Molecular marker of wheat flag leaf angle dominant gene site qla.nau-5d, primer thereof and application

Abstract

This invention belongs to the field of crop breeding and relates to a major gene locus for the flag leaf angle in wheat. Qla.nau-5D Molecular markers, their primers, and applications. The molecular marker WGRC8163 and... Qla.nau-5D Tight linkage. The upstream and downstream primer sequences for amplifying the molecular marker are shown in SEQ ID NO.1 and SEQ ID NO.2. Wheat was amplified using the molecular marker; if the product size was 164 bp, then the wheat sample contained... Qla.nau-5D If it is 174 bp, then it does not contain Qla.nau-5D Major gene loci were detected using primers labeled WGRC8163. Qla.nau-5D It can be determined Qla.nau-5D The presence and prediction of the wheat flag leaf angle can be used to quickly screen for those carrying [certain pathogens]. Qla.nau-5D The plants were used for the breeding of wheat varieties with superior plant types.

Description

Technical Field

[0001] This invention belongs to the field of crop breeding, specifically relating to a molecular marker for the major gene locus Qla.nau-5D of the flag leaf angle in wheat, its primers, and its applications. Technical Background

[0002] Wheat yield formation is closely related to plant architecture, and the leaf angle is a key trait determining wheat plant architecture. The smaller the angle between the leaf and the stem, the more upright or upward-pointing the leaves, resulting in a compact plant architecture; when the angle increases, the leaves become horizontal or even drooping, leading to a looser plant architecture. In wheat production, upright leaves are considered to have higher yield potential (Betsabe et al. 2017). First, upright leaves help increase the size of the wheat population per unit area, enabling reasonable dense planting and laying the foundation for higher wheat yields (Aisawi 2012). Simultaneously, with the flag leaf pointing upwards, the second and third leaves from the bottom can absorb more light energy, thereby improving the light energy utilization rate of the wheat canopy (Hussain et al. 2017). Furthermore, upright leaves can improve the microenvironment of light, temperature, and humidity within the wheat population, thus helping to mitigate wheat diseases. Recent studies have also found that upright leaves can optimize the light environment at the base of the wheat canopy, increase the ratio of red light to far-infrared light, thereby increasing the total number of tillers and the tiller-to-ear ratio (Xie et al. 2016).

[0003] However, leaf angle is a quantitative trait controlled by multiple genes and is easily influenced by the environment, making it very difficult to improve wheat leaf angle through traditional breeding methods. Identifying the major genes controlling wheat leaf angle, developing their linkage molecular markers, and establishing high-throughput gene detection technologies are effective means to achieve genetic improvement of wheat leaf angle. A previous study reported a CAPS marker and its application for detecting the flag-leaf angle QTL in Zhongmai 895 (CN109136402A). This patent constructed a DH population using Zhongmai 895 (smaller flag-leaf angle) and Yangmai 16 (larger flag-leaf angle) as parents. Genotypic analysis was performed using a 660K SNP chip to construct a high-density genetic map. Through multi-environment field trials, a major locus controlling flag-leaf angle, QFla.caas-1Ds, was identified on the wheat 1Ds chromosome, with a LOD value of 3.4–10.8, explaining 6.1%–9.1% of the phenotypic variation. However, this QTL is located on chromosome 1Ds and does not disclose any function of the QTL on wheat chromosome 5D that controls the flag leaf angle. Furthermore, the highest LOD value of this patented QTL is only 10.8, which can explain no more than 9.1% of phenotypic variation. Its genetic effect is relatively weak and it is difficult to play a significant role in genetic improvement on its own in actual breeding. Summary of the Invention

[0004] The purpose of this invention is to address the above-mentioned shortcomings of the prior art by providing a molecular marker for the major gene locus Qla.nau-5D related to the flag leaf angle of wheat and its application.

[0005] Another object of the present invention is to provide primers for the molecular marker and their applications.

[0006] Another object of the present invention is to provide a kit containing the molecular marker primers and its application.

[0007] The fourth objective of this invention is to provide a molecular marker identification method for the major gene locus Qla.nau-5D of the flag leaf angle in wheat and its application.

[0008] The fifth objective of this invention is to provide a method for screening wheat with an ideal flag leaf angle.

[0009] To address the aforementioned technical problems, this invention provides a primer pair for the molecular marker of the major gene locus Qla.nau-5D at the flag leaf angle of wheat, characterized in that it comprises an upstream primer WGRC8163-F and a downstream primer WGRC8163-R; the nucleotide sequence of the upstream primer WGRC8163-F is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer WGRC8163-R is shown in SEQ ID NO.2.

[0010] This invention provides a molecular marker WGRC8163 for the major gene locus Qla.nau-5D in wheat flag leaf angle. The key feature is that the genomic DNA of the wheat sample is amplified using the aforementioned primer pair, and the amplified products are separated by electrophoresis. The amplified products show either a 164 bp band or a 174 bp band, which is the molecular marker WGRC8163 for the major gene locus Qla.nau-5D in wheat. This molecular marker is a co-dominant marker, tightly linked to Qla.nau-5D; wheat materials containing Qla.nau-5D have a smaller flag leaf angle than wheat materials without Qla.nau-5D.

[0011] The present invention provides a reagent or kit containing the above-described primer pair or the above-described molecular marker WGRC8163.

[0012] Furthermore, the present invention provides a method for identifying the major gene locus Qla.nau-5D in wheat flag leaf angle using primer pairs of the above-mentioned molecular markers, characterized by comprising the following steps: using the genomic DNA of the wheat to be tested as a template, PCR amplification is performed using the upstream primer WGRC8163-F (CCGAGATGCCATAGATGTCCA) and the downstream primer WGRC8163-R (CAATCACAGCCAGAAACACCG) of the molecular marker WGRC8163 shown in SEQ ID NO.1 and SEQ ID NO.2, and then the amplification products are separated by electrophoresis. If the electrophoresis result shows a 164 bp band, the wheat to be tested contains Qla.nau-5D; if the electrophoresis result shows a 174 bp band, the wheat to be tested does not contain Qla.nau-5D; if the electrophoresis result shows two bands of 164 bp and 174 bp, it indicates that the wheat material to be tested is in a heterozygous state at this locus.

[0013] On the other hand, the present invention provides the application of primer pairs containing the above-mentioned primers or molecular marker WGRC8163 or reagents or kits containing the above-mentioned reagents or kits in the identification of the major gene locus Qla.nau-5D of flag leaf angle in wheat germplasm resources.

[0014] On the other hand, the present invention provides the application of the above-mentioned primer pair or the above-mentioned molecular marker WGRC8163 or the above-mentioned reagent or kit in the selection of wheat products with the major gene locus Qla.nau-5D of flag leaf angle.

[0015] On the other hand, the present invention provides the application of the above-mentioned primer pair or the above-mentioned molecular marker WGRC8163 or the above-mentioned reagent or kit in screening wheat with ideal flag leaf angle, wherein wheat material containing Qla.nau-5D has a smaller flag leaf angle than wheat material without Qla.nau-5D.

[0016] On the other hand, the present invention provides the application of the above-mentioned primer pair or the above-mentioned molecular marker WGRC8163 or the above-mentioned reagent or kit in cloning the major gene locus Qla.nau-5D of wheat flag leaf angle.

[0017] On the other hand, the present invention provides the application of the above-mentioned primer pair or the above-mentioned molecular marker WGRC8163 or the above-mentioned reagent or kit in the breeding of ideal plant type of wheat, wherein wheat material containing Qla.nau-5D has a smaller flag leaf angle than wheat material without Qla.nau-5D.

[0018] Beneficial effects

[0019] This invention targets the novel major gene locus Qla.nau-5D for the flag leaf angle in wheat, and for the first time internationally, has obtained the molecular marker WGRC8163 linked to it. This marker can accelerate the application of Qla.nau-5D in the breeding of ideal wheat plant architecture and can also be used for the cloning of the Qla.nau-5D gene.

[0020] 1. The molecular marker WGRC8163 can be used to transfer Qla.nau-5D into commercial varieties, thereby achieving genetic improvement of the flag leaf angle in wheat; this marker can also be used to combine Qla.nau-5D with other superior genes.

[0021] 2. Convenient Detection. WGRC8163 is a co-dominant marker, accurately identifying the presence or absence of Qla.nau-5D and distinguishing between homozygotes and heterozygotes. An electrophoresis result showing a 164 bp band indicates that the tested wheat material carries Qla.nau-5D; a 174 bp band indicates that the tested wheat material does not carry Qla.nau-5D; and two bands (164 bp and 174 bp) indicate that the tested wheat material is heterozygous at that locus. The difference between the two bands is 10 bp, making them easily distinguishable. This method offers advantages such as convenient detection, stable amplification, and easy band reading. Using the molecular marker WGRC8163 to detect the Qla.nau-5D gene locus, the presence and state of Qla.nau-5D can be used to predict the size of the flag leaf angle in wheat, thereby rapidly screening plants carrying Qla.nau-5D for use in wheat plant type breeding.

[0022] 3. Improve the efficiency of variety selection and identification, and save costs. Wheat leaf angle is controlled by multiple genes and is also influenced by the environment. Improving wheat leaf angle through traditional hybridization breeding methods is time-consuming, labor-intensive, difficult, and costly. By detecting the molecular marker Qla.nau-5D, a major gene locus related to wheat flag leaf angle, individual plants carrying Qla.nau-5D can be identified at the seedling stage, thereby eliminating non-target plants, significantly reducing phenotypic identification work, saving breeding costs, and greatly improving the efficiency of variety selection, achieving rapid and high-throughput genetic improvement of target traits.

[0023] 4. Reduce linkage burden. The flag leaf angle trait in wheat is often associated with some undesirable agronomic traits. In traditional breeding processes, improving the flag leaf angle may introduce unfavorable traits due to linkage burden. Using the molecular marker WGRC8163, which is associated with the major gene locus Qla.nau-5D for wheat flag leaf angle, linkage burden during selection can be reduced, selection accuracy can be improved, and unfavorable traits can be reduced.

[0024] 5. It can be used for research on cloning the major gene locus Qla.nau-5D at the wheat flag leaf angle. Cloning Qla.nau-5D requires tightly linked molecular markers. WGRC8163 is most tightly linked to Qla.nau-5D and can be used for recombinant identification, fine gene mapping, and map-based cloning. Attached Figure Description

[0025] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the accompanying drawings used in the description of the specific embodiments will be briefly introduced below.

[0026] Figure 1 This is a genetic linkage map of WGRC8163 and the major gene locus Qla.nau-5D for the flag leaf angle in wheat. The left side shows the molecular markers on the linkage map, the right side shows the genetic distances between markers, and the vertical boxes indicate the location of the major gene locus Qla.nau-5D for the flag leaf angle.

[0027] Figure 2 This is the amplification band pattern of WGRC8163. M is the standard molecular weight band of pUC19 / MspI. 1 represents the parental wheat variety Huaimai 33 containing Qla.nau-5D, 2 represents the parental wheat variety Yangmai 17 without Qla.nau-5D, 3 represents the near-isogenic line NIL-HM containing Qla.nau-5D, and 4 represents the near-isogenic line NIL-YM without Qla.nau-5D. The arrows indicate the specific amplification bands.

[0028] Figure 3 The flag leaf angle is the near-isogenic angle of the Qla.nau-5D line under artificial climate chamber conditions. NIL-YM is a near-isogenic line without Qla.nau-5D, and NIL-HM is a near-isogenic line containing Qla.nau-5D.

[0029] Figure 4 The mean flag leaf angle of the Qla.nau-5D near-isogenic line under artificial climate chamber conditions. NIL-YM is the near-isogenic line without Qla.nau-5D, and NIL-HM is the near-isogenic line containing Qla.nau-5D. ** indicates P < 0.01.

[0030] Figure 5 The mean flag leaf angle of the Qla.nau-5D near-isogenic line under field conditions. NIL-YM is the near-isogenic line without Qla.nau-5D, and NIL-HM is the near-isogenic line containing Qla.nau-5D. **** indicates P < 0.0001. Detailed Implementation

[0031] The technical solution of the present invention will now be described in detail with reference to the accompanying drawings and embodiments. The following embodiments are only used to more clearly illustrate the technical solution of the present invention and are therefore merely examples, not intended to limit the scope of protection of the present invention. Unless otherwise stated, the technical or scientific terms used in this application should have the ordinary meaning understood by those skilled in the art. As a professional agricultural research institution, the applicant has long preserved relevant germplasm materials, and the relevant wheat varieties are all publicly available from the market or existing germplasm banks.

[0032] Example 1: Obtaining the molecular marker WGRC8163 of the major gene locus Qla.nau-5D for the flag leaf angle in wheat.

[0033] (I) Construction of the recombinant inbred line Huaimai 33 / Yangmai 17

[0034] The wheat varieties Huaimai 33 and Yangmai 17 were crossed and continuously self-pollinated to obtain the F7 recombinant inbred line population, which included 231 lines.

[0035] (II) Construction of a high-density genetic map of the Huaimai 33 / Yangmai 17 recombinant inbred line population

[0036] Genotypic analysis of this population was performed using a 5K liquid chromatography-mass spectrometry (LC-MS) chip to obtain high-quality polymorphic SNPs. Linkage analysis was then conducted using QTLIciMapping Version 4.2 software to construct a high-density genetic map of this population.

[0037] (III) Phenotypic identification of the Huaimai 33 / Yangmai 17 recombinant inbred line population

[0038] The recombinant inbred line population of Huaimai 33 / Yangmai 17 was planted at the Liuhe Base of Jiangsu Academy of Agricultural Sciences and the Chuzhou Science and Education Innovation Park of Nanjing Agricultural University in 2024, 2025 and 2026. At flowering time, the flag leaf angle of each line was investigated using an angle meter, and 10 tillers of each line were measured.

[0039] (iv) Identification of gene loci controlling flag leaf angle using the Huaimai 33 / Yangmai 17 recombinant inbred line population

[0040] Based on the high-density genetic map and three-year field phenotypes of the Huaimai 33 / Yangmai 17 recombinant inbred line population, QTL genetic linkage analysis was conducted using MapQTLV6 software. Ultimately, a flag leaf angle QTL, Qla.nau-5D, was identified on wheat chromosome 5D, with a LOD of 13.3, explaining 23.3% of the phenotypic variation, and an additive effect of 9°. Figure 1 This QTL exhibits a strong effect and is stably expressed in all three environments, making it valuable for breeding applications.

[0041] (V) Development of practical molecular markers for Qla.nau-5D region polymorphism

[0042] DNA was extracted from the parents Huaimai 33 and Yangmai 17 and their recombinant inbred line populations using the SDS method. Sequence variation analysis was performed on the Qla.nau-5D region using the wheat reference genome sequence. Based on the obtained sequence variations, molecular markers were developed using PrimerServer2 software. The genotypes of Huaimai 33 and Yangmai 17 were detected using the obtained molecular markers. For markers that showed polymorphism between the parents, they were further used to detect the genotypes of the recombinant inbred line population.

[0043] The PCR amplification method used for the labeling was as follows: The PCR reaction system consisted of 12.5 μL of 10× buffer (1.25 μL), 25 mM MgCl2 (0.75 μL), 2.5 mM dNTPs (1 μL), forward and reverse primers (0.2 μM each), Taq polymerase (5 U / μL) (0.1 μL), template DNA (50 ng), and sterile water to a final volume of 12.5 μL. The PCR amplification program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 40 s, 59℃ annealing for 40 s, and 72℃ extension for 1 min, repeated 36 times; and a final extension at 72℃ for 10 min. Amplification was performed using an AppliedBiosystems PCR instrument. The amplified products were separated by electrophoresis on an 8% non-denaturing polyacrylamide gel, and then photographed using a UV transilluminator to record the results.

[0044] (vi) Obtaining the Qla.nau-5D linked molecular marker WGRC8163

[0045] Based on the above strategy, the molecular marker WGRC8163 was developed in the Qla.nau-5D region. Genotyping of the Huaimai 33 / Yangmai 17 recombinant inbred line population was conducted using this marker, and linkage analysis of the 5D chromosome molecular marker was performed using QTL IciMapping Version 4.2 software. A genetic map of this chromosome was constructed, clearly showing that WGRC8163 co-segregates with the left SNP marker 5D21445676 and has a genetic distance of 2.87 cM from the right marker 5D47817459. QTL genetic mapping showed that WGRC8163 has a LOD of 13.3 and is tightly linked to the flag leaf angle phenotype. Figure 1 ).

[0046] Example 2: Application of the molecular marker WGRC8163 at the major gene locus Qla.nau-5D in wheat flag leaf angle

[0047] The recombinant inbred line population of Huaimai 33 / Yangmai 17 was screened using the molecular marker WGRC8163 at the major gene locus Qla.nau-5D of the wheat flag leaf angle. The line RIL023, heterozygous at this locus, exhibited two genotypes: 164 bp and 174 bp. This line was self-pollinated to obtain the F2 population. Using WGRC8163, homozygous plants of the Huaimai 33 type with the 164 bp genotype were selected and named NIL-HM, and homozygous plants of the Yangmai 17 type with the 174 bp genotype were selected and named NIL-YM. Figure 2 The amplification method was the same as in Example 1. NIL-HM and NIL-YM are near-isogenic lines. In 2026, NIL-HM and NIL-YM were planted in the field and artificial climate chamber of the Chuzhou Science and Education Innovation Park of Nanjing Agricultural University. At flowering time, the flag leaf angle of each line was investigated using an angle meter. The results showed that under artificial climate chamber conditions, the flag leaf angle of NIL-HM was 24.6° smaller than that of NIL-YM, a decrease of 40.9%. Figure 3 , Figure 4 In field conditions, compared to NIL-YM, NIL-HM exhibited a 15.9° reduction in flag leaf angle, a decrease of 29.0%. Figure 5 This demonstrates that the molecular marker WGRC8163 provided by this invention can accurately screen for materials containing Qla.nau-5D, effectively improving the flag leaf angle of wheat materials, thereby greatly improving breeding selection efficiency.

[0048] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A primer pair of WGRC8163, a molecular marker tightly linked to the major gene locus Qla.nau-5D in wheat flag leaf angle, characterized in that, It includes an upstream primer WGRC8163-F and a downstream primer WGRC8163-R; the nucleotide sequence of the upstream primer WGRC8163-F is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer WGRC8163-R is shown in SEQ ID NO.

2.

2. A molecular marker WGRC8163 for the major gene locus Qla.nau-5D of wheat flag leaf angle, characterized in that, The genomic DNA of the wheat to be tested was amplified using the primer pair described in claim 1. The amplification products were separated by electrophoresis. The amplification products showed a 164 bp band or a 174 bp band, which is the molecular marker WGRC8163 of the major gene locus Qla.nau-5D for the flag leaf angle of wheat. The molecular marker is a codominant marker and is tightly linked to Qla.nau-5D. If the amplification product is a 164 bp band, it indicates that the wheat to be tested contains Qla.nau-5D. If the amplification product is a 174 bp band, it indicates that the wheat to be tested does not contain Qla.nau-5D. Wheat materials containing Qla.nau-5D have a smaller flag leaf angle than wheat materials without Qla.nau-5D.

3. A kit for detecting the major gene locus Qla.nau-5D at the flag leaf angle in wheat, characterized in that, Contains the primer pair as described in claim 1.

4. A molecular marker method for the major gene locus Qla.nau-5D at the flag leaf angle in wheat, characterized in that, Includes the following steps: Using the genomic DNA of the wheat to be tested as a template, PCR amplification was performed using the upstream primer WGRC8163-F and the downstream primer WGRC8163-R of the molecular marker WGRC8163 shown in SEQ ID NO.1 and SEQ ID NO.

2. The amplification products were then separated by electrophoresis. If the electrophoresis result showed a 164 bp band, the wheat to be tested contained Qla.nau-5D. If the electrophoresis result showed a 174 bp band, the wheat to be tested did not contain Qla.nau-5D. If the electrophoresis result showed two bands, 164 bp and 174 bp, it indicated that the wheat material to be tested was in a heterozygous state at that site.

5. The application of the primer pair of claim 1, the molecular marker WGRC8163 of claim 2, or the reagent or kit of claim 3 in identifying the major gene locus Qla.nau-5D for flag leaf angle in wheat germplasm resources.

6. The application of the primer pair of claim 1, the molecular marker WGRC8163 of claim 2, or the reagent or kit of claim 3 in the selection of wheat products with the major gene locus Qla.nau-5D of flag leaf angle.

7. The application of the primer pair of claim 1, the molecular marker WGRC8163 of claim 2, or the reagent or kit of claim 3 in screening for ideal flag-leaf angle wheat, characterized in that, Wheat materials containing Qla.nau-5D have a smaller flag leaf angle than wheat materials without Qla.nau-5D.

8. The use of the primer pair of claim 1, the molecular marker WGRC8163 of claim 2, or the reagent or kit of claim 3 in cloning the major gene locus Qla.nau-5D at the flag leaf angle.

9. The application of the primer pair of claim 1, the molecular marker WGRC8163 of claim 2, or the reagent or kit of claim 3 in the breeding of ideal wheat plant type, characterized in that, Wheat materials containing Qla.nau-5D have a smaller flag leaf angle than wheat materials without Qla.nau-5D.

Images