A molecular marker-assisted breeding method for improving corn plant height based on multi-gene locus aggregation

Abstract

The application discloses a molecular marker assisted breeding method for improving corn plant height based on multiple gene sites. The application provides application of a substance for detecting genotypes of nine sites Z3080-473, Z4970-229, Z7250-3093, Z7460-9928, Z8490-2184, Z8710-8bp, Z9450-535, Z9460-698 and Z9730-406 in the corn genome in any one of the following: A1) identifying or assisting in identifying corn plant height; A2) screening or assisting in screening short-stalk corn; A3) breeding short-stalk corn; A4) corn genetic breeding. The experiment proves that the application provides nine sites, which are significantly related to the plant height, and identifies a site combination scheme meeting the breeding requirement, so that the site combination scheme can adapt to different height reduction requirements.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a molecular marker-assisted breeding method for improving maize plant height based on multi-gene locus aggregation. Background Technology

[0002] corn( Zea mays As the most widely planted and highest-yielding food crop globally, maize plant height is a core agronomical trait determining lodging resistance, canopy light utilization efficiency, and adaptability to mechanized harvesting. Excessively tall plants increase the risk of lodging, leading to yield loss; while excessive dwarfing may result in decreased biomass and yield. Therefore, breeding moderately short-stalked, stable-yielding maize varieties is a key objective for achieving high-density planting, high yields, and suitability for mechanized harvesting.

[0003] Previous studies have shown that maize plant height is regulated by multiple genes, involving multiple pathways such as hormone synthesis, biological clock, and light signaling. The plant height-related genes identified by previous researchers have provided important candidate targets for molecular breeding of maize plant height. However, the existing technologies mainly have the following shortcomings: (1) The functional sites are not clearly defined, which makes it difficult to develop molecular markers and utilize them in breeding. (2) The effect of a single site is limited. The effect of a single stalk reduction site is usually 10–35 cm, which is difficult to meet the needs of modern breeding. Whether the aggregation of multiple sites produces a synergistic stalk reduction effect and whether there is effect saturation lacks systematic research. Therefore, this field needs a technical solution that can systematically screen new sites, verify aggregation effects, and guide breeding practices. Summary of the Invention

[0004] The technical problem solved by this invention is to provide a molecular marker-assisted breeding method for improving maize plant height based on multi-gene locus aggregation.

[0005] To address the aforementioned technical problems, the first aspect of this invention provides a substance for detecting the genotypes of nine loci in the maize genome: Z3080-473, Z4970-229, Z7250-3093, Z7460-9928, Z8490-2184, Z8710-8bp, Z9450-535, Z9460-698, and Z9730-406, in any of the following applications: A1) To identify or assist in the identification of maize plant height; A2) Screening or assisting in the screening of short-stalked corn; A3) Breeding dwarf corn; A4) Maize genetic breeding; the indicator for genetic breeding is dwarf stalks.

[0006] The locus Z3080-473 is the 101st position of sequence 1, and its genotype is AA, GG or AG; The site Z4970-229 is the 101st position of sequence 2, and its genotype is TT, GG or TG; The locus Z7250-3093 is the 101st position of sequence 3, and its genotype is AA, GG or AG; The locus Z7460-9928 is the 101st position of sequence 4, and its genotype is CC, TT or CT. The site Z8490-2184 is the 101st position of sequence 5, and its genotype is AA, GG or AG; The site Z8710-8bp is located at positions 101-108 of sequence 6, and its genotype is aa, gg, or ag; The site Z9450-535 is the 101st position of sequence 7, and its genotype is GG, CC or GC; The locus Z9460-698 is the 101st position of sequence 8, and its genotype is AA, GG or AG; The locus Z9730-406 is the 101st position of sequence 9, and its genotype is CC, AA or CA.

[0007] The genotype of the Z8710-8bp site is aa, which means that the insertion / deletion site is 8 bp (ATGGATGG) in both homologous chromosomes; the genotype is gg, which means that the insertion / deletion site is 8 bp (ATGGATGG) in both homologous chromosomes; the genotype is ag, which means that the insertion / deletion site is 8 bp (ATGGATGG) in one homologous chromosome and that the insertion / deletion site is 8 bp (ATGGATGG) missing in the other homologous chromosome.

[0008] The genotypes at other loci are the standard SNP genotypes.

[0009] In the above-described applications, the substance is B1 or B2. B1) Primer set; B2) PCR reagents or kits containing the complete set of primers described above; The primer set includes primer F, primer H and primer C; The nucleotide sequence of primer F includes any one of sequences 10-18, obtained by removing 21 bp from the 5' end; The nucleotide sequence of primer H includes any one of sequences 19-27, obtained by removing 21 bp from the 5' end; The nucleotide sequence of primer C is any one of sequences 28-36.

[0010] In some embodiments, the nucleotide sequence of primer F is any one of sequences 10-18; In some embodiments, the nucleotide sequence of primer H is any one of sequences 19-27.

[0011] Secondly, the present invention provides the application of a substance for detecting the genotype at the Z3080-473 locus in the maize genome in any of the following: C1) Identification or auxiliary identification of maize plant height; C2) Screening or assisted screening of short-stalked corn that does not reduce yield; C3) Selecting and breeding short-stalked corn varieties that do not reduce yield; C4) Maize genetic breeding; the breeding target is short stalks without reduced yield.

[0012] The Z3080-473 position is the 101st position in sequence 1; The genotype at the Z3080-473 locus is GG, AA, or AG.

[0013] In the above-described applications, the substance is B1 or B2. B1) Primer set; B2) PCR reagents or kits containing the complete set of primers described above; The primer set includes primer F, primer H and primer C; The nucleotide sequence of primer F includes sequence 10; The nucleotide sequence of primer H includes sequence 19; The nucleotide sequence of primer C is sequence 28.

[0014] Thirdly, the present invention provides any of the following substances: The primer set described in the first or second aspect; Alternatively, PCR reagents or kits containing the primer set described in the first or second aspect.

[0015] Fourthly, the present invention provides the application of the primer sets, PCR reagents, or kits described in the first or second aspect in any of the following: D1) Identify or assist in identifying maize plant height; D2) Screening or assisted screening of short-stalk or short-stalk corn that does not reduce yield; D3) Select and breed short-stalk or short-stalk corn that does not reduce yield; D4) Maize genetic breeding, with the breeding index being short stalks or short stalks without yield reduction.

[0016] Fifthly, the present invention provides any of the following methods: E1) A method for identifying or assisting in the identification of maize plant height, comprising the following steps: detecting the genotypes of nine loci in the maize genome: Z3080-473, Z4970-229, Z7250-3093, Z7460-9928, Z8490-2184, Z8710-8bp, Z9450-535, Z9460-698, and Z9730-406; and, among all nine loci, the maize plant height of those carrying a higher number of dominant genotypes is lower or a candidate lower than that of those carrying a lower number of dominant genotypes. The dominant genotypes at the loci Z3080-473, Z4970-229, Z7250-3093, Z7460-9928, Z8490-2184, Z8710-8bp, Z9450-535, Z9460-698, and Z9730-406 are GG, CC, AA, TT, GG, aa, CC, GG, and CC, respectively.

[0017] E2) A method for identifying or assisting in the identification of maize plant height, comprising the following steps: detecting the genotype at the Z3080-473 locus in the maize genome, The plant height of maize with the genotype GG at the Z3080-473 locus is lower or candidate lower than that of maize with the genotype AA at the Z3080-473 locus.

[0018] The method described above for detecting genotypes at various loci in the maize genome includes the following steps: using the maize genome to be tested as a template, performing a KASP reaction with primers corresponding to each locus in the first aspect to obtain the genotype.

[0019] In a seventh aspect, the present invention provides a method for breeding dwarf maize, comprising the following steps: breeding maize varieties carrying a large number of advantageous genotypes as described in the sixth aspect.

[0020] Alternatively, the present invention provides a method for breeding short-stalked maize without reducing yield, comprising the following steps: breeding maize with the genotype GG at the Z3080-473 locus described in the sixth aspect.

[0021] Experiments of this invention have demonstrated that the invention provides nine loci that are significantly correlated with plant height, and identifies locus combinations that meet breeding requirements, enabling them to adapt to different height reduction needs. Among them, locus Z3080-473 is used to identify short-stalked maize that does not reduce yield. Attached Figure Description

[0022] Figure 1 The effect of the aggregation of dominant genotypes on plant height. Detailed Implementation

[0023] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0024] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0025] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0026] Example 1: Discovery of polymorphic sites related to plant height and design of dedicated KASP primers I. Screening for height-related polymorphic sites using mixed-cell resequencing in extreme materials 1. Materials used for screening plant height gene polymorphism Eleven materials, representing two extreme groups, were screened from inbred lines widely used in maize production: six taller materials (209-245 cm) and five shorter materials (137-175 cm). These materials are documented in the following references: ① Su A, Xiao S, Li Z, et al., Multi-omics analysis elucidates phased defense and resource allocation trade-offs in fusarium resistance of maize. Plant Stress, 2025, 100977. ② Yang X, Gao S, Xu S, et al., Characterization of a global germplasm collection and its potential utilization for analysis of complex quantitative traits in maize. Molecular Breeding, 2011, 28:511–526.

[0027] Table 1 lists the materials used for screening plant height gene polymorphism.

[0028] 2. Selection and amplification of plant height genes Based on literature reports and public databases, 79 genes regulating plant height were selected, covering multiple functional categories such as flowering period regulation, hormone synthesis, and signal transduction. Among them, 30 genes were related to flowering period, 32 genes were related to plant hormones, and 17 genes were related to signal transduction.

[0029] 3. Screening of polymorphic sites RNA was extracted from the leaves of the above 11 materials using the RNAprep plant total RNA extraction kit (DP432, Tiangen Biotech), and then reverse transcribed into cDNA using a reverse transcription kit (HiScript III 1st Strand cDNA Synthesis Kit-R312-02, Novizan Biotech).

[0030] Based on the B73-RefGen_v5 reference genome cDNA sequence, primers were designed using Primer3 to amplify the full-length CDS sequences of 79 candidate genes. Conventional PCR amplification and sequencing were performed. The PCR products were sequenced using Sanger sequencing, and the sequences were aligned using MAFFT v7.037 software and visualized using BioEdit software. The polymorphic site screening criterion was the frequency difference of the variant site between dwarf and tall materials, resulting in 104 polymorphic sites.

[0031] 4. Design KASP primers targeting polymorphic sites KASP primers were designed using the following method: The Primer3 v2.5.0 online website (https: / / junli.netlify.app / apps / design-primers-with-primer3 / ) was used to input the sequences 100 bp before and after the aforementioned loci to design KASP primers. Each KASP primer contained three sequences: a FAM primer sequence, a HEX primer sequence, and a Common primer sequence. The adapter sequence for the FAM primer was GAAGGTGACCAAGTTCATGCT; the adapter sequence for the HEX primer was GAAGGTCGGAGTCAACGGATT. The designed KASP primers were used to amplify 11 materials, and primers with clear genotyping were selected, resulting in 9 primer pairs.

[0032] The KASP amplification system consists of 3 μL (using a 384 microplate) and includes 30 ng of dried DNA, 1.5 μL of KASP 2X Mastermix 96 / 384 (LGC, model KBS-1016-003), 1.5 μL of deionized or ultrapure water, and 0.042 μL of primer working solution (where the final concentrations of FAM primers, HEX primers, and Common primers in the amplification system are 12 μM, 12 μM, and 30 μM, respectively).

[0033] The KASP amplification program is as follows: 95℃ for 15 min preheating; 94℃ for 20 s, 61-55℃ for 1 min (decreasing by 0.6℃ per cycle), 10 cycles; 94℃ for 20 s, 55℃ for 1 min, 26 cycles, end.

[0034] The genotyping results were read using the PheraStar fluorescence scanner, and the Kraken software was used to output the genotypes, thus obtaining the genotypes of the samples to be tested.

[0035] II. Screening for plant height-related polymorphic loci in large populations 1. Identification of experimental materials and phenotypic characteristics To identify the key functional markers for distinguishing widely used dwarf germplasm, 92 maize inbred lines used in production were selected for identification. These materials cover major heterotic groups such as the Huanggai, Ruide, Lanca, and Iodent groups (Table 2). The materials are documented in the following references: (1) Liu H, Wang X, Xiao Y, et al. CUBIC: an atlas of geneticarchitecture promises directed maize improvement. Genome Biol. 2020, 24;21(1):20. (2) Su A, Xiao S, Li Z, et al., Multi-omics analysis elucidates phased defense and resource allocation trade-offs in fusarium resistance of maize. Plant Stress, 2025,100977.

[0036] (3) Wang S, Wang X, Zhang R, et al., RppM, encoding a typical CC-NBS-LRR protein, confers resistance to southern corn rust in maize. Frontiers inPlant Science. 2022, 12;13:951318. (4) Wang X, Shi Z, Zhang R, et al. Stalk architecture, cell wallcomposition, and QTL underlying high stalk flexibility for improved lodgingresistance in maize. BMC Plant Biology. 2020,11;20 (1):515. (5) Wang X, Wang T, Zhang R, et al., ZmPRX38 is required for improvingstalk strength and yield in maize. Journal of Genetics and Genomics, 2026;53(4):691-703. (6)Wang X, Zhang R, Sun X, et al., Pyramiding of favorable haplotypesof major QTLs for yield-related traits to improve maize ( Zea mays L.)productivity. Agriculture Communications, 2025, 3(2): 100083。

[0037] (7)Xiao Y, Jiang S, Cheng Q, et al., The genetic mechanism ofheterosis utilization in maize improvement. Genome Biology. 2021 10;22(1):148。

[0038] (8) Yang

[0039] (9) Chen Yanbo. Genetic improvement study of the backbone line Y59 of maize Non-Reid group and its improved lines. Jilin Agricultural University, 2022. (10) Tian Hongli, Zhang Ruyang, Fan Yaming, et al. Application analysis of Maize 6H-60K chip in the identification of substantial derivative varieties of maize. Acta Agronomica Sinica, 2023, 49(11): 2876-2885. (11) Yang Hui, Jing Xiqiang, Wang Liang, et al. Breeding and application of multi-resistant maize inbred line Dan 299. Liaoning Agricultural Sciences, 2013, (6) 68-71. (12) Zhao Jiuran, Li Chunhui, Song Wei, et al. Genetic diversity and population genetic structure of maize breeding in China based on SNP chip. Chinese Journal of Agricultural Science, 2018, 51(4): 626-644. In 2019 and 2020, these 92 materials were planted in Sanya, Hainan. Plant height was investigated after flowering, and grain weight per ear was investigated after harvesting and fully drying the maize ears. The plant height and grain weight per ear data obtained under the two environments were used to obtain BLUP data for these two traits using optimal linear unbiased estimation (Table 2).

[0040] Table 2 shows the data on plant height and grain weight per ear for 92 natural maize materials.

[0041] 2. Genotyping The KASP technique described in Example 1 was used to genotype 92 materials. Combined with the plant height phenotype, the significance of the genotype and plant height phenotype was identified based on Student's t test.

[0042] Ultimately, nine loci were identified as significantly associated with plant height. These loci were located at... ZmMADS69 , GA20ox1 , ZmELF3.2 ,ZmEMF2b / 2-2 , ZmACS7 , Br2 , ZmLUX3 , ZmPIF5.1 , ZmDWF4 The specific physical location and allele variation information of these 9 genes are shown in Table 3.

[0043] The specific information for the 9 sites is as follows: SNP site Z3080-473 is located at position 101 of sequence 1, and this site is R, with the corresponding base being A or G. The genotype of this SNP site is AA, GG, or AG.

[0044] SNP site Z4970-229 is located at position 101 of sequence 2, and this site is Y, with the corresponding base being T or G. The genotype of this SNP site is TT, CC, or TC.

[0045] SNP site Z7250-3093 is located at position 101 of sequence 3, and this site is R, with the corresponding base being A or G. The genotype of this SNP site is AA, GG, or AG.

[0046] SNP site Z7460-9928 is located at position 101 of sequence 4, and this site is Y, with the corresponding base being C or T. The genotype of this SNP site is CC, TT, or CT.

[0047] SNP site Z8490-2184 is located at position 101 of sequence 5, and this site is R, with the corresponding base being A or G. The genotype of this SNP site is AA, GG, or AG.

[0048] The insertion / deletion site Z8710-8bp is located at positions 101-108 of sequence 6, and the bases at this site can be 8bp (ATGGATGG) or 8bp missing. For consistency, the genotype of this insertion / deletion site is named aa, gg, or ag; where genotype aa indicates that the insertion / deletion site is 8bp (ATGGATGG) in both homologous chromosomes; genotype gg indicates that the insertion / deletion site is 8bp (ATGGATGG) in both homologous chromosomes; and genotype ag indicates that the insertion / deletion site is 8bp (ATGGATGG) in one homologous chromosome and 8bp (ATGGATGG) missing in the other homologous chromosome.

[0049] SNP site Z9450-535 is located at position 101 of sequence 7, and this site is S, with the corresponding base being G or C. The genotype of this SNP site is GG, CC, or GC.

[0050] SNP site Z9460-698 is located at position 101 of sequence 8, and this site is R, corresponding to bases A or G. The genotype of this SNP site is AA, GG, or AG.

[0051] SNP site Z9730-406 is located at position 101 of sequence 9, and this site is M, corresponding to base C or A. The genotype of this SNP site is CC, AA or CA.

[0052] Table 3 shows the information of the nine polymorphic sites that were significantly associated with plant height.

[0053] Based on the design rules of KASP primers, KASP primers for amplifying 9 sites were designed. The KASP primers for each site include 3 primer sequences: FAM primer, HEX primer, and Common primer (sequences are shown in Table 4).

[0054] Table 4 shows the developed KASP markers for loci significantly associated with plant height.

[0055] The effects of the nine loci on plant height are shown in Table 5. These nine loci had significant or highly significant effects on plant height, with eight loci reaching highly significant levels (p<0.01) and one locus reaching significant levels (p<0.05). The effect range for each locus was 19.74–34.30 cm. These nine loci exhibited stable plant height regulatory effects and can serve as reliable targets for molecular breeding. The genotypes of alleles associated with the dwarf phenotype were the dominant genotypes at that locus, while the genotypes of alleles associated with the tall phenotype were the non-dominant genotypes at that locus.

[0056] Table 5 shows the effects of these 9 loci on plant height.

[0057] Therefore, the above nine polymorphic sites can be used to assist in the identification of maize plant height, and the specific methods are as follows: 1) Extract genomic DNA from the sample to be tested; 2) Using genomic DNA as a template, KASP detection was performed using primers for each site shown in Table 4 to obtain amplification products.

[0058] The KASP amplification system consists of 3 μL (using a 384 microplate) and includes 30 ng of dried DNA, 1.5 μL of KASP 2X Mastermix 96 / 384 (LGC, model KBS-1016-003), 1.5 μL of deionized or ultrapure water, and 0.042 μL of primer working solution (composed of FAM primers, HEX primers, Common primers, and water, with the final concentrations of FAM primers, HEX primers, and Common primers in the amplification system being 12 μM, 12 μM, and 30 μM, respectively).

[0059] The KASP amplification program is as follows: 95℃ for 15 min preheating; 94℃ for 20 s, 61-55℃ for 1 min (decreasing by 0.6℃ per cycle), 10 cycles; 94℃ for 20 s, 55℃ for 1 min, 26 cycles, end.

[0060] The genotyping results were read using the PheraStar fluorescence scanner, and the genotypes were output using Kraken software.

[0061] The detection results for the Z3080-473 locus are as follows: If the fluorescence signal of the amplification product is FAM fluorescence signal, then the base at the Z3080-473 locus of maize to be tested is A, and the genotype is AA; if the fluorescence signal of the amplification product is HEX fluorescence signal, then the base at the Z3080-473 locus of maize to be tested is G, and the genotype is GG.

[0062] The detection results for the Z4970-229 locus are as follows: If the fluorescence signal of the amplification product is FAM fluorescence signal, then the base of the maize Z4970-229 locus to be tested is C, and the genotype is CC; if the fluorescence signal of the amplification product is HEX fluorescence signal, then the base of the maize Z4970-229 locus to be tested is T, and the genotype is TT.

[0063] The detection results for the Z7250-3093 locus are as follows: If the fluorescence signal of the amplification product is FAM fluorescence signal, then the base at the Z7250-3093 locus of maize to be tested is A, and the genotype is AA; if the fluorescence signal of the amplification product is HEX fluorescence signal, then the base at the Z7250-3093 locus of maize to be tested is G, and the genotype is GG.

[0064] The detection results for the Z7460-9928 locus are as follows: If the fluorescence signal of the amplification product is FAM fluorescence signal, then the base of the maize Z7460-9928 locus to be tested is T, and the genotype is TT; if the fluorescence signal of the amplification product is HEX fluorescence signal, then the base of the maize Z7460-9928 locus to be tested is C, and the genotype is CC.

[0065] The detection results for the Z8490-2184 locus are as follows: If the fluorescence signal of the amplification product is FAM fluorescence signal, then the base at the Z8490-2184 locus of maize to be tested is G, and the genotype is GG; if the fluorescence signal of the amplification product is HEX fluorescence signal, then the base at the Z8490-2184 locus of maize to be tested is A, and the genotype is AA.

[0066] The detection results for the Z8710-8bp site are as follows: If the fluorescence signal of the amplification product is FAM fluorescence signal, then the base at the maize Z8710-8bp site to be tested is an 8bp (ATGGATGG) insertion, and the genotype is aa; if the fluorescence signal of the amplification product is HEX fluorescence signal, then the base at the maize Z8710-8bp site to be tested is an 8bp deletion (ATGGATGG), and the genotype is gg.

[0067] The detection results for the Z9450-535 locus are as follows: If the fluorescence signal of the amplification product is FAM fluorescence signal, then the base of the maize Z9450-535 locus to be tested is C, and the genotype is CC; if the fluorescence signal of the amplification product is HEX fluorescence signal, then the base of the maize Z9450-535 locus to be tested is G, and the genotype is GG.

[0068] The detection results for the Z9460-698 locus are as follows: If the fluorescence signal of the amplification product is FAM fluorescence signal, then the base at the Z9460-698 locus of maize to be tested is G, and the genotype is GG; if the fluorescence signal of the amplification product is HEX fluorescence signal, then the base at the Z9460-698 locus of maize to be tested is A, and the genotype is AA.

[0069] The detection results for the Z9730-406 locus are as follows: If the fluorescence signal of the amplification product is FAM fluorescence signal, then the base of the maize Z9730-406 locus to be tested is C, and the genotype is CC; if the fluorescence signal of the amplification product is HEX fluorescence signal, then the base of the maize Z9730-406 locus to be tested is A, and the genotype is AA.

[0070] Example 2: Application of multi-site combination in detecting maize plant height The multi-site combination consists of at least two sites among Z3080-473, Z4970-229, Z7250-3093, Z7460-9928, Z8490-2184, Z8710-8bp, Z9450-535, Z9460-698, and Z9730-406.

[0071] Based on the genotyping results of Example 1, the number of dominant genotypes (i.e., alleles associated with the dwarf phenotype) at each of the 92 materials was counted. In the 92 materials, the number of dominant genotype aggregations ranged from 0 to 7. Aggregate number 0 indicates no dominant genotype at any of the 9 loci; aggregate number 1 indicates one dominant genotype at one of the 9 loci, and the remaining eight are non-dominant genotypes; aggregate number 2 indicates two dominant genotypes at two of the 9 loci, and the remaining seven are non-dominant genotypes; aggregate number 3 indicates three dominant genotypes at three of the 9 loci, and the remaining six are non-dominant genotypes; aggregate number 4 indicates four dominant genotypes at four of the 9 loci, and the remaining five are non-dominant genotypes; aggregate number 5 indicates nine dominant genotypes at one of the 9 loci, and the remaining seven are non-dominant genotypes; aggregate number 5 indicates nine dominant genotypes at one of the 9 loci, and the remaining seven are non-dominant genotypes; aggregate number 5 indicates nine dominant genotypes at one of the 9 loci, and the remaining seven are non-dominant genotypes; aggregate number 6 indicates three dominant genotypes at three of the 9 loci, and the remaining six are non-dominant genotypes; aggregate number 4 indicates four dominant genotypes at four of the 9 loci, and the remaining five are non-dominant genotypes; aggregate number 5 indicates nine dominant genotypes at one of the 9 loci, and the remaining seven are non-dominant genotypes; aggregate number 5 indicates nine dominant genotypes at one of the 9 loci, and the remaining seven are non-dominant genotypes; Five loci were dominant genotypes, and the remaining four were non-dominant genotypes; a cluster number of 6 indicates that six out of nine loci were dominant genotypes, and the remaining three were non-dominant genotypes; a cluster number of 7 indicates that seven out of nine loci were dominant genotypes, and the remaining two were non-dominant genotypes; a cluster number of 8 indicates that eight out of nine loci were dominant genotypes, and the remaining one was non-dominant genotype; a cluster number of 9 indicates that all nine out of nine loci were dominant genotypes; loci with a cluster number of 8 were not included in the main analysis due to the small sample size (n=3), and no samples were detected with a cluster number of 9.

[0072] Analysis of plant height at different numbers of aggregation sites revealed that for each additional dominant genotype, the average plant height decreased by 9.87 cm. When the number of aggregation sites increased from 0 to 7 dominant genotypes, the plant height decreased from 241.5 cm to 167.0 cm, a total decrease of 74.5 cm (Table 6 and...). Figure 1 ).

[0073] Table 6 shows the effect of nine-site polymerization on plant height.

[0074] Typical materials with different dominant plant height genotypes were selected for analysis, as shown in Table 7. A typical material with zero dominant plant height genotypes aggregated is Jing724 from group X, which has a relatively high plant height of 260.75 cm, typical of maize. A typical material with one dominant plant height genotype aggregated is D9H from group X, with a plant height of 239.50 cm, containing the dominant plant height genotype Z9450-535 (CC). A typical material with two dominant plant height genotypes aggregated is Qi319 from group P, with a plant height of 213.25 cm, containing the dominant plant height genotypes Z8710-8bp (aa) and Z7250-3093 (AA). A typical example of aggregating three dominant height genotypes is Jing404 from the Huanggai group, with a plant height of 188.50 cm. Its dominant height genotypes are Z3080-473 (GG), Z4970-229 (CC), and Z9450-535 (CC). A typical example of aggregating four dominant height genotypes is Zong3 from the Zi330 subgroup, with a plant height of 181.00 cm. Its dominant height genotypes are Z8710-8bp (aa), Z4970-229 (CC), Z8490-2184 (GG), and Z9460-698 (GG). A typical material exhibiting five dominant height genotypes is J1692R_254 from the Huang Gaiqun, with a plant height of 171.50 cm. Its dominant height genotypes are Z8710-8bp (aa), Z4970-229 (CC), Z7250-3093 (AA), Z8490-2184 (GG), and Z9450-535 (CC). A typical material exhibiting six dominant height genotypes is Shuang741 from the Huang Gaiqun, with a plant height of 166.50 cm. Its dominant height genotypes are Z8710-8bp (aa), Z7250-3093 (AA), Z8490-2184 (GG), Z9450-535 (CC), Z9460-698 (GG), and Z9730-406 (CC). The typical material that aggregates seven dominant plant height genotypes is the HYS of the Huanggai group, which has a plant height of 152.25 cm. The dominant plant height genotypes it contains are Z8710-8bp (aa), Z3080-473 (GG), Z7250-3093 (AA), Z7460-9928 (TT), Z8490-2184 (GG), Z9450-535 (CC), and Z9730-406 (CC).

[0075] Table 7 shows typical materials with different dominant genotypes for plant height.

[0076] The above results indicate that Among all nine loci, maize plants carrying a higher number of dominant genotypes were shorter or had a lower candidate height than maize plants carrying fewer dominant genotypes.

[0077] The number of loci carrying the dominant genotype is the number of loci carrying the dominant genotype out of the nine loci.

[0078] Specifically as follows: Among all 9 loci, maize plants carrying 7 dominant genotypes had lower or candidate lower plant heights than maize plants carrying 6, 5, 4, 3, 2, 1, or 0 dominant genotypes.

[0079] Alternatively, maize plants carrying 6 dominant genotypes are shorter or candidate plants are shorter than maize plants carrying 5, 4, 3, 2, 1 or 0 dominant genotypes.

[0080] Alternatively, maize plants carrying 5 dominant genotypes are shorter or candidate plants are shorter than maize plants carrying 4, 3, 2, 1 or 0 dominant genotypes.

[0081] Alternatively, maize plants carrying 4 dominant genotypes are shorter or candidate plants are shorter than maize plants carrying 3, 2, 1 or 0 dominant genotypes.

[0082] Alternatively, maize plants carrying 3 dominant genotypes are shorter or candidate plants are shorter than maize plants carrying 2, 1 or 0 dominant genotypes.

[0083] Alternatively, maize plants carrying 2 dominant genotypes are shorter or lower than maize plants carrying 1 or 0 dominant genotypes.

[0084] Alternatively, the height of maize plants carrying a dominant genotype of 1 is lower than or lower than the height of maize plants carrying a dominant genotype of 0.

[0085] Therefore, the plant height of maize can be identified or assisted in by detecting the genotype at nine loci in maize. The specific methods are as follows: 1) Extract genomic DNA from the sample to be tested; 2) Using genomic DNA as a template, KASP detection was performed using primers for each site shown in Table 4 to obtain amplification products.

[0086] The genotyping results were read using the PheraStar fluorescence scanner, and the genotypes were output using Kraken software.

[0087] Among all nine loci, maize plants carrying a higher number of dominant genotypes were shorter or had a lower candidate height than maize plants carrying fewer dominant genotypes.

[0088] The nine sites are Z3080-473, Z4970-229, Z7250-3093, Z7460-9928, Z8490-2184, Z8710-8bp, Z9450-535, Z9460-698, and Z9730-406. The number of loci carrying the dominant genotype is the number of loci carrying the dominant genotype out of the nine loci.

[0089] Example 3: Sites where lowering the yield does not reduce production To identify which of the nine loci reduced plant height without affecting yield, yield data (grain weight per ear, KWPE, in g) from 2019 and 2020 were collected from these 92 materials, and a set of optimal unbiased estimates was obtained. Student's t-test statistical analysis was performed on these nine plant height loci and yield to obtain the effect value of each locus on yield (Table 8).

[0090] The results showed that six loci had no significant effect on yield: Z3080-473, Z4970-229, Z7250-3093, Z7460-9928, Z9450-535, and Z9730-406. The remaining loci had a significant or highly significant effect on plant height.

[0091] Table 8 shows the effects of nine significantly related loci on yield.

[0092] Note: ** indicates P<0.01, *** indicates P<0.001, and ns indicates no significance.

[0093] By integrating the effects of these 9 loci on plant height and yield, these loci were divided into two categories: 6 core loci with "no significant yield reduction due to stalk reduction" and 3 loci with "yield reduction due to stalk reduction" (Table 9).

[0094] In breeding, more attention is paid to loci where stalk reduction does not significantly reduce yield, namely Z3080-473 (GG), Z4970-229 (CC), Z7250-3093 (AA), Z7460-9928 (CC), Z9450-535 (CC), and Z9730-406 (CC). The genes containing these loci are respectively ZmMADS69 , GA20ox1 , ZmELF3.2 , ZmEMF2b / 2 2 , ZmLUX3 , ZmDWF4Of these six loci, the Z3080-473 (GG) locus is the most recommended because it has a very significant effect on reducing plant height by 27.3 cm, while also enhancing yield.

[0095] Table 9 summarizes the effects of the nine loci on plant height and yield.

[0096] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. The application of substances used to detect the genotypes of nine loci in the maize genome, namely Z3080-473, Z4970-229, Z7250-3093, Z7460-9928, Z8490-2184, Z8710-8bp, Z9450-535, Z9460-698, and Z9730-406, in any of the following: A1) To identify or assist in the identification of maize plant height; A2) Screening or assisting in the screening of short-stalked corn; A3) Breeding dwarf corn; A4) Maize genetics and breeding; The locus Z3080-473 is the 101st position of sequence 1, and its genotype is AA, GG or AG; The site Z4970-229 is the 101st position of sequence 2, and its genotype is TT, GG or TG; The locus Z7250-3093 is the 101st position of sequence 3, and its genotype is AA, GG or AG; The locus Z7460-9928 is the 101st position of sequence 4, and its genotype is CC, TT or CT. The site Z8490-2184 is the 101st position of sequence 5, and its genotype is AA, GG or AG; The site Z8710-8bp is located at positions 101-108 of sequence 6, and its genotype is aa, gg, or ag; The site Z9450-535 is the 101st position of sequence 7, and its genotype is GG, CC or GC; The locus Z9460-698 is the 101st position of sequence 8, and its genotype is AA, GG or AG; The locus Z9730-406 is the 101st position of sequence 9, and its genotype is CC, AA or CA.

2. The application according to claim 1, characterized in that: The substance is either B1 or B2. B1) Primer set; B2) PCR reagents or kits containing the complete set of primers described above; The primer set includes primer F, primer H and primer C; The nucleotide sequence of primer F includes any one of sequences 10-18, obtained by removing 21 bp from the 5' end; The nucleotide sequence of primer H includes any one of sequences 19-27, obtained by removing 21 bp from the 5' end; The nucleotide sequence of primer C is any one of sequences 28-36.

3. The application according to claim 2, characterized in that: The nucleotide sequence of primer F is any one of sequences 10-18; The nucleotide sequence of primer H is any one of sequences 19-27.

4. The application of the substance used to detect the genotype at the Z3080-473 locus in the maize genome in any of the following: C1) Identification or auxiliary identification of maize plant height; C2) Screening or assisted screening of short-stalked corn that does not reduce yield; C3) Selecting and breeding short-stalked corn varieties that do not reduce yield; C4) Maize genetics and breeding; The Z3080-473 position is the 101st position in sequence 1; The genotype at the Z3080-473 locus is GG, AA, or AG.

5. The application according to claim 4, characterized in that: The substance is either B1 or B2. B1) Primer set; B2) PCR reagents or kits containing the complete set of primers described above; The primer set includes primer F, primer H, and primer C; The nucleotide sequence of primer F includes sequence 10; The nucleotide sequence of primer H includes sequence 19; The nucleotide sequence of primer C is sequence 28.

6. Any of the following substances: The primer set as described in claim 2, 3, or 5; Alternatively, a PCR reagent or kit containing the primer set as described in claim 2, 3, or 5.

7. The use of the primer set, PCR reagent, or kit described in claim 6 in any of the following: D1) Identify or assist in identifying maize plant height; D2) Screening or assisted screening of short-stalked or short-stalked corn that does not reduce yield; D3) Select and breed short-stalk or short-stalk corn that does not reduce yield; D4) Maize genetics and breeding.

8. Any of the following methods: E1) A method for identifying or assisting in the identification of maize plant height, comprising the following steps: detecting the genotypes of nine loci in the maize genome: Z3080-473, Z4970-229, Z7250-3093, Z7460-9928, Z8490-2184, Z8710-8bp, Z9450-535, Z9460-698, and Z9730-406; and, among all nine loci, the maize plant height of those carrying a higher number of dominant genotypes is lower or a candidate lower than that of those carrying a lower number of dominant genotypes. The dominant genotypes at the loci Z3080-473, Z4970-229, Z7250-3093, Z7460-9928, Z8490-2184, Z8710-8bp, Z9450-535, Z9460-698, and Z9730-406 are, respectively, GG, CC, AA, TT, GG, aa, CC, GG, and CC. E2) A method for identifying or assisting in the identification of maize plant height, comprising the following steps: detecting the genotype at the Z3080-473 locus in the maize genome, The plant height of maize with the genotype GG at the Z3080-473 locus is lower or candidate lower than that of maize with the genotype AA at the Z3080-473 locus.

9. The method according to claim 8, characterized in that: The method for detecting genotypes at various loci in the maize genome includes the following steps: using the maize genome to be tested as a template, performing a KASP reaction with primers corresponding to each locus in claim 2, 3, or 4 to obtain the genotype.

10. A method for breeding dwarf maize, comprising the following steps: breeding maize varieties carrying a large number of dominant genotypes as described in claim 8 or 9; Alternatively, a method for breeding dwarf maize may be provided, comprising the following steps: breeding maize with the genotype GG at the Z3080-473 locus as described in claim 8 or 9.

Images