A molecular marker related to the content of high grain amylopectin and its application

Abstract

The application belongs to the technical field of molecular biology and plant molecular marker assisted breeding, and particularly relates to a molecular marker related to a grain amylopectin content trait of sorghum and application thereof, the molecular marker related to the grain amylopectin content trait of sorghum comprises a SNP site located at position 1900642 of chromosome 10 of a sorghum genome, and the polymorphism of the SNP site is G / C; the sorghum genome is derived from a red sorghum.The application screens a SNP site significantly related to the grain amylopectin content trait of sorghum based on whole genome association analysis, and develops a molecular marker based on the site, so that the molecular marker can quickly and accurately identify the high and low content of the grain amylopectin of sorghum, and the breeding efficiency of new varieties of sorghum can be further improved by using the molecular marker assisted breeding technology.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology and plant molecular marker-assisted breeding research technology, specifically involving a molecular marker related to the amylopectin content trait of sorghum grains and its application. Background Technology

[0002] Sorghum (Sorghumbicolor) is one of the world's five major cereal crops, after rice, wheat, corn, and oats. The starch characteristics of sorghum are closely related to the quality of Maotai-flavor liquor. High amylopectin content in sorghum grains makes it easier to achieve the desired mellowing, clarifying, and drying processes during the fermentation of Maotai-flavor liquor. It also contributes to higher yields, higher quality, and more flavor compounds in the liquor. Furthermore, the brewing process of Maotai-flavor liquor typically involves nine rounds of steaming, eight rounds of fermentation, and seven rounds of distillation. The high amylopectin content in sorghum grains facilitates the multiple rounds of steaming and fermentation in the traditional Maotai-flavor liquor brewing process.

[0003] Marker-assisted selection (MAG) allows for rapid and accurate analysis of an individual's genetic makeup at the molecular level, enabling direct genotypic selection for molecular breeding. It is unaffected by environmental conditions and boasts high selection accuracy. Therefore, developing molecular markers associated with amylopectin content in sorghum grains is of great significance. Summary of the Invention

[0004] The purpose of this invention is to provide a molecular marker related to the amylopectin content trait in sorghum grains and its application. The novel molecular marker provided in this application can rapidly and effectively identify high / low amylopectin content in sorghum grains, and the use of this molecular marker-assisted breeding technology can further improve the breeding efficiency of new sorghum varieties.

[0005] According to a first aspect of the present invention, the present invention provides a molecular marker related to the amylopectin content trait of sorghum grains, characterized in that the molecular marker includes an SNP site located at position 1900642 on chromosome 10 of the sorghum genome, the polymorphism of the SNP site being G / C; the sorghum genome is derived from red-tasseled sorghum.

[0006] In some embodiments of the present invention, the molecular marker comprises a nucleotide sequence as shown in SEQ ID NO:1; the nucleotide sequence as shown in SEQ ID NO:1 has a polymorphism at position 101 from the 5' end, and the polymorphism is G / T.

[0007] According to a second aspect of the invention, the invention also provides a primer pair for amplifying molecular markers as described in any of the first aspects of the invention.

[0008] In some embodiments of the present invention, the primer pairs include a forward competitive primer as shown in SEQ ID NO.2, a forward competitive primer as shown in SEQ ID NO.3, and a reverse universal primer as shown in SEQ ID NO.4.

[0009] In some embodiments of the present invention, the primer pair is a KASP primer pair.

[0010] According to a third aspect of the present invention, the present invention also provides a kit comprising a molecular marker as described in any of the first aspects of the present invention or a primer pair as described in any of the second aspects of the present invention.

[0011] According to a fourth aspect of the invention, the invention also provides the application of a molecular marker as described in any of the first aspects of the invention, or a primer pair as described in any of the second aspects of the invention, or / or a kit as described in the third aspect of the invention, wherein the application is any one of (b1) to (b4): (b1) To identify or assist in the identification of the amylopectin content in the sorghum grains to be tested; (b2) Screening or assisted screening of sorghum varieties with high amylopectin content in grains; (b3) Screening or assisted screening of sorghum varieties with low amylopectin content in grains; (b4) Sorghum breeding.

[0012] Specifically, in some embodiments of the present invention, the sorghum varieties with higher amylopectin content correspond to an amylopectin content range of 80% or higher. Specifically, in some embodiments of the present invention, the sorghum varieties with lower amylopectin content have an amylopectin content range of less than 80% (excluding 80%).

[0013] According to a fifth aspect of the invention, the invention also provides the use of a substance for detecting polymorphisms or genotypes of SNP sites in the sorghum genome in any of the following (a1) to (a8): (a1) To identify or assist in the identification of the amylopectin content in the sorghum grains to be tested; (a2) Screening or assisted screening of sorghum varieties with high amylopectin content in grains; (a3) Screening or assisted screening of sorghum varieties with low amylopectin content in grains; (a4) Sorghum breeding; (a5) Prepare products for identification or auxiliary identification of the amylopectin content in sorghum grains to be tested; (a6) Prepare products from sorghum varieties with high amylopectin content in the grains, either by screening or by assisting in screening. (a7) Prepare products from sorghum varieties with low amylopectin content in grains for screening or auxiliary screening; (a8) Preparation of sorghum breeding products; The SNP site is located at position 1900642 on chromosome 10 in the sorghum genome, and the polymorphism of the nucleotide corresponding to this site is G / C; and / or, the SNP site is the nucleotide corresponding to position 101 from the 5' end of the nucleotide sequence shown in SEQ ID NO.1, and the polymorphism of this nucleotide is G / C.

[0014] Specifically, in some embodiments of the present invention, the sorghum varieties with higher amylopectin content correspond to an amylopectin content range of 80% or higher. Specifically, in some embodiments of the present invention, the sorghum varieties with lower amylopectin content have an amylopectin content range of less than 80% (excluding 80%).

[0015] In some embodiments of the present invention, the substance is c1, c2, or c3: c1 is a primer composition for amplifying sorghum genomic DNA fragments including the SNP sites; c2 is a PCR reagent containing the primer composition described in c1; c3 is a kit containing the primer composition described in c1 or the PCR reagent described in c2.

[0016] In some embodiments of the present invention, the primer composition includes a forward competitive primer as shown in SEQ ID NO.2, a forward competitive primer as shown in SEQ ID NO.3, and a reverse universal primer as shown in SEQ ID NO.4.

[0017] According to a sixth aspect of the present invention, the present invention also provides a method for identifying or assisting in the identification of amylopectin content in sorghum grains to be tested, characterized in that the method includes P1 or P2; P1 includes the following steps: The genotypes of SNP sites in the genome of the sorghum to be tested are detected, and the content of amylopectin in sorghum grains is identified or assisted in the identification based on the genotypes. The SNP site is located at position 1900642 on chromosome 10 in the sorghum genome, and the polymorphism of the nucleotide corresponding to this site is G / C; and / or, the SNP site is the nucleotide corresponding to position 101 from the 5' end of the nucleotide sequence shown in SEQ ID NO.1, and the polymorphism of this nucleotide is G / C; The genotype of the SNP locus is GG or TT, where GG is the homozygous type of the SNP locus being G, and TT is the homozygous type of the SNP locus being T; the amylopectin content in the sorghum grains tested with the genotype GG at the SNP locus is higher than that in the sorghum grains tested with the genotype TT at the SNP locus. P2 includes the following steps: Using the genomic DNA of the sorghum to be tested as a template, PCR amplification was performed using the primer pair described in claim 3 to obtain the PCR amplification product; The PCR amplification products were subjected to fluorescence signal scanning, and the amylopectin content in sorghum grains was identified or used to assist in the identification of the fluorescence signal scanning results. The primer pairs include a forward competitive primer as shown in SEQ ID NO.2, a forward competitive primer as shown in SEQ ID NO.3, and a reverse universal primer as shown in SEQ ID NO.4.

[0018] In some embodiments of the present invention, the identification or auxiliary identification of amylopectin content in sorghum grains based on fluorescence signal scanning results includes: When the PCR amplification product shows a fluorescent signal of the positive competitive primer as shown in SEQ ID NO.2, but does not show a fluorescent signal of the positive competitive primer as shown in SEQ ID NO.3, the sorghum to be tested is a sorghum variety with a high content of amylopectin in the grain and a genotype of GG. When the PCR amplification product shows a fluorescent signal of the positive competitive primer as shown in SEQ ID NO.3, but does not show a fluorescent signal of the positive competitive primer as shown in SEQ ID NO.2, the sorghum to be tested is a sorghum variety with low amylopectin content in the grain and genotype TT. When the PCR amplification product simultaneously shows the fluorescence signal of the positive competitive primer shown in SEQ ID NO.2 and the fluorescence signal of the positive competitive primer shown in SEQ ID NO.3, the sorghum to be tested is a sorghum variety with extremely low amylopectin content in the grain and genotype GT.

[0019] Compared with the prior art, the present invention has the following beneficial effects: This invention identifies a single SNP locus significantly associated with amylopectin content in sorghum grains based on genome-wide association analysis. A molecular marker is developed based on this locus, enabling rapid and accurate identification of amylopectin content in sorghum grains. Compared to other SNP markers identified during the analysis process, the SNP marker provided by this invention allows for more accurate genotyping of sorghum varieties with different amylopectin contents and identification of different amylopectin contents in sorghum grains. This marker-assisted breeding technology can further improve the breeding efficiency of new sorghum varieties. Attached Figure Description

[0020] Figure 1 Harmanton plot for genome-wide association analysis of amylopectin content in sorghum grains; Figure 2 This image shows the genotyping results of 264 natural population materials detected using the Chr010_1900642 marker. Red represents the FAM fluorescent group, indicating a higher amylopectin content in sorghum grains; blue represents the HEX fluorescent group, indicating a lower amylopectin content in sorghum grains; and green represents the simultaneous presence of both FAM and HEX fluorescent signals, indicating a heterozygous genotype with a lower amylopectin content in sorghum grains. Detailed Implementation

[0021] The following specific embodiments further illustrate the technical solution of the present invention. These specific embodiments do not represent a limitation on the scope of protection of the present invention. Non-essential modifications and adjustments made by others based on the concept of the present invention still fall within the scope of protection of the present invention.

[0022] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0023] Example 1: Development of molecular markers related to amylopectin content in sorghum grains I. Phenotypic Survey: This invention uses 977 collected and preserved sorghum germplasm resources as experimental materials for phenotypic investigation to obtain the amylopectin content of each sorghum experimental material. The specific steps are as follows: In 2024, sorghum was planted in Sanya, Hainan. The plot length (the length of each experimental plot along the planting row direction) was 2m, the row spacing was 60cm, and the plant spacing was 20cm. Manual sowing was carried out, and routine field management was carried out in a timely manner. During the heading stage, 5 sorghum ears from each line were selected for self-pollination using sodium sulfate paper bags. When pollination was completed for the whole ear, the paper bags were replaced with mesh bags until the seeds matured. After harvesting, the grains were dried and threshed. 200g of plump and undamaged grains were selected, and the amylopectin content was determined according to the national standard GB / T 15683-2008 to obtain the amylopectin content of the 977 sorghum experimental materials.

[0024] II. SNP Detection: (1) Whole-genome DNA extraction: 977 sorghum germplasm samples at the three-leaf stage were collected. DNA was extracted from the three-leaf stage samples using the CTAB method. The DNA extraction steps were as follows: 1) The three-leaf stage samples were placed in 2ml centrifuge tubes, frozen in liquid nitrogen, and ground into powder using a tissue homogenizer; 2) 800ul of DNA was added to the centrifuge tubes. 1) Place the CTAB extraction solution in a 2ml centrifuge tube and incubate at 65℃ for 30 minutes, gently shaking 5-8 times during this period to ensure complete DNA lysis; 2) Add 800ul of chloroform-isoamyl alcohol (volume ratio 24:1) and gently shake for 10 minutes; 3) Centrifuge at 3000g for 10 minutes and transfer 500ul of the supernatant to a clean 96-well plate (note the corresponding number); 4) Add 500ul of isopropanol (pre-frozen at -20℃) and gently shake to mix. White DNA flocculents will be observed. Incubate at -20℃ for 20 minutes to increase DNA yield; 5) Centrifuge at 3000g for 10 minutes and discard the supernatant. Wash the precipitate 2-3 times with 70% ethanol (pre-frozen at -20℃) and air dry until there is no alcohol odor; 6) Add 300ul of ddH2O to dissolve the DNA to obtain the genomic DNA of the corresponding sorghum sample and incubate at -20℃. (2) Detection of the concentration and purity of the extracted whole genomic DNA: The concentration and purity of the extracted whole genomic DNA were determined using 0.1% agarose gel electrophoresis and Nanodrop 2000, respectively. The steps for detecting DNA quality using 1% agarose gel electrophoresis are as follows: 1) Weigh 1.00g of agarose and put it into an Erlenmeyer flask; 2) Add 100ml of agarose gel to the Erlenmeyer flask. 1×TAE; 3) Heat to dissolve, shaking 1-2 times to ensure the agarose is fully dissolved; 4) When the temperature of the conical flask drops to about 60℃, add 10μl of nucleic acid dye; 5) Pour the agarose solution into the mold with the comb inserted, and wait for the agarose to solidify into a gel; 6) Remove the comb, add 5μl of DNA sample to the well, and perform electrophoresis with a current I=100mA and a voltage V=120V for 20-30 minutes; 7) After electrophoresis, use a GelDoxXR gel imaging system to photograph and save the electrophoresis results; The steps for determining the concentration of sample DNA are as follows: Use a nucleic acid protein analyzer to determine the concentration of the DNA sample. The DNA should be in the OD range. 260 It exhibits a significant absorption peak, OD 260 When OD = 1, it is equivalent to more than 50 μg / ml double-stranded DNA, when OD 260 / OD 280 When the pH is 1.7–1.9, the DNA purity of the sample is relatively high. (3) Sequencing: DNA samples that have passed quality inspection are used to construct resequencing libraries and sequenced using the DNBSEQ-T7RS platform; (4) SNP screening: Using the genome sequence of the sorghum variety Hongyingzi as a reference, SNP screening was performed using bwa and GATK software. The obtained SNP typing results were filtered using vcftools software (the filtering conditions were: deletion rate less than 20%, secondary allele frequency greater than 5% of 2 alleles) to obtain the corresponding SNP markers.

[0025] III. Genome-wide association analysis: Using the aforementioned 977 sorghum germplasm resources as the research object, the SNP markers corresponding to these 977 sorghum germplasm resources were used as genotypic data, and the amylopectin content of these 977 sorghum germplasm resources was used as phenotypic data. GWAS analysis was performed on these 977 sorghum germplasm resources using GAPIT 3.0 software. All parameters were set to default values ​​during the GWAS analysis, and the threshold for significantly associated SNPs was LOD (logarithmofodds) ≥ 10.0. The results are as follows: Figure 1 The Harmanton plot shows the genome-wide association analysis of the amylopectin content trait in sorghum grains; based on Figure 1 The analysis results show that the QTL associated with the amylopectin content of sorghum grains is located on chromosome 10, and the significant association interval is 1897326-1960598.

[0026] IV. SNP site screening: Based on the GWAS analysis results, SNP data within the significantly associated regions were further screened, ultimately identifying four SNP loci (the screening criteria for SNP loci were: no other SNPs within 100 bp upstream and downstream of the target SNP locus, and compliance with the KASP design criteria). Information on the four selected SNP loci is shown in Table 1. Table 1 SNP locus information

[0027] Example 2: Development and Application of Molecular Markers The development and application of corresponding molecular markers based on the SNP sites screened in Example 1 are as follows: I. KASP Primer Design Based on the SNP sites shown in Table 1, Tbtools was used to retrieve the upstream and downstream 100bp sequence information corresponding to each of the four SNP sites shown in Table 1 (where the 100bp sequence information corresponding to the Chr10_1900642 site is shown in SEQ ID NO.1). Primers were then designed based on this sequence information using Primer Picker Lite for KASPar v0.106 (https: / / www.biosearchtech.com / ). Furthermore, primer specificity was detected using a genomic database to screen primer sequences that could specifically recognize the target site and meet the requirements of PCR amplification as target amplification primers. These target amplification primers were then converted into KASP primers. Each KASP primer set consists of three sequences: forward competitive primer 1: FAM fluorescent tag sequence + amplification primer sequence; forward competitive primer 2: HEX fluorescent tag sequence + amplification primer sequence; and reverse universal primer: amplification primer sequence. The KASP primer set sequence information obtained using this method is shown in Table 2. Table 2. KASP primer information for each molecular marker

[0028] Note: Underlined text indicates fluorescent sequence tag. II. Whole Genome DNA Extraction Whole-genome DNA was extracted from 264 sorghum samples using the CTAB method. The specific steps are as follows: 1) Young leaves of the corresponding sorghum varieties were placed in 2ml centrifuge tubes, frozen in liquid nitrogen, and ground into powder using a tissue homogenizer; 2) Three-leaf stage materials were placed in 2ml centrifuge tubes, frozen in liquid nitrogen, and ground into powder using a tissue homogenizer; 1) Place the CTAB extraction solution in a 2ml centrifuge tube and incubate at 65℃ for 30 minutes, gently shaking 5-8 times during this period to ensure complete DNA lysis; 2) Add 800ul of chloroform-isoamyl alcohol (volume ratio 24:1) and gently shake for 10 minutes; 3) Centrifuge at 3000g for 10 minutes and transfer 500ul of the supernatant to a clean 96-well plate (note the corresponding number); 4) Add 500ul of isopropanol (pre-frozen at -20℃) and gently shake to mix. White DNA flocculents will be observed. Incubate at -20℃ for 20 minutes to increase DNA yield; 5) Centrifuge at 3000g for 10 minutes and discard the supernatant. Wash the precipitate 2-3 times with 70% ethanol (pre-frozen at -20℃) and air dry until there is no alcohol odor; 6) Add 300ul of ddH2O to dissolve the DNA to obtain the genomic DNA of the corresponding sorghum sample and incubate at -20℃. III. PCR Amplification Based on the KASP primer pairs designed in step one, the whole genome DNA corresponding to the 264 sorghum samples extracted in step two was amplified by PCR, and the corresponding PCR amplification products were obtained: The PCR reaction system consisted of a total volume of 10 μL, including 10.5 μL of sample DNA (1100 ng / μL), 5 μL of 10× KASPMasterMix (LGCGenomics, Hoddeston, UK), 0.14 μL of KASPMasterMix, and ddH2O. 10 O10.36μL; wherein, the KASPAssayMix preparation method is as follows: each 100μL KASPAssayMix contains 110μL each of two forward competitive primers at a concentration of 100μM, 30μL of reverse universal primer at a concentration of 100μM, and ddH 10 O46μL; The PCR reaction program was as follows: 95℃ heat activation for 15 min; 95℃ denaturation for 100 s, annealing and extension at 61-55℃ for 60 s (10 Touch-down cycles, decreasing the temperature by 0.6℃ each cycle); 95℃ denaturation for 100 s, 55℃ annealing for 60 s, 107 cycles; and incubation of the amplified products at 105℃. IV. Results Analysis: The PCR amplification products obtained after the above PCR amplification were scanned for endpoint fluorescence signals and genotyped using the Applied Biosystems ABIViia7 Real Time PCR System (i.e., ViiA™7 real-time fluorescence quantitative PCR system, ThermoScientific (USA)). In the obtained endpoint fluorescence signal scan results, the fluorescence type of samples with fluorescence signal intensity values ​​concentrated near the X-axis and displaying red represents the FAM fluorescent group, indicating a sorghum genotype with high amylopectin content; the fluorescence type of samples with fluorescence signal intensity values ​​concentrated near the Y-axis and displaying blue represents the HEX fluorescent group, indicating a sorghum genotype with low amylopectin content.

[0029] The typing results of the above four molecular markers were statistically analyzed. Table 3 shows the typing results using Chr10_1900055, Chr10_1892629, and Chr10_1894387. As can be seen from the results in Table 3, the Chr10_1900055 molecular marker could not be identified, while the typing effects of Chr10_1892629 and Chr10_1894387 molecular markers were poor, making it impossible to type all sorghum samples.

[0030] Table 3. Genotyping results for each molecular marker

[0031] Note: "Unknown" in the table indicates that the corresponding molecular marker cannot be used to genotype the sorghum sample.

[0032] The results of the amplification and typing of 264 sorghum samples based on the Chr010_1900642 molecular marker are shown in Table 4. Figure 2 As shown (where, Figure 2 (Based on the results of three separate typing operations on 264 sorghum samples), according to Figure 2 The results shown indicate that the KASP primers designed based on the Chr010_1900642 marker were used to amplify the whole-genome DNA corresponding to the 264 sorghum samples. The genotyping results showed that the 264 sorghum samples were clearly divided into two genotypes, such as... Figure 2 As shown, the fluorescence type of sorghum samples with fluorescence signal intensity values ​​aggregated near the X-axis and displaying red represents the FAM fluorescent group, which is a sorghum genotype with high amylopectin content, genotype GG(A), totaling 160 samples with an average amylopectin content of 96.96%; the fluorescence type of sorghum samples with fluorescence signal intensity values ​​aggregated near the Y-axis and displaying blue represents the HEX fluorescent group, which is a sorghum genotype with low amylopectin content, genotype TT(B), totaling 104 samples with an average amylopectin content of 69.27%.

[0033] Table 4

[0034] Table 5

[0035] Combination Figure 2 As shown in Table 4, the molecular markers developed based on this invention can accurately classify the genotypes of 264 sorghum samples. Furthermore, the statistical analysis results shown in Table 5 further demonstrate that there are significant differences in the amylopectin content of the grains of the two genotype sorghum samples, which further proves the practical application value of the molecular markers provided by this invention.

[0036] It is understood that the present invention has been described through some embodiments, and those skilled in the art will recognize that various changes or equivalent substitutions can be made to these features and embodiments without departing from the scope of the invention. Furthermore, under the teachings of the present invention, these features and embodiments can be modified to adapt to specific situations and materials without departing from the scope of the invention. Therefore, the present invention is not limited to the specific embodiments disclosed herein, and all embodiments falling within the scope of the claims of the present invention are protected by the present invention.

[0037] sequence list SEQ ID NO.1 (Sequence information of the upstream and downstream 100bp corresponding to the Chr010_1900642 marker site): TTTGTTCCAAAATGGCCGTATTTTGCGCTTGGAACGGTGTGCTATACAAATTTGTGAAGACCTTAAGCAGCTAGGCTTCCTGCCTTCCTAGCTAATAAAAG / TTCTAAATGAACAAATGTTTCCCCAATTATGTCAAGTAGTTGGGTCTTTCCCATTTTCCAAAAAGTAATAAACGTAAGCACAACAACTTGCAAACAATAAA SEQ ID NO.2 (FAM-F1 corresponding to the Chr010_1900642 marker site): GAAGGTGACCAAGTTCATGCTTTCCTGCCTTCCTAGCTAATAAAAG; SEQ ID NO.3 (HEX-F2 corresponding to the Chr010_1900642 marker site) GAAGGTCGGAGTCAACGGATTTTCCTGCCTTCCTAGCTAATAAAAT SEQ ID NO.4 (Com-R corresponding to the Chr010_1900642 marker site) GTTTGCAAGTTGTTGTGCTTACG

Claims

1. A molecular marker associated with the amylopectin content trait in sorghum grains, characterized in that, The molecular marker includes an SNP site located at position 1900642 on chromosome 10 of the sorghum genome, and the polymorphism of the SNP site is G / C; the sorghum genome is derived from red tassel sorghum.

2. The molecular marker according to claim 1, characterized in that, The molecular marker comprises a nucleotide sequence as shown in SEQ ID NO:1; the nucleotide sequence as shown in SEQ ID NO:1 is polymorphic at position 101 from the 5' end, and the polymorphism is G / T.

3. A primer pair, characterized in that, Used to amplify the molecular markers as described in any one of claims 1-2.

4. The primer pair according to claim 3, characterized in that, The primer pair includes a forward competitive primer as shown in SEQ ID NO.2, a forward competitive primer as shown in SEQ ID NO.3, and a reverse universal primer as shown in SEQ ID NO.4; and / or, the primer pair is a KASP primer pair.

5. A reagent kit, characterized in that, It includes the molecular marker as described in any one of claims 1-2 or / and the primer pair as described in any one of claims 3-4.

6. The application of the molecular marker as described in any one of claims 1-2 or the primer pair as described in any one of claims 3-4 or the kit as described in claim 5, wherein the application is any one of (b1)-(b4): (b1) To identify or assist in the identification of the amylopectin content in the sorghum grains to be tested; (b2) Screening or assisted screening of sorghum varieties with high amylopectin content in grains; (b3) Screening or assisted screening of sorghum varieties with low amylopectin content in grains; (b4) Sorghum breeding.

7. Application of substances for detecting SNP polymorphisms or genotypes in the sorghum genome in any of the following (a1) to (a8): (a1) To identify or assist in the identification of the amylopectin content in the sorghum grains to be tested; (a2) Screening or assisted screening of sorghum varieties with high amylopectin content in grains; (a3) Screening or assisted screening of sorghum varieties with low amylopectin content in grains; (a4) Sorghum breeding; (a5) Prepare products for identification or auxiliary identification of the amylopectin content in sorghum grains to be tested; (a6) Prepare products from sorghum varieties with high amylopectin content in the grains, either by screening or by assisting in screening. (a7) Prepare products from sorghum varieties with low amylopectin content in grains for screening or auxiliary screening; (a8) Preparation of sorghum breeding products; The SNP site is located at position 1900642 on chromosome 10 in the sorghum genome, and the polymorphism of the nucleotide corresponding to this site is G / C; and / or, the SNP site is the nucleotide corresponding to position 101 from the 5' end of the nucleotide sequence shown in SEQ ID NO.1, and the polymorphism of this nucleotide is G / C.

8. The application according to claim 7, characterized in that, The substance is c1, c2, or c3: c1 is a primer composition for amplifying sorghum genomic DNA fragments including the SNP sites; c2 is a PCR reagent containing the primer composition described in c1; c3 is a kit containing the primer composition described in c1 or the PCR reagent described in c2.

9. The application according to claim 7, characterized in that, The primer composition includes a forward competitive primer as shown in SEQ ID NO.2, a forward competitive primer as shown in SEQ ID NO.3, and a reverse universal primer as shown in SEQ ID NO.

4.

10. A method for identifying or assisting in the identification of amylopectin content in sorghum grains, characterized in that, The method includes P1 or P2; P1 includes the following steps: The genotypes of SNP sites in the genome of the sorghum to be tested are detected, and the content of amylopectin in sorghum grains is identified or assisted in the identification based on the genotypes. The SNP site is located at position 1900642 on chromosome 10 in the sorghum genome, and the polymorphism of the nucleotide corresponding to this site is G / C; and / or, the SNP site is the nucleotide corresponding to position 101 from the 5' end of the nucleotide sequence shown in SEQ ID NO.1, and the polymorphism of this nucleotide is G / C; The genotype of the SNP locus is GG or TT, where GG is the homozygous type of the SNP locus being G, and TT is the homozygous type of the SNP locus being T; the amylopectin content in the sorghum grains tested with the genotype GG at the SNP locus is higher than that in the sorghum grains tested with the genotype TT at the SNP locus. P2 includes the following steps: Using the genomic DNA of the sorghum to be tested as a template, PCR amplification was performed using the primer pair described in claim 3 to obtain the PCR amplification product; The PCR amplification products were subjected to fluorescence signal scanning, and the amylopectin content in sorghum grains was identified or used to assist in the identification of the fluorescence signal scanning results. The primer pairs include the forward competitive primer shown in SEQ ID NO.2, the forward competitive primer shown in SEQ ID NO.3, and the reverse universal primer shown in SEQ ID NO.4; And / or, the identification or auxiliary identification of amylopectin content in sorghum grains based on fluorescence signal scanning results includes: When the PCR amplification product shows a fluorescent signal of the positive competitive primer as shown in SEQ ID NO.2, but does not show a fluorescent signal of the positive competitive primer as shown in SEQ ID NO.3, the sorghum to be tested is a sorghum variety with a high content of amylopectin in the grain and a genotype of GG. When the PCR amplification product shows a fluorescent signal of the positive competitive primer as shown in SEQ ID NO.3, but does not show a fluorescent signal of the positive competitive primer as shown in SEQ ID NO.2, the sorghum to be tested is a sorghum variety with low amylopectin content in the grain and genotype TT. When the PCR amplification product simultaneously shows the fluorescence signal of the positive competitive primer shown in SEQ ID NO.2 and the fluorescence signal of the positive competitive primer shown in SEQ ID NO.3, the sorghum to be tested is a sorghum variety with extremely low amylopectin content in the grain and genotype GT.

Images