃ plate reading for 30 s. A blank control was set up using ultrapure water instead of DNA template.

[0060] 4. Genotyping: Using QuantStudio™ 5 The fluorescence signal is read by a real-time PCR instrument, and the genotype is determined by the fluorescence signal type: FAM fluorescence signal corresponds to the genotype (SNP locus 1 is G, SNP locus 2 is A, SNP locus 3 is A, SNP locus 4 is G and SNP locus 5 is C), and HEX fluorescence signal corresponds to the allele genotype (SNP locus 1 is C, SNP locus 2 is G, SNP locus 3 is T, SNP locus 4 is A and SNP locus 5 is T).

[0061] 5. Result verification: The primer set of the KASP marker qPDGR5.1 of this invention can clearly distinguish the genotypes of 90 soybean germplasms. Figure 3 (Table 1) The genotyping success rate was 96.7%; the average plant height response value of the material with genotype CC was 0.99, and the average plant height response value of the material with genotype GG was 1.22. The phenotypic difference between the two genotypes reached a highly significant level. P =3.01E-11), indicating that the KASP marker qPDGR5.1 of the present invention can be accurately used for screening densely planted soybean germplasm.

[0062] Table 1. Response values ​​of 90 soybean germplasm accessions and qPDGR5.1 genotyping of the KASP marker.

[0063] The primer set of the KASP marker qPDGR18.2 of this invention can clearly distinguish the genotypes of 78 soybean germplasms. Figure 4 (Table 2) The genotyping success rate was 100%; among them, 55 dense-planting tolerant germplasms all carried at least one superior allele (GG), and 23 dense-planting sensitive germplasms all carried a non-superior allele (AA). The phenotypic difference between the two genotypes reached a highly significant level. P = 8.21E-08), indicating that the KASP marker qPDGR18.2 of the present invention can be accurately used for screening densely planted soybean germplasm.

[0064] Table 2. Response values ​​of 78 soybean germplasm accessions and genotyping of the KASP marker qPDGR18.2

[0065] The primer set of the KASP marker qPDGR19.1 of this invention can clearly distinguish the genotypes of 88 soybean germplasms. Figure 5 (Table 3) The genotyping success rate was 100%; among them, 50 dense-planting tolerant germplasms all carried at least one superior allele (AA), and 38 dense-planting sensitive germplasms all carried a non-superior allele (TT). The phenotypic difference between the two genotypes reached a highly significant level. P = 3.58E-10), indicating that the KASP marker qPDGR19.1 of the present invention can be accurately used for screening densely planted soybean germplasm.

[0066] Table 3. Response values ​​of 88 soybean germplasm accessions and genotyping of the KASP marker qPDGR19.1

[0067] The primer set of the KASP marker qPDGR3.2 of this invention can clearly distinguish the genotypes of 90 soybean germplasms. Figure 6 (Table 4) The genotyping success rate was 90%; among them, 43 dense-planting tolerant germplasms all carried at least one superior allele (GG), and 39 dense-planting sensitive germplasms all carried a non-superior allele (AA). The phenotypic difference between the two genotypes reached a highly significant level. P =4.07E-05), indicating that the KASP marker qPDGR3.2 of the present invention can be accurately used for screening densely planted soybean germplasm.

[0068] Table 4. Response values ​​of 90 soybean germplasm accessions and genotyping of the KASP marker qPDGR3.2

[0069] The primer set of the KASP marker qPDGR4.1 of this invention can clearly distinguish the genotypes of 90 soybean germplasms. Figure 7 (Table 5) The genotyping success rate was 96%; among them, 40 dense-planting tolerant germplasms all carried at least one superior allele (CC), and 52 dense-planting sensitive germplasms all carried a non-superior allele (TT). The phenotypic difference between the two genotypes reached a highly significant level. P =7.14E-09), indicating that the KASP marker qPDGR4.1 of the present invention can be accurately used for screening densely planted soybean germplasm.

[0070] Table 5. Response values ​​of 90 soybean germplasm accessions and genotyping of the KASP marker qPDGR4.1

[0071] In summary, the SNP sites, KASP markers and their primers and kits that are significantly associated with soybean plant height response density of the present invention can be directly applied to the early identification and screening of soybean dense-planting tolerant germplasm and the molecular genetic breeding of soybean dense-planting tolerant varieties. The operation is convenient, the detection efficiency is high, and the results are accurate. It is suitable for large-scale breeding practice and can significantly improve the efficiency of soybean dense-planting tolerant breeding, accelerate the breeding process of dense-planting tolerant soybean varieties, and has important industrial application value and market prospects.

[0072] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A SNP molecular marker associated with soybean plant height response density, characterized in that, The SNP molecular marker is at least one of SNP sites 1 to 5; wherein, SNP site 1 is located at 1096073 bp on chromosome 5 of the soybean genome, with a polymorphism of C / G; SNP site 2 is located at 4285387 bp on chromosome 18 of the soybean genome, with a polymorphism of G / A; SNP site 3 is located at 46728040 bp on chromosome 19 of the soybean genome, with a polymorphism of T / A; SNP site 4 is located at 45206037 bp on chromosome 3 of the soybean genome, with a polymorphism of A / G; and SNP site 5 is located at 42154075 bp on chromosome 4 of the soybean genome, with a polymorphism of T / C. The version number of the soybean genome is Glycine max Wm82.a2.v1.

2. The SNP molecular marker according to claim 1, characterized in that, Soybeans carrying at least one of the following genotypes are tolerant to high-density planting: SNP1C, SNP2G, SNP3A, SNP4G, and SNP5C. Soybeans carrying at least one of the following genotypes are not tolerant to high-density planting: SNP1G, SNP2A, SNP3T, SNP4A, and SNP5T. Alternatively, if the genotype of SNP locus 1 is CC, the genotype of SNP locus 2 is GG, the genotype of SNP locus 3 is AA, the genotype of SNP locus 4 is GG, or the genotype of SNP locus 5 is CC, then the soybean variety is determined to have the characteristic of being tolerant to dense planting. Alternatively, if the genotype of SNP locus 1 is GG, the genotype of SNP locus 2 is AA, the genotype of SNP locus 3 is TT, the genotype of SNP locus 4 is AA, or the genotype of SNP locus 5 is TT, then the soybean variety is determined to be a soybean that is not tolerant to dense planting or has weak dense planting tolerance.

3. The SNP molecular marker according to claim 1 or 2, characterized in that, The SNP site 1 is located at position 81 of the sequence shown in SEQ ID No. 1; the SNP site 2 is located at position 81 of the sequence shown in SEQ ID No. 2; the SNP site 3 is located at position 81 of the sequence shown in SEQ ID No. 3; the SNP site 4 is located at position 51 of the sequence shown in SEQ ID No. 4; and the SNP site 5 is located at position 54 of the sequence shown in SEQ ID No.

5.

4. Primers for amplifying the SNP molecular marker as described in any one of claims 1 to 3.

5. The primer according to claim 4, characterized in that, The primers are KASP-specific primers; Preferably, the KASP-specific primers include at least one primer sequence shown in SEQ ID No. 6 to SEQ ID No. 8, SEQ ID No. 9 to SEQ ID No. 11, SEQ ID No. 12 to SEQ ID No. 14, SEQ ID No. 15 to SEQ ID No. 17, and SEQ ID No. 18 to SEQ ID No.

20.

6. A reagent or kit for detecting the high-density planting tolerance of soybeans, characterized in that, This includes the primers described in claim 4 or 5.

7. The reagent or kit according to claim 6, characterized in that, The kit also includes at least one of the following: PCR amplification buffer, dNTPs, Taq DNA polymerase, and ultrapure water.

8. The use of the SNP molecular marker according to any one of claims 1 to 3, the primer according to claim 4 or 5, and the reagent or kit according to claim 6 or 7 in at least one of the following aspects: (1) Identify or assist in screening soybean varieties tolerant to high-density planting; (2) Genetic breeding of soybean dense planting trait.

9. The application according to claim 8, characterized in that, The application steps include: extracting genomic DNA from the soybean sample to be tested, detecting the genotype of at least one SNP site among SNP sites 1 to SNP sites 5, and determining whether the soybean variety has the characteristic of being tolerant to dense planting.

10. The application according to claim 9, characterized in that, The application steps include: using the genomic DNA of the soybean sample to be tested as a template, performing PCR amplification with the primers shown in SEQ ID No. 6 to SEQ ID No. 20, performing KASP genotyping detection on the PCR amplification products, obtaining the genotypes of SNP sites 1 to 5, and determining whether the soybean variety has the characteristic of dense planting.

Images