SNP molecular marker for identifying viburnum plicatum and viburnum macrocephalum and application thereof

Abstract

The application belongs to the technical field of molecular markers, and specifically discloses a SNP molecular marker for identifying Viburnum plicatum and Viburnum macrocephalum var. formosanum and application, wherein the SNP molecular marker is located at the 49225th site of a chloroplast genome, the site of Viburnum plicatum is A, and the site of Viburnum macrocephalum var. formosanum simultaneously exists A and C two kinds of base signals (IUPAC degenerate base is expressed as M). An amplification primer is designed based on the specific SNP site, and a 206 bp target fragment SEQ ID NO. 1 containing the site is obtained. The application provides reliable technical support for germplasm resource identification, seedling authenticity detection, new variety protection and horticultural production. Compared with complete chloroplast genome sequencing, the application only needs to amplify a 206 bp target fragment to complete the identification, and the detection process is simple and low in cost, and is suitable for rapid molecular identification of large-scale samples.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker technology, specifically relating to an SNP molecular marker for identifying Viburnum macrocephalum and Viburnum sylvestris and its application. Background Technology

[0002] viburnum ( Viburnum keteleeri ) belongs to the genus Viburnum in the family Viburnaceae. Viburnum A deciduous shrub or small tree, it is highly valued for its pure white inflorescences and graceful form, and is widely used in landscaping, scenic area construction, and the floriculture industry. Hydrangea viburnum ( Viburnum keteleeri 'Sterile' is an important horticultural type of *Viburnum macrocephalum*, whose inflorescence consists entirely of large sterile flowers, giving it higher ornamental value and making it widely cultivated in landscaping and seedling production. Due to their similar morphology and close kinship, confusion and misidentification of the two species are prone to occur during seedling propagation, germplasm resource preservation, and horticultural production. Therefore, establishing a rapid and accurate molecular identification method is of great significance.

[0003] Currently, the identification of *Viburnum macrocephalum* and *Viburnum hydrangea* mainly relies on morphological characteristics such as inflorescence morphology and the proportion of sterile flowers. However, this method is greatly affected by factors such as plant growth stage, cultivation environment, and flowering time, and it is difficult to accurately identify seedlings, dormant branches, or flowering materials. In recent years, molecular markers such as DNA barcoding and complete chloroplast genomes have been widely used in plant classification and identification. However, complete chloroplast genome sequencing data is large, the analysis process is complex, and the detection cost is high, which is not conducive to the rapid detection of large numbers of samples and production applications. Therefore, developing a rapid identification method based on a small number of specific molecular markers has greater application value.

[0004] Single nucleotide polymorphisms (SNPs) are the most common forms of genetic variation in the genome. They are characterized by genetic stability, wide distribution, accurate detection, and ease of high-throughput analysis, and have been widely applied in plant variety identification, germplasm resource evaluation, genetic breeding, and marker-assisted selection. Establishing plant molecular identification methods using specific SNP sites not only significantly improves identification efficiency but also offers advantages such as short amplified fragments, high detection sensitivity, and applicability to degraded DNA and batch sample testing. Therefore, it has become an important technical means for plant molecular identification. Summary of the Invention

[0005] The purpose of this invention is to provide an SNP molecular marker for identifying Viburnum macrocephalum and Viburnum sylvestris and its application.

[0006] To achieve the above objectives, the technical solution of the present invention is as follows: This invention first performed high-throughput sequencing on *Viburnum macrocephalum* and *Viburnum hydrangea*, respectively, and completed chloroplast genome assembly and annotation to obtain complete chloroplast genome sequences for both. Whole-genome alignment analysis was then performed on the obtained *Viburnum macrocephalum* and *Viburnum hydrangea* chloroplast genome sequences, and all single nucleotide polymorphism (SNP) sites were counted. Screening results showed that the chloroplast genomes of *Viburnum macrocephalum* and *Viburnum hydrangea* were highly similar, with a unique and stable specific SNP site at position 49225 of the chloroplast genome. The base at this site in *Viburnum hydrangea* is A, while in *Viburnum macrocephalum*, both A and C bases (represented as M in IUPAC degenerate bases) are present at this site. Therefore, position 49225 of the chloroplast genome was selected as the target site for molecular identification of *Viburnum macrocephalum* and *Viburnum hydrangea*, and PCR amplification primers were designed centered on this site.

[0007] Using the 49225th SNP site in the chloroplast genome as the center, PCR amplification primers were designed using Primer Premier 5.0 software to ensure that the amplified fragment covered the target SNP site.

[0008] The primer sequences (5'→3') are as follows: VM_Primer_F: TTCTTTGATTTCAAAGGGAC (SEQ ID NO.2); VM_Primer_R: TTATGAGTAGCTAAGATTCC (SEQ ID NO. 3).

[0009] The amplified target fragment is 206 bp in length, and its sequence is shown in SEQ ID NO.1. The target SNP site is located at position 87 of the amplified fragment SEQ ID NO.1. The base characteristics of position 87 of the SEQ ID NO.1 sequence are as follows: when sequencing at this site detects only a single base A signal, the sample to be tested is Viburnum hydrangea; when sequencing at this site detects both base A and base C signals, which are denoted as degenerate base M according to IUPAC nucleotide encoding, the sample to be tested is Viburnum macrocephalum.

[0010] The sequence of SEQ ID NO.1 is as follows: TTCTTTGATTTCAAAGGGACATTATAAATATAAATCATGTAAAAATTAGAATAAAAAAAATAGAGAAAAGCCGGCTATCGGAATCG A / CACCGATGACCATCGCATTACAAATGCGATGCTCTAACCTCTGAGCTAAGCAGGCTCACATAACAGAAATTCTACATGCATAGGAATTCAATAAACTATTGGAATCTTAGCTACTCATAA.

[0011] In addition, the present invention also protects a kit for identifying Viburnum macrocephalum and Viburnum hydrangea, the kit containing the above-mentioned primer pair.

[0012] This invention also discloses the application of the primer pair kit for the above-mentioned SNP molecular markers in the identification of Viburnum macrocephalum and Viburnum sylvestris.

[0013] In addition, a molecular identification method for distinguishing between Viburnum hydrangea and Viburnum macrocephalum is disclosed, which uses the aforementioned primer pair or kit for detection and includes the following steps: (1) Extract genomic DNA from the sample to be tested; (2) Use the genomic DNA extracted in step (1) as an amplification template and perform real-time PCR amplification using the primer pair; (3) The PCR amplification product was recovered and purified. The purified product was subjected to Sanger sequencing, and the genotype at position 87 was determined by reading the sequencing peak diagram. (4) Classification criteria: Compare the sequencing sequence with SEQ ID NO.1. If there is only a single A base peak at position 87, the sample is identified as Viburnum hydrangea; if there are both A and C base peaks at position 87, the sample is identified as Viburnum macrocephalum.

[0014] Advantages of this invention: This invention, by comparing the chloroplast genome sequences of *Viburnum macrocephalum* and *Viburnum hydrangea*, for the first time discovered a stable and specific single nucleotide polymorphism (SNP) site at position 49225 of the chloroplast genome in both species. *Viburnum hydrangea* has an A base at this site, while *Viburnum macrocephalum* exhibits both A and C base signals (represented as M in IUPAC degenerate bases). Based on this specific SNP site, amplification primers were designed to obtain a 206 bp target fragment containing this site. Combined with amplicon sequencing, a rapid and accurate molecular identification method for *Viburnum macrocephalum* and *Viburnum hydrangea* was established, providing reliable technical support for germplasm resource identification, seedling authenticity testing, new variety protection, and horticultural production. Compared to complete chloroplast genome sequencing, this invention only requires amplification of a 206 bp target fragment for identification, resulting in a simpler and lower-cost detection process, suitable for rapid molecular identification of large-scale samples. Attached Figure Description

[0015] Figure 1This is a sequence alignment diagram of the chloroplast genome of *Viburnum macrocephalum* and *Viburnum hydrangea* at position 49225. Note: The red box indicates the chloroplast genome specific SNP at position 49225. A: *Viburnum hydrangea*, the base at this site is A; B: *Viburnum macrocephalum*, this site contains both A and C base signals (IUPAC degenerate bases are represented as M).

[0016] Figure 2 The results show the PCR amplification of Viburnum hydrangea and Viburnum macrocephalum samples using the specific primers VM_Primer_F and VM_Primer_R from previous experiments. Note: MW is the DNA molecular weight standard; Test samples 1-4 are Viburnum hydrangea samples, and Test samples 5-8 are Viburnum macrocephalum samples, all of which amplified to obtain target bands of approximately 206 bp.

[0017] Figure 3 The images show the PCR amplification results of Viburnum macrocephalum and Viburnum hydrangea samples from later experiments. Note: Specific primers VM_Primer_F and VM_Primer_R were used for PCR amplification of Viburnum macrocephalum and Viburnum hydrangea samples. The markers represent DNA molecular weight standards; samples 001–010 on the left represent 10 Viburnum macrocephalum samples, and samples 001–010 on the right represent 10 Viburnum hydrangea samples. All samples amplified to obtain target bands of approximately 206 bp.

[0018] Figure 4 These are the results of SNP detection at position 49225 in Viburnum macrocephalum and Viburnum hydrangea based on amplicon sequencing from previous experiments. Note: Test samples 1-4 are Viburnum hydrangea samples, and position 49225 was detected as A in all samples; Test samples 5-8 are Viburnum macrocephalum samples, and position 49225 was detected as M (A / C in all samples).

[0019] Figure 5 Sanger sequencing results for SNP locus 49225 in the chloroplast genomes of *Viburnum macrocephalum* and *Viburnum hydrangea*. Note: ①-③ represent three randomly selected *Viburnum macrocephalum* individuals, all showing A / C bimodal signals at the target locus; ④-⑥ represent three randomly selected *Viburnum hydrangea* individuals, all showing a single A peak at the target locus. Green, red, blue, and black curves represent A, T, C, and G base signals, respectively. Detailed Implementation

[0020] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, unless otherwise specified, the specific experimental methods involved in the following embodiments are conventional methods or implemented according to the conditions recommended in the manufacturer's instructions.

[0021] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used can be purchased commercially.

[0022] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only. I. Materials and Methods

[0023] 1. Plant materials and DNA extraction With viburnum ( Viburnum keteleeri ) and Viburnum sylvestris ( Viburnum keteleeri Fresh leaves of 'Sterile' were used as experimental material, and total plant DNA was extracted using a modified CTAB method. DNA integrity was detected by 1% agarose gel electrophoresis, and DNA purity and concentration were detected by NanoDrop 2000 ultra-micro spectrophotometer. After passing the test, the DNA was stored at -20 ℃ for later use.

[0024] 2. Screening for specific SNP sites First, high-throughput sequencing was performed on Viburnum macrocephalum and Viburnum hydrangea, and chloroplast genome assembly and annotation were completed to obtain the complete chloroplast genome sequences of both.

[0025] The obtained chloroplast genome sequences of *Viburnum macrocephalum* and *Viburnum hydrangea* were subjected to whole-genome alignment analysis, and all single nucleotide polymorphism (SNP) sites between the two were counted. Based on the stability, uniqueness, and conservation of flanking sequences of candidate SNP sites, target SNP sites suitable for PCR amplification and amplicon sequencing detection were screened.

[0026] Screening results showed that the chloroplast genomes of *Viburnum macrocephalum* and *Viburnum hydrangea* were highly similar, with a unique and stable specific SNP locus at position 49225 of the chloroplast genome. *Viburnum hydrangea* has an A base at this locus, while *Viburnum macrocephalum* exhibits both A and C base signals (represented as M in IUPAC degenerate bases). Therefore, position 49225 of the chloroplast genome was selected as the target locus for molecular identification of *Viburnum macrocephalum* and *Viburnum hydrangea*, and PCR amplification primers were designed centered on this locus.

[0027] 3. PCR primer design Using the 49225th SNP site in the chloroplast genome as the center, PCR amplification primers were designed using Primer Premier 5.0 software to ensure that the amplified fragment covered the target SNP site.

[0028] The primer sequences (5'→3') are as follows: VM_Primer_F: TTCTTTGATTTCAAAGGGAC (SEQ ID NO.2); VM_Primer_R: TTATGAGTAGCTAAGATTCC (SEQ ID NO. 3).

[0029] The amplified target fragment is 206 bp in length, and its sequence is shown in SEQ ID NO.1. The target SNP site is located inside the amplified fragment SEQ ID NO.1.

[0030] 4. PCR amplification Using the extracted total plant DNA as a template, PCR amplification was performed using the primers described above. The PCR reaction procedure was as follows: Pre-denaturation at 97 ℃ for 1 min; Then perform 35 cycles: Denaturation at 96 ℃ for 45 s; Anneal at 50 ℃ for 30 s; Extend at 72 ℃ for 2 min; The final extension was performed at 72°C for 2 min, followed by storage at 4°C. PCR products were analyzed by 1% agarose gel electrophoresis to detect amplification efficiency.

[0031] 5. Amplicon sequencing and result interpretation After obtaining the 206 bp target fragment by PCR amplification, the PCR product was purified, and the library was constructed according to the high-throughput sequencing library construction method, including end repair, adapter ligation, PCR enrichment, and library purification. The library concentration was detected using a Qubit real-time fluorescence instrument, and the library fragment size and quality were detected using an Agilent 2100 Bioanalyzer. After the library passed the quality control, high-throughput amplicon sequencing was performed.

[0032] After obtaining amplicon sequencing data, quality control was performed to remove adapter sequences, low-quality sequences, and other invalid data, resulting in high-quality Clean Reads. These Clean Reads were then aligned to the reference sequence of the *Viburnum macrocephalum* chloroplast genome. Sequence assembly and consistency analysis were performed on the 206 bp target fragment obtained from PCR amplification, and the base information at position 49225 of the chloroplast genome was read. Based on the amplicon sequencing results, the molecular identification of the samples to be tested was completed.

[0033] 6. Primer validity verification PCR amplification was performed on samples of Viburnum hydrangea and Viburnum macrocephalum using the designed VM_Primer_F and VM_Primer_R primers. If a single target band of about 206 bp was amplified in all samples, it indicates that the primers have good amplification specificity and stability, which can meet the needs of subsequent amplicon sequencing and species identification. II. Results and Analysis

[0034] 1. Screening of specific SNP sites in Viburnum macrocephalum and Viburnum 'Hydrangea' To establish a rapid molecular identification method for *Viburnum macrocephalum* and *Viburnum hydrangea*, whole-genome alignment analysis was performed on the chloroplast genome sequences of both species, and all single nucleotide polymorphism (SNP) sites were counted. The results showed that the chloroplast genome sequences of both *Viburnum macrocephalum* and *Viburnum hydrangea* were highly conserved overall, with only one stable, specific SNP site detected at position 49225 of the chloroplast genome.

[0035] Further analysis of this site revealed that the base at position 49225 in Viburnum hydrangea is A ( Figure 1 A), while the viburnum flower simultaneously exhibits both A and C base signals at the corresponding site (A), Figure 1 B), denoted as M according to IUPAC nucleotide degenerate coding. Sequencing peak diagrams show that Viburnum hydrangea exhibits a single A peak at this site, while the corresponding site in Viburnum macrocephalum shows both A and C double peaks, indicating a stable and easily identifiable base difference between the two.

[0036] Since the chloroplast genomes of *Viburnum macrocephalum* and *Viburnum hydrangea* contain only one stable and specific SNP locus, the 49225th SNP was selected as the target locus for molecular identification. PCR primers were designed around this locus to construct a rapid molecular identification method for *Viburnum macrocephalum* and *Viburnum hydrangea* based on amplicon sequencing. This method simplifies the identification of the complete chloroplast genome to the detection of a single SNP locus, significantly reducing detection costs and improving detection efficiency while ensuring accuracy. It is suitable for applications such as germplasm resource identification, seedling authenticity testing, and new variety protection.

[0037] 2. Specific primer design and amplification validation Based on the specific SNP site at position 49225 of the chloroplast genome of *Viburnum macrocephalum* and *Viburnum sylvestris*, and the conserved sequences flanking it, PCR amplification primers (VM_Primer_F / VM_Primer_R) were designed using Primer Premier 5.0 software to ensure that the amplified fragment covered the target SNP site. The amplified product was 206 bp in length, and the target SNP site was located within the amplified fragment, which was sufficient for accurate reading of the target site in subsequent amplicon sequencing.

[0038] In the preliminary validation, designed primers were used to perform PCR amplification on four samples of Viburnum hydrangea and four samples of Viburnum macrocephalum, and the amplification results were detected by 1% agarose gel electrophoresis. The results showed that all eight samples yielded a single target band of approximately 206 bp, and no obvious non-specific amplification bands were observed. Figure 2 This indicates that the designed primers have good amplification specificity.

[0039] To verify the applicability of the SNP molecular markers established in this invention, subsequent experiments randomly selected 10 plants each of *Viburnum macrocephalum* and *Viburnum hydrangea* from the Hangzhou Botanical Garden and the Hangzhou Garden Co., Ltd. breeding nursery, totaling 20 samples as verification materials. Total DNA was extracted from the plants using the modified CTAB method, and PCR amplification was performed using the specific primers VM_Primer_F and VM_Primer_R designed in this invention.

[0040] The PCR amplification products were detected by 1% agarose gel electrophoresis. The results showed that all 20 samples amplified a single target band of approximately 206 bp, and no obvious non-specific amplification bands were observed. Figure 3 This demonstrates that the primers designed in this invention have good amplification specificity, stability, and repeatability, and can stably amplify DNA fragments containing target SNP sites, meeting the requirements for subsequent molecular identification.

[0041] The above results indicate that the PCR primers designed based on the specific SNP site at position 49225 of the chloroplast genome have high amplification efficiency and good repeatability, and can stably obtain a 206 bp amplified fragment containing the target SNP site, providing a reliable technical basis for establishing a rapid molecular identification method for Viburnum macrocephalum and Viburnum hydrangea.

[0042] 3. Molecular identification of Viburnum macrocephalum and Viburnum 'Hydrangea' based on amplicon sequencing To verify the accuracy of the molecular identification method of the present invention, a library was constructed and high-throughput amplicon sequencing was performed on the 206 bp target fragment obtained by PCR amplification. Sequence alignment analysis was performed on the sequencing results to read the base information at position 49225 of the chloroplast genome.

[0043] Amplicon sequencing results showed that a single A base was detected at position 49225 of the chloroplast genome in all four *Viburnum hydrangea* samples (Test sample 1–4); and both A and C base signals were detected simultaneously at the corresponding position in all four *Viburnum macrocephalum* samples (Test sample 5–8). These results are represented as M(…) according to IUPAC nucleotide degeneracy coding. Figure 4 The test results of all 8 samples were completely consistent with their true species information, indicating that the locus has good stability and repeatability.

[0044] In later experiments, three samples of *Viburnum macrocephalum* and three samples of *Viburnum hydrangea* were randomly selected from 20 PCR amplification products for Sanger sequencing analysis. The results showed that the three independent *Viburnum macrocephalum* individuals ( Figure 5 Samples ①-③ all showed stable A / C bimodal signals at the target SNP sites, with the A peak being the main peak and the C peak being a distinct secondary peak; in contrast, the three Viburnum individuals ( Figure 5 Samples ④-⑥ all showed a single A peak at this site, with no similar C secondary peak signal detected. These results indicate that the A / C bimodal characteristic at this site is not a random variation in a single sample, but a stable molecular feature that can be repeatedly detected in multiple independent *Viburnum macrocephalum* individuals.

[0045] Previous comparative analysis of the chloroplast genome showed that *Viburnum macrocephalum* exhibited both A and C base signals at this locus, with A base signals accounting for 85.4% and C base signals accounting for 14.6%; *Viburnum hydrangea*, on the other hand, mainly showed a single A base signal. The Sanger sequencing results of six random samples were consistent with the previous chloroplast genome analysis results, further demonstrating that the 49225th SNP locus in the chloroplast genome has good stability and reproducibility, and can be used for molecular identification of *Viburnum macrocephalum* and *Viburnum hydrangea*.

[0046] The above results demonstrate that the molecular marker and identification method based on the 49225th specific SNP site of the chloroplast genome established in this invention exhibits good stability, repeatability, and accuracy. Since the chloroplast genomes of *Viburnum macrocephalum* and *Viburnum hydrangea* contain only one stable specific SNP site at position 49225, this invention only requires amplifying a 206bp target fragment containing this site and combining this with amplicon sequencing to read the base type of the target site, thus achieving rapid and accurate identification of both species. Compared with complete chloroplast genome sequencing and traditional DNA barcoding methods, the detection process of this invention is simpler, the detection cost is lower, and it possesses good accuracy, stability, and repeatability. It can be widely applied in fields such as germplasm resource identification of *Viburnum macrocephalum* and *Viburnum hydrangea*, seedling authenticity testing, new variety protection, and horticultural production.

[0047] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. A SNP molecular marker for identifying Viburnum macrocephalum and Viburnum sylvestris, characterized in that, The SNP molecular marker is located at position 87 of the amplified fragment SEQ ID NO.

1. The base characteristics of position 87 of the SEQ ID NO.1 sequence are as follows: when sequencing at this site detects only a single base A signal, the sample to be tested is Viburnum hydrangea; when sequencing at this site detects both base A and base C signals, which are denoted as degenerate base M according to IUPAC nucleotide encoding, the sample to be tested is Viburnum macrocephalum.

2. A primer pair for amplifying the SNP molecular marker of claim 1, characterized in that, The primer pairs are as follows: VM_Primer_F: TTCTTTGATTTCAAAGGGAC; VM_Primer_R: TTATGAGTAGCTAAGATTCC.

3. A kit containing the SNP molecular marker of claim 1 or the primer pair of claim 2.

4. The application of the primer pair of the SNP molecular marker described in claim 2 or the kit described in claim 3 in the identification of Viburnum macrocephalum and Viburnum 'Hydrangea'.

5. A molecular identification method for distinguishing between Viburnum hydrangea and Viburnum macrocephalum, characterized in that, The detection is performed using the primer pair of claim 2 or the kit of claim 3, comprising the following steps: (1) Extract genomic DNA from the sample to be tested; (2) Use the genomic DNA extracted in step (1) as an amplification template and perform PCR amplification using the primer pair; (3) The PCR amplification product was recovered and purified. The purified product was subjected to Sanger sequencing, and the genotype at position 87 was determined by reading the sequencing peak diagram. (4) Classification criteria: Compare the sequencing sequence with SEQ ID NO.

1. If there is only a single A base peak at position 87, the sample is identified as Viburnum hydrangea; if there are both A and C double base fluorescence peaks at position 87, the sample is identified as Viburnum macrocephalum.

Images